ID: 927696439

View in Genome Browser
Species Human (GRCh38)
Location 2:25242634-25242656
Sequence CAGTCTCAACCCAGGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927696439_927696442 -8 Left 927696439 2:25242634-25242656 CCAGGGTCCCTGGGTTGAGACTG 0: 1
1: 0
2: 1
3: 24
4: 250
Right 927696442 2:25242649-25242671 TGAGACTGCCTATCTCCCTCTGG 0: 1
1: 0
2: 1
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927696439 Original CRISPR CAGTCTCAACCCAGGGACCC TGG (reversed) Intronic
900292568 1:1929751-1929773 CAGTCTCAACCTGGGAGCCCTGG + Intronic
900806252 1:4769983-4770005 TATTCACCACCCAGGGACCCCGG - Intronic
900888466 1:5432103-5432125 CAGACCCAACTCAGGGATCCTGG - Intergenic
901510969 1:9717889-9717911 CAGGTTCAGCCCAGGGATCCGGG + Intronic
902363918 1:15958619-15958641 CAGCCTTATCCCAGGGCCCCTGG - Intronic
902526970 1:17065476-17065498 CAGGCTTAACCCAGGGGCCCAGG - Intergenic
903127733 1:21259082-21259104 CATTCTCATCCCAGCCACCCAGG - Intronic
904310350 1:29625317-29625339 CAGTCTCACCCCATGGAGCTGGG - Intergenic
904835317 1:33331949-33331971 CAGTCTCAAGGCAGGGACGAAGG + Intronic
904942496 1:34174857-34174879 GAATCTGAACCCAGGGACTCTGG + Intronic
906775875 1:48529149-48529171 CAGTGTCAAGCCAGGGACCTAGG - Intergenic
908382951 1:63613672-63613694 AAGTCTTAACCCAGGAACCTGGG - Intronic
908440016 1:64143927-64143949 TAGTCTCAACCCAGCAGCCCAGG - Intronic
908702705 1:66919853-66919875 AAGTCTCATCCCAGGGACAAGGG + Intronic
911565490 1:99458504-99458526 CAGTCACCACCCAGGAACTCAGG + Intergenic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
914201751 1:145491343-145491365 CCTTCAGAACCCAGGGACCCCGG - Intergenic
914313617 1:146488419-146488441 CCTTCAGAACCCAGGGACCCTGG - Intergenic
914480875 1:148064467-148064489 CCTTCAGAACCCAGGGACCCCGG - Intergenic
914500731 1:148244962-148244984 CCTTCAGAACCCAGGGACCCTGG + Intergenic
915728502 1:158036062-158036084 CAGTCAAAACCCAGGGATACTGG + Intronic
916179943 1:162074573-162074595 CAGTTTGAAGCCAGGGAACCAGG - Intronic
916408460 1:164521074-164521096 CAGTCTCAACTCTGTCACCCAGG - Intergenic
916700815 1:167292817-167292839 AGGTCTCATCCCAGGGATCCAGG + Intronic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
919532046 1:198734323-198734345 CAGTTTCATCCCTGGGACCTAGG - Exonic
919817018 1:201448137-201448159 CCGCCCCCACCCAGGGACCCTGG + Intergenic
921870640 1:220135930-220135952 CACTCCCACCCCAGGGCCCCTGG + Intronic
922064547 1:222124340-222124362 CAGTCTCAACCCAAAGATTCAGG - Intergenic
922339975 1:224647461-224647483 CAGTCTCCACCCCGACACCCAGG - Intronic
922795382 1:228337149-228337171 CAGACACACCCCAGGGACCCTGG - Intronic
924940870 1:248811869-248811891 CAGATTCAAGCCAGGAACCCTGG + Exonic
1063370134 10:5515854-5515876 CAGCCACCACCCAGGGACTCTGG - Intergenic
1063550379 10:7027076-7027098 GAGTCTGAACCCAGGCAGCCGGG + Intergenic
1066661480 10:37741361-37741383 CAGGCCCAACCCAGGACCCCTGG - Intergenic
1067846207 10:49723754-49723776 TAGTCTCAACGCTGGGACCATGG - Intergenic
1069115411 10:64499209-64499231 AAGTCATAACCCAGGGACTCAGG - Intergenic
1070486072 10:76932940-76932962 CAGTACCAACCCAGGGCCCAAGG - Intronic
1072036625 10:91568848-91568870 CAGTCTGAAAGCAGAGACCCAGG + Intergenic
1073122016 10:101127753-101127775 AAGTCTCCTCCCAGGTACCCTGG + Intronic
1073185786 10:101614331-101614353 CCCTCTGAACCCAGGGACCAGGG - Intronic
1074444109 10:113504342-113504364 CAGGCTCATCCCAAGGTCCCAGG - Intergenic
1075711333 10:124532267-124532289 GAATCTCAGCCCAGGGCCCCAGG + Intronic
1075784089 10:125036812-125036834 CAGTTTGCACCCAGGAACCCGGG - Intronic
1077362313 11:2146132-2146154 CAGACTCACCCCATGGAGCCTGG + Intronic
1081775661 11:45674523-45674545 CAGTTTCACCCCAGGGAATCTGG - Intergenic
1084415722 11:69031982-69032004 CAGTCTCAAGACAGGGGCCCAGG - Intergenic
1085032311 11:73280183-73280205 TAGTCTGAACCCAGGCAGCCTGG - Intronic
1086480217 11:87227393-87227415 CAGTCTTAACCTGGAGACCCAGG + Intronic
1087391149 11:97537058-97537080 CAGCCTCAAGCCTGAGACCCAGG + Intergenic
1088544526 11:110946210-110946232 CCCTGTCAACCCAGGGTCCCAGG + Intergenic
1089406709 11:118203476-118203498 CAGTATCCACCTAGGGAACCTGG - Exonic
1090039941 11:123281904-123281926 CAGTCTCAGCCCATGGACTTTGG - Intergenic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1090829891 11:130413984-130414006 CAGTGTCAACCCACTGACCGAGG + Intronic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1098282113 12:68872276-68872298 CAGTCTCAACTCCGTCACCCAGG + Intronic
1098818994 12:75207125-75207147 CAGGGTAAACCCAGGGACCCCGG - Intronic
1099255778 12:80309676-80309698 CAGTATCCACCCAGGAAGCCAGG - Intronic
1102433333 12:112900616-112900638 CCCTCTCAACCCAGGGTTCCAGG + Intergenic
1103727388 12:123004894-123004916 AAGGATCAACCCAGGCACCCTGG - Intronic
1103839979 12:123855119-123855141 CAGACTCAACACAGGAGCCCCGG - Intronic
1104608356 12:130206133-130206155 CAGCCTCACCCACGGGACCCAGG + Intergenic
1105214173 13:18274669-18274691 CAGTCTGCACTCAGGGCCCCAGG - Intergenic
1108260077 13:48647157-48647179 CAGTCTCAACCCAGGGTAGGTGG + Intergenic
1110090260 13:71436030-71436052 CAGTCAGACCCCAGGGACCAGGG - Intergenic
1110333590 13:74300834-74300856 CAATCTCATCCCAGGAACCCAGG - Intergenic
1112402844 13:99090386-99090408 CAGCCTCATCCCAGGTAGCCAGG - Intergenic
1117786608 14:59292245-59292267 CACTCTCGACCCAGGGAAACAGG + Intronic
1121322805 14:93002431-93002453 GAGTCTGAACCCAGGGCCTCTGG + Intronic
1121817960 14:96942987-96943009 CAGTTTGAACCCAGGCAGCCTGG + Intergenic
1122863173 14:104591625-104591647 CAGCCTCACTCCCGGGACCCAGG + Intronic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125011403 15:34879934-34879956 CTCCCACAACCCAGGGACCCAGG + Intronic
1126157241 15:45576968-45576990 CAGTCTTCACTCAGAGACCCAGG - Intergenic
1126466431 15:48965078-48965100 CAGAAGCAACACAGGGACCCAGG - Intergenic
1126548780 15:49904003-49904025 CAGTCTGAACCCAGGTTTCCAGG - Intronic
1128151760 15:65367637-65367659 CACTCTCCACCCAGTGTCCCAGG + Intronic
1131177961 15:90221568-90221590 CAGAGTCAGCCCAGGAACCCTGG - Intronic
1132849955 16:2020454-2020476 CAGGCTCGACCCTGGCACCCGGG + Intronic
1133062097 16:3181728-3181750 CAGACTGAACCCAGGAACCCGGG - Intergenic
1133130055 16:3671434-3671456 CAGTCACAACCCTGGGGCACAGG + Intronic
1133226937 16:4345415-4345437 CAGTCACTACGCAGGGTCCCGGG + Intronic
1133270291 16:4608064-4608086 CAGTCACATCCCTGGGAGCCAGG + Intergenic
1135643115 16:24138150-24138172 CAGGTTCAAACCAGGGAGCCTGG + Intronic
1137231269 16:46569674-46569696 CAGTCTCAACCAAGGAAGCCAGG - Intergenic
1137250889 16:46740062-46740084 CAGTCTGATGCCAGGGAGCCTGG - Exonic
1138890041 16:61130735-61130757 CATTCACAATCCAGGGACACTGG - Intergenic
1139415751 16:66807927-66807949 CAGTCTCACCACAGTCACCCAGG + Intronic
1140204522 16:72922559-72922581 CACCCTCAACCCAGGGACCATGG + Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1143096027 17:4478881-4478903 CAGCCCCAACGCAGGGAGCCAGG + Intronic
1147026154 17:37586072-37586094 CAGCCTCAACCTCGGGGCCCAGG + Intronic
1150213581 17:63454848-63454870 CAGTCTCTATCAGGGGACCCAGG - Intergenic
1150377049 17:64689971-64689993 CAGTCTCAATCCATTGACCATGG - Intergenic
1150594088 17:66588998-66589020 AAGTCTCAAACAAGTGACCCTGG - Intronic
1152534283 17:80941412-80941434 CAGCCCCATCCCAGGGACCCTGG + Intronic
1152721556 17:81926375-81926397 CAGTCTCAACCCAGACTCCAGGG + Intronic
1154305527 18:13228034-13228056 CAGTCTCAACCCAGGGAGATGGG - Intronic
1157153319 18:45240984-45241006 AAGCTTCAACCCAGGGAACCTGG + Intronic
1157678275 18:49583698-49583720 CTGTCTCAACCCCGCAACCCCGG + Exonic
1157731719 18:50009916-50009938 CATTTTCACCCCAGGAACCCAGG - Intronic
1159852373 18:73539874-73539896 AAATCTCAACCCAGGGAACAAGG + Intergenic
1160460835 18:79037061-79037083 CACTCTCCACCCAGGCATCCTGG + Intergenic
1160460883 18:79037289-79037311 CAGTTTCCACCCAGGCATCCTGG + Intergenic
1160460901 18:79037365-79037387 CAGTTTCCACCCAGGCATCCTGG + Intergenic
1160460936 18:79037517-79037539 CAGTTTCCACCCAGGCATCCTGG + Intergenic
1160460972 18:79037667-79037689 CAGTTTCCACCCAGGCATCCTGG + Intergenic
1160692892 19:467902-467924 CAGCCACAACTCAGGGCCCCTGG - Intronic
1161059538 19:2208079-2208101 CAGACCCCACCCATGGACCCTGG - Intronic
1161086904 19:2339610-2339632 CCAGCTCAACCCAGGGACGCGGG + Intronic
1161373952 19:3929345-3929367 TGGGCTCAACCCAGGGACCTGGG + Intergenic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1163349865 19:16769651-16769673 GAGTCCCAGCCCAGGGCCCCCGG - Intronic
1164807155 19:31125873-31125895 CAGTCACAAGCCAGGGAACATGG - Intergenic
1165455480 19:35908118-35908140 CAAGCTGAGCCCAGGGACCCGGG + Intronic
1165472798 19:36013276-36013298 CAGTCCCAACCCAAGAACTCAGG + Intronic
1166010082 19:39935284-39935306 CCACCTCCACCCAGGGACCCAGG - Intergenic
1166566573 19:43769209-43769231 CAGTAGAAACCCAGGTACCCAGG + Intronic
1167307815 19:48719297-48719319 GGGTCTCAACCCTGGGATCCTGG + Intronic
1167383931 19:49153274-49153296 CAGTAGCCACACAGGGACCCTGG + Exonic
1167713370 19:51125616-51125638 CATCCTCATCCCAGGCACCCTGG + Exonic
925210219 2:2038959-2038981 CAGTCACAACCCAGTGTGCCAGG - Intronic
925302820 2:2829058-2829080 CAGGTTCATCCCAGGGACTCTGG - Intergenic
925349287 2:3189799-3189821 AAATATCAACCCAGGCACCCGGG - Intronic
927100788 2:19786297-19786319 CAGGCTCAAGCCAGGGCCCAGGG + Intergenic
927206827 2:20616380-20616402 CAGCTTCAGCCCTGGGACCCAGG - Intronic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
927964125 2:27258679-27258701 CACTCTCCACCCAGAGTCCCAGG - Intronic
928323400 2:30301592-30301614 CTGTCTGGACCCAGGCACCCTGG + Intronic
932210730 2:69927560-69927582 CAGTCTCCTACCTGGGACCCTGG + Intronic
934153754 2:89175256-89175278 CAGGCTCAACCCATGGAGCCAGG + Intergenic
934155397 2:89195020-89195042 CAGGCTCAACTCAGGAAGCCAGG + Intergenic
934160353 2:89243740-89243762 CAGGCTCCACCCAGGAAGCCAGG + Intergenic
934196632 2:89842382-89842404 CAGGCTCCACCCAGGAAGCCAGG - Intergenic
934206922 2:89938698-89938720 CAGGCTCCACCCAGGAAACCAGG - Intergenic
934211926 2:89987734-89987756 CAGGCTCAACTCAGGAAGCCAGG - Intergenic
934213484 2:90006676-90006698 CAGGCTCAACCCATGGAGCCAGG - Intergenic
934300146 2:91772081-91772103 CAGTCTGCACTCAGGGCCCCAGG + Intergenic
934935724 2:98463953-98463975 CGGTCTCCACCCAGTGAACCTGG + Intronic
937183488 2:120016402-120016424 CAGTCTCAACCTAGTCCCCCAGG - Intronic
937377936 2:121350497-121350519 CAGTCTCTTCCCAGAGCCCCAGG - Intronic
937626728 2:124052458-124052480 CCCTCTCAACCAAGGGTCCCAGG + Intronic
938069943 2:128303036-128303058 CAGTCTAAACCCCAGGAGCCAGG + Intronic
939176161 2:138749942-138749964 CAGGTTGAACCCAGGAACCCAGG + Intronic
946576484 2:221081453-221081475 CAGTCTCAACCAGGTGACCTTGG - Intergenic
946706068 2:222460078-222460100 CAGTCAAAACCCAGGGCCTCCGG + Intronic
948918182 2:241048840-241048862 CAGTCTGGACCTACGGACCCCGG - Intronic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1169488968 20:6055620-6055642 CAGTCACCTCCCAGGGAGCCTGG + Intergenic
1170573776 20:17647660-17647682 AGGTGTCAACCCAGGGACTCTGG + Intronic
1171186337 20:23126677-23126699 CAGCCTAAACCCAAGGCCCCAGG - Intergenic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172175682 20:32970627-32970649 CAGCCTCAAGCCAGGGGCTCAGG - Intergenic
1173039832 20:39451936-39451958 CAGTCTCAACCCAAAGATACTGG - Intergenic
1174145872 20:48452165-48452187 AAGTCACAAACCAGGGTCCCTGG + Intergenic
1175963093 20:62646918-62646940 CAGTCTCCACCCACTGAACCTGG - Intronic
1176060122 20:63168872-63168894 CAGGCCCCAGCCAGGGACCCGGG + Intergenic
1178403357 21:32305906-32305928 CAGGTTCTACCCAGGGCCCCAGG + Intronic
1179909980 21:44442435-44442457 CAGCCTCGTCCCAGGGTCCCTGG - Exonic
1181168310 22:20994819-20994841 CAGAGTCAAGCCAGGGCCCCAGG - Intronic
1181179117 22:21054952-21054974 CACTCACACCCCAGGAACCCTGG - Intronic
1181467164 22:23116470-23116492 CAGTGACTACCCAGGGACCAGGG - Intronic
1181555876 22:23671442-23671464 CAGTCTGCACTCAGGGCCCCAGG - Intergenic
1181698501 22:24607211-24607233 CAGTCTGCACTCAGGGCCCCAGG + Intronic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1182075959 22:27495533-27495555 CAGTCTCAACCTCGGGAGGCAGG - Intergenic
1183585456 22:38750711-38750733 CAGTCACAGCCCAGGGCACCAGG + Intronic
1184238770 22:43200623-43200645 CAGTCTCACACCAGGGAACTTGG - Exonic
1184461375 22:44640046-44640068 CAGAGCCAACCCAGGGTCCCAGG + Intergenic
1184461401 22:44640120-44640142 CAGAGCCAACCCAGGGTCCCAGG + Intergenic
1184461427 22:44640194-44640216 CAGAGTCAACCCAGGGCCCCAGG + Intergenic
1184663112 22:45974636-45974658 CAGGCCCCACCCAGGGCCCCTGG - Intronic
1184743863 22:46444828-46444850 CAGCCACAAGCCAGGGACGCTGG - Intronic
1184784038 22:46663213-46663235 CAGCCTCAGCCCAGGGACCGGGG - Intronic
1185060139 22:48602350-48602372 CAGCCGTCACCCAGGGACCCTGG - Intronic
1185060287 22:48603076-48603098 CAGCCATCACCCAGGGACCCTGG + Intronic
950769368 3:15299102-15299124 CAGTCAGCACCCAGGGAGCCAGG + Intronic
951806258 3:26647324-26647346 CTCTCTCAACCCAGAGATCCTGG + Intronic
952493428 3:33894299-33894321 CAGTTTCACCCCAGGGATGCAGG - Intergenic
953228040 3:41038487-41038509 CAGTCAAATCCCATGGACCCAGG + Intergenic
953912072 3:46898333-46898355 CAGTCAGAGCCCTGGGACCCAGG - Intronic
954610771 3:51943517-51943539 CAGCAGCAACCCCGGGACCCAGG + Exonic
954671078 3:52291691-52291713 CTATCCCAACCCAGGGAACCAGG - Intronic
954715218 3:52523563-52523585 CAGACTCACCACAGGGGCCCAGG - Exonic
958922279 3:100120873-100120895 CCGAGTCAACCCAGGCACCCTGG + Intronic
962535791 3:136327824-136327846 CTGGCTCAACCTAGGGGCCCTGG - Intronic
967050800 3:185782803-185782825 CAGTCCCCACCCTGGGATCCTGG - Intronic
967194808 3:187017052-187017074 CAGCTTCAATCCAGGGCCCCAGG - Intronic
967948622 3:194823570-194823592 CAGGCCCAACCCTGGTACCCTGG + Intergenic
968029448 3:195470859-195470881 CTTTCTAAATCCAGGGACCCAGG + Intergenic
968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG + Intergenic
968613604 4:1567769-1567791 CAGCCCCAGCCCAGGGCCCCCGG + Intergenic
969657102 4:8504740-8504762 CTGTCACAACCCAGGCACCCTGG + Intergenic
971018442 4:22511662-22511684 AAGGCTCAAACCAGGGAGCCTGG + Intronic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
975195299 4:71517894-71517916 CAGTTCCAAACCATGGACCCAGG - Intronic
976002071 4:80386105-80386127 CAGTCTGCCCCCAGGGAGCCTGG + Intronic
977565036 4:98571997-98572019 CAGTCTCAACTCTGTCACCCAGG + Intronic
978663588 4:111155534-111155556 ATGTCACAACCCAGGGACACAGG - Intergenic
980415847 4:132486457-132486479 CACTCACAACGCAGGGGCCCTGG + Intergenic
981663042 4:147189826-147189848 CAGTAAGAACACAGGGACCCAGG + Intergenic
982161839 4:152578264-152578286 GAGCCTCAATCCAGAGACCCTGG - Intergenic
984837379 4:184034194-184034216 AAGTCTCACCCCAAAGACCCAGG - Intergenic
985535834 5:465327-465349 CAGCCTCCACCCCGGGACTCGGG + Intronic
985754902 5:1707742-1707764 CAGTCTGCACACAGGGGCCCAGG + Intergenic
985970975 5:3378058-3378080 GACTCTCAACCCAGAGCCCCAGG + Intergenic
986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG + Intergenic
987277152 5:16374228-16374250 CAGTCTCAACCCAGTTTGCCAGG + Intergenic
989183481 5:38600901-38600923 CAGTATCAACCCAGGGCTGCTGG - Intronic
989266258 5:39477400-39477422 AAGTCACAACCTAGGGACCAGGG + Intergenic
992225858 5:74619271-74619293 CAGTGCCCACCCAGGGACCTTGG + Intergenic
992806447 5:80342537-80342559 GAGTCTCAACCCTGTCACCCAGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994237823 5:97385341-97385363 GAATCTCAACTCAGGGATCCAGG - Intergenic
996197279 5:120624515-120624537 GAGTCTCAAACCAGGCAACCTGG - Intronic
997398411 5:133582627-133582649 CAGTGTCAACCCATGGGCCATGG + Intronic
1001409997 5:171504589-171504611 CTGTCGCAAGCCAGAGACCCAGG - Intergenic
1002880850 6:1251112-1251134 AAGTCTCAAGCAAGGGTCCCGGG - Intergenic
1003007406 6:2394462-2394484 CAGTCTCAACCCAGTGCCCTCGG + Intergenic
1003776733 6:9375215-9375237 CATTCTCAACCTCGGGACCATGG - Intergenic
1005685302 6:28248066-28248088 CAGGCTCACTCCAGGGTCCCAGG - Exonic
1007707389 6:43799185-43799207 CAGCCCCATCCCAGGGGCCCAGG - Intergenic
1015795420 6:137006422-137006444 CAGGCTCAATCCAGGGACCAGGG - Intronic
1016503228 6:144746508-144746530 GAGTCTCAACTCTGGCACCCAGG + Intronic
1016822221 6:148357509-148357531 CAGTTTCCACCCAGGCTCCCTGG + Intronic
1016857386 6:148684586-148684608 CAGTCTGCTCCCAAGGACCCTGG + Intergenic
1017664223 6:156703700-156703722 CAGTGTCTGCCCAGGGACACAGG - Intergenic
1018131641 6:160737544-160737566 CAGTCCAATCCCAGGGAACCTGG + Intronic
1019417872 7:935532-935554 GAGGCTCAGCCCAGGGACCCCGG + Intronic
1020129114 7:5549482-5549504 CAGTTACAGCCCAGAGACCCAGG - Intronic
1020382966 7:7566723-7566745 CAGTCCCAGCCTAGGAACCCGGG + Intergenic
1022799105 7:33758578-33758600 AAATTTCTACCCAGGGACCCAGG - Intergenic
1025206642 7:56996842-56996864 CTGTCTCTACCCAGGCACCGTGG + Intergenic
1025236684 7:57239430-57239452 CAAACCCAACCCAGAGACCCTGG + Intergenic
1025665298 7:63580085-63580107 CTGTCTCTACCCAGGCACCGTGG - Intergenic
1027216880 7:76189511-76189533 CAGTCGGAACACGGGGACCCAGG + Intergenic
1031972326 7:128073824-128073846 CTGTCTCATCCCGAGGACCCAGG - Intronic
1033165349 7:139035164-139035186 CAGTCTCACCCCAGGAAACAGGG - Intronic
1033944487 7:146699487-146699509 TGGTCACAACCCAGGGGCCCAGG - Intronic
1035488811 7:159253908-159253930 CAGACTCAACCCAAGGGCCCAGG + Intergenic
1036814000 8:11887783-11887805 CAGTCTCAACGCAGCGCCCGAGG + Intergenic
1037048794 8:14342933-14342955 CACACACAGCCCAGGGACCCTGG - Intronic
1037689701 8:21171771-21171793 GAGTCTCACCCCAGGGTCCCCGG - Intergenic
1037914458 8:22764466-22764488 CAGCCAAAACCCAGGGACCAAGG + Intronic
1038207607 8:25482101-25482123 GAGTCTAAACACAGGGCCCCTGG - Intronic
1038773000 8:30501380-30501402 CAGTTTCATGCCAGGGAGCCAGG - Intronic
1039014499 8:33130863-33130885 CAGTCCAAACCCAGGTAGCCTGG - Intergenic
1044922886 8:97184731-97184753 CCTTCTCAACACAGGGCCCCAGG + Intergenic
1045017077 8:98009550-98009572 CCATCTCATCCCAGGGCCCCTGG - Intronic
1045112855 8:98949910-98949932 CAGGCAGAACCCAGGTACCCTGG + Intronic
1049210686 8:141385149-141385171 CTGGCCCCACCCAGGGACCCAGG - Intergenic
1050663062 9:7904968-7904990 CAGTATGAACCCAGGCAGCCTGG + Intergenic
1052459291 9:28741874-28741896 CAGGCTAAACCCAAGGCCCCAGG - Intergenic
1053180296 9:35962502-35962524 CAGTGTCTAGCCAGGGATCCAGG - Intergenic
1055665267 9:78546661-78546683 GCGTATCAACCTAGGGACCCAGG - Intergenic
1056019290 9:82424471-82424493 CACTCTTCACCCAGGGATCCAGG + Intergenic
1056761490 9:89418679-89418701 CAGTCTCAAGACAGGGATCGTGG + Exonic
1058434716 9:104951748-104951770 AAGTCTCAGCCCAGGGCACCTGG + Intergenic
1062268202 9:135696935-135696957 CAGCCTCTGCCCAGGGGCCCTGG + Intronic
1062280866 9:135751072-135751094 AAGGCTCAGCCCTGGGACCCGGG - Intronic
1062525046 9:136974811-136974833 CTGTCTCCACCCTGGGGCCCCGG - Intergenic
1062585908 9:137249936-137249958 CAGTCGCAAGCCTGGGCCCCTGG - Intergenic
1185669490 X:1794845-1794867 CCCTCTCCACCCAGGGACGCTGG - Intergenic
1185702114 X:2238536-2238558 CAGATTCTCCCCAGGGACCCTGG + Intronic
1187547491 X:20267391-20267413 CAGTCCCGAGCCAAGGACCCGGG + Intergenic
1187871947 X:23771824-23771846 TAGTCTCAGCCCAGGTACTCAGG + Intergenic
1190043666 X:47094020-47094042 CAGTCTCAGCCCAGCTACTCGGG - Intergenic
1190365161 X:49686135-49686157 CAGTCACAACCCATGGTCCTAGG + Intergenic
1194746911 X:97638096-97638118 CAGAGTTATCCCAGGGACCCAGG - Intergenic
1195239238 X:102934775-102934797 TAATCTCAAACCAGGGACTCAGG - Intergenic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1199881061 X:151974545-151974567 GAGTCTCCATCCCGGGACCCGGG - Intronic
1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG + Intergenic