ID: 927698523

View in Genome Browser
Species Human (GRCh38)
Location 2:25252798-25252820
Sequence TAGGAGGCCCAGGAAGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927698519_927698523 7 Left 927698519 2:25252768-25252790 CCAAAAAAAAAAAAAGAAAAAGC 0: 2
1: 323
2: 2974
3: 22170
4: 32329
Right 927698523 2:25252798-25252820 TAGGAGGCCCAGGAAGCTGTAGG 0: 1
1: 0
2: 4
3: 36
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927698523 Original CRISPR TAGGAGGCCCAGGAAGCTGT AGG Intronic
900310821 1:2032435-2032457 AGGGAGGCCCAGGAAGCAGAGGG - Intergenic
900352318 1:2241072-2241094 GAGGGAGCCCAGGATGCTGTGGG + Intronic
900511146 1:3061789-3061811 TTGGACTCCCAGGAAGCTGGAGG + Intergenic
900983667 1:6060659-6060681 TGGGAGGCCCAGGCAGGTGGCGG + Intronic
901456531 1:9366239-9366261 GAGAAGGCCCAGGCAGCTCTGGG + Intronic
901880945 1:12193330-12193352 TGGGAGGCCAAGGAGGCTGGAGG + Intronic
902447782 1:16478151-16478173 TAGGAGGCCCAGGACCCAGTGGG + Intergenic
902467683 1:16628362-16628384 TAGGAGGCCCAGGACCCAGTGGG + Intergenic
902506899 1:16944366-16944388 TAGGAGGCCCAGGACCCAGTGGG - Intronic
902719773 1:18296186-18296208 AAGGGGTCCCAGGAAGCTGATGG - Intronic
903478778 1:23638219-23638241 GAGGAGGCCCAGGCAGAAGTGGG + Intronic
904451270 1:30613880-30613902 CAGGAGTCCCAGAAAGCTTTTGG - Intergenic
905494835 1:38376760-38376782 TTGGAGGCCCCAGAATCTGTGGG - Intergenic
906109340 1:43312669-43312691 TAGGAGACACGGGAGGCTGTAGG + Intronic
907243407 1:53092872-53092894 CAGGAGCCCCAGGAAGCTCAGGG - Intronic
907552922 1:55319450-55319472 TGTGATGCCCAGGGAGCTGTGGG + Intergenic
907715368 1:56921600-56921622 CAGGAAGCCCAGGGACCTGTGGG + Intergenic
908682882 1:66682134-66682156 GAGGAGGCCCAGGAGGCCCTGGG - Exonic
909460295 1:75904583-75904605 TAGGAGGTCAAGTAAGCAGTGGG - Intronic
912687124 1:111776326-111776348 TAGGGGGTCAAGGAAGCTTTGGG - Intronic
913578014 1:120196956-120196978 GAGGAGGCCCAGGGAACTGACGG + Intergenic
913630158 1:120701396-120701418 GAGGAGGCCCAGGGAACTGACGG - Intergenic
914559930 1:148808376-148808398 GAGGAGGCCCAGGGAACTGACGG + Intronic
914612903 1:149321839-149321861 GAGGAGGCCCAGGGAACTGACGG - Intergenic
916599242 1:166276155-166276177 CAGGAGGCCCAGGAAGTCCTGGG - Intergenic
917766886 1:178229925-178229947 AAGGAGAACCAGGAAGCTTTTGG - Intronic
919729906 1:200907063-200907085 TAGGAGGCCAAGGCAGCAGATGG - Intronic
920102408 1:203525641-203525663 CAGGAGGCCCAGGAAGCTGCTGG + Intergenic
920500660 1:206483027-206483049 CAGGAGGGCCAGGGAGCTTTGGG - Intronic
920523723 1:206649454-206649476 GGGGAGCACCAGGAAGCTGTTGG + Intronic
921155150 1:212433199-212433221 CCGGCGGCCCAGGAAGCTCTGGG + Intronic
921544605 1:216459698-216459720 TAAGAGGACCAGGAAGAAGTAGG - Intergenic
922501229 1:226098436-226098458 AAGGATGCCCAGAAAGGTGTGGG + Intergenic
922933789 1:229409026-229409048 TAGGAAGACCAGGCAGCTGTAGG + Intergenic
923119799 1:230979172-230979194 CAGGAGGCCGAGGCAGCAGTAGG - Exonic
923855104 1:237837870-237837892 CTGGAGGCCCAGGAAGCAGGTGG + Intergenic
1062999698 10:1904553-1904575 TAGGAGGCTGAAGAAGCTGAAGG + Intergenic
1065270856 10:24032331-24032353 TAGGAGGCCGAGGTTGCAGTGGG - Intronic
1065746765 10:28849234-28849256 AAGGATGCCCAGGAGGCTGAGGG + Intronic
1067087131 10:43248842-43248864 CATGAGGCCCAGGACTCTGTGGG - Intronic
1067572943 10:47384735-47384757 AAGGAGGGCCAGGAGGCCGTGGG - Intergenic
1068089431 10:52414372-52414394 TAAGAAGCTTAGGAAGCTGTAGG - Intergenic
1068190355 10:53643467-53643489 TAGGAGGTCAAGGATGCAGTGGG + Intergenic
1068666944 10:59686979-59687001 TAGGAGGCGGAGGTTGCTGTGGG - Intronic
1069571012 10:69494495-69494517 GCGGAGGCCCAGGTGGCTGTAGG + Intronic
1069925406 10:71847030-71847052 TGGGATGTCCAGGCAGCTGTGGG - Intronic
1070506319 10:77116377-77116399 AAGGAGGCCCCAGAAGCTCTGGG - Intronic
1070802328 10:79250992-79251014 GAGAAGGCACAGGAAGCTGGGGG + Intronic
1071473719 10:86006880-86006902 TAGGAGGCAGGGGAAGCTGGCGG + Intronic
1071819468 10:89265019-89265041 GAGGAGGCCCAGGCAGCAGGGGG + Intronic
1072334167 10:94382641-94382663 TAGGAGGCACATGAGGCTTTTGG + Intergenic
1072714123 10:97737815-97737837 GAGATGGCCCAGGAAGTTGTTGG + Intronic
1073073308 10:100808337-100808359 TAGGGGGGCCAGGAAGCGGAAGG + Intronic
1073140546 10:101244385-101244407 GAGGAAACCCAGGAAGCTCTCGG - Intergenic
1074549795 10:114431942-114431964 TTTGCGGCCCAGGAAGCAGTGGG - Intronic
1075153453 10:119955482-119955504 AAGGAGGCCGGGGAGGCTGTAGG + Intergenic
1075585335 10:123653316-123653338 CAGGAGTCCCTGGAAGGTGTGGG + Intergenic
1076564212 10:131387029-131387051 GAGGAAGCCCAGGGAGCTGCAGG - Intergenic
1076815176 10:132911103-132911125 TGGGCGGCTCAGGCAGCTGTGGG - Intronic
1077009945 11:375262-375284 AAGGAAGCCCAGAAAGCTGAGGG - Intronic
1077550270 11:3197094-3197116 TGGGAGGCCCAAGGAGCGGTAGG + Intergenic
1079561695 11:21829397-21829419 CAGGAGGGCCAGGAAACTCTAGG - Intergenic
1080382669 11:31790401-31790423 TAGGGGGCCCACTGAGCTGTAGG - Intronic
1081037972 11:38173937-38173959 TATGGTGCCCAGGCAGCTGTAGG + Intergenic
1083538275 11:63491275-63491297 TTAGAGGCCCGGGAATCTGTGGG + Intergenic
1083623766 11:64061444-64061466 TGGAAAGCCCACGAAGCTGTTGG - Intronic
1083722352 11:64609623-64609645 GAGGAGGACCAGGAGGCTGATGG - Intronic
1084120711 11:67067334-67067356 TCGGAGGCCCTGGCAGCAGTGGG - Intronic
1084298121 11:68226293-68226315 CAGGAGGCCTAGGAGGCTGACGG + Intergenic
1085397861 11:76216205-76216227 GAGGAGGCATAGGAAGCAGTGGG + Intergenic
1089154160 11:116387816-116387838 CAGGAGGCCAAGGAAGGGGTCGG - Intergenic
1089321449 11:117629375-117629397 TGGGAGGCCACGGAAGCTGATGG + Intronic
1089595056 11:119573301-119573323 AAGGGGGATCAGGAAGCTGTGGG - Intergenic
1090406679 11:126479974-126479996 GGGGATGCCCAGGATGCTGTGGG - Intronic
1090694272 11:129221736-129221758 CAGGAGGTCCAGGCTGCTGTGGG + Intronic
1090884201 11:130861813-130861835 TGGAAGACCTAGGAAGCTGTGGG + Intergenic
1091058519 11:132440855-132440877 CTGGAGACCTAGGAAGCTGTAGG + Intronic
1091395942 12:154337-154359 TGGGAGGCCCAGGGCACTGTGGG - Intronic
1091979110 12:4851213-4851235 GAGGATGCCCAGCAAGCTGCAGG - Intronic
1092320739 12:7471965-7471987 AAGGAGGCCAAGGAGGCCGTTGG + Intronic
1092612872 12:10189950-10189972 CAGCTGGCCCAGGGAGCTGTGGG - Exonic
1094199157 12:27779914-27779936 GGGGAGGCCCGGGAAGCTGCGGG - Intergenic
1098230216 12:68365428-68365450 GAGGAGGCACTGCAAGCTGTGGG + Intergenic
1098351583 12:69567602-69567624 TAGGAAGCCCAGGGTGCTTTGGG + Intronic
1100086606 12:90918337-90918359 TAGCCAGCCCAGGAAGATGTTGG - Intronic
1100441765 12:94623799-94623821 GGGGAGGACCAGGAAGCTCTGGG + Intronic
1102088068 12:110160361-110160383 CTAGAGCCCCAGGAAGCTGTTGG + Intronic
1102255175 12:111410839-111410861 AAGGAGGCCCAGAGAGTTGTGGG - Intronic
1102499490 12:113341651-113341673 TAGGAGGCCCAGGGTGCGGGTGG + Intronic
1102569894 12:113821002-113821024 TATCAGGCCCAGGCAGCTGCAGG - Intronic
1102822374 12:115918664-115918686 TAGGAGACACAGTAAGCTGTAGG + Intergenic
1108728526 13:53207553-53207575 GAGGAGGAAGAGGAAGCTGTGGG + Intergenic
1110229032 13:73149273-73149295 CAGGAGGTCCAGGATGCAGTGGG + Intergenic
1112435630 13:99389688-99389710 TTGGAGGCCCCGGAATCTGTGGG - Intergenic
1113945624 13:114042606-114042628 TAGGAGGCCCAGGCCGCTCCCGG - Intronic
1115414020 14:33110702-33110724 TATGAATCCCAGGAAGCAGTAGG - Intronic
1116330958 14:43597163-43597185 AACCAGGCCCAGGAAGCTGAAGG - Intergenic
1117061548 14:51968615-51968637 TAGGACGCCCATGAAGATTTAGG + Exonic
1117484196 14:56177315-56177337 GAGAAGGCCCAGGGATCTGTGGG + Intronic
1117735826 14:58767409-58767431 TAGAATGCCCAGGAAGCAGGAGG + Intergenic
1118751539 14:68811313-68811335 GAGGAGGCCCAGGCAGCTGGCGG + Intergenic
1120212209 14:81644365-81644387 TAGGAGGCCCAGGTTGGGGTCGG + Intergenic
1122194113 14:100072306-100072328 CAGGAGGCACAGGGAGGTGTAGG - Intronic
1122969578 14:105147082-105147104 TCCGGGGCCCAGGGAGCTGTGGG - Intronic
1124035245 15:26048561-26048583 TGAGAGGCCAAGGAAGATGTGGG - Intergenic
1124349284 15:28943661-28943683 GAGGAGGCCCAGAACACTGTAGG - Intronic
1124475159 15:30026787-30026809 CAGCAGGACCAGGAAGCTCTGGG + Intergenic
1126142214 15:45448074-45448096 TATGAGGAACAGGAAGCTCTGGG + Intronic
1126149479 15:45509756-45509778 TAAGAGGTCCTGGATGCTGTGGG + Intronic
1127979792 15:64026137-64026159 TGGAAGGCCCTGGAAGCTGCCGG + Intronic
1128588236 15:68870461-68870483 TGGGAACCCCAGGAAGCTGAGGG - Intronic
1128656743 15:69468249-69468271 AAGGAGGCTCAGGAAGCGGCCGG - Intergenic
1128997809 15:72309672-72309694 TAGGTTGCCCAGGAAGCTCATGG - Intronic
1129219286 15:74122071-74122093 TAGGAGGCCCTTGAGGCTCTTGG - Intronic
1129271485 15:74421526-74421548 TGGGAGGGCCAGGAACCTGGGGG - Intronic
1131002170 15:88947788-88947810 TAGGAGGTCCAGGCTGCAGTGGG + Intergenic
1132575822 16:663542-663564 CAGGAGGCCCAGGTAGCTACTGG + Intronic
1135263414 16:21000549-21000571 TTGTGGGCCCAGGAAGCTGGAGG + Intronic
1136276343 16:29181353-29181375 TGGGAGACACAGGAAGCTCTCGG + Intergenic
1138330486 16:56211397-56211419 TAGGAGGCCCAGGGAGTTCTGGG - Intronic
1138558934 16:57788598-57788620 CGGGAGGCCCGGGAAGCTGGTGG - Intronic
1138585538 16:57967620-57967642 TAGGAGGTCGAGGCAGCAGTGGG + Intronic
1139296165 16:65902937-65902959 CTGGAGGCCCGGGAAGCTGGTGG - Intergenic
1140529168 16:75648933-75648955 CAGGAGGTCCAGGATGCAGTAGG - Intronic
1141461185 16:84179659-84179681 TGGGAGGTCCAGGAAGCTGTGGG + Exonic
1141638719 16:85329115-85329137 TGGGGGGCCCAGGGAGCTGTGGG - Intergenic
1142080726 16:88147413-88147435 TGGGAGACACAGGAAGCTCTCGG + Intergenic
1142083283 16:88162180-88162202 TAAGAGACCCAGGAAGCTCAGGG - Intergenic
1143543434 17:7582812-7582834 TAGGAGCCCCAGGAGGCTTCCGG + Intergenic
1143885826 17:10064153-10064175 TGGGAGGCCCCAGAAGGTGTAGG - Intronic
1144084719 17:11798357-11798379 TGGGAGGCCCAGGTTGCAGTGGG + Intronic
1144444361 17:15313453-15313475 TAGCATGCCCTGGATGCTGTGGG - Intronic
1144942898 17:18953505-18953527 ACTGAGGCCCAGGAAGCTGAGGG - Intronic
1145263615 17:21368973-21368995 GGGGAAGCCCAGGAGGCTGTGGG + Intergenic
1145753001 17:27368540-27368562 CAGTAAGCCCAGGATGCTGTGGG - Intergenic
1145817209 17:27804240-27804262 GTGCAGGCCCAGGAAGCCGTAGG - Exonic
1146455845 17:33009124-33009146 TGGGAAGCCCAGGAGGCTGGAGG - Intergenic
1147857010 17:43488695-43488717 TATGAGGGCCAGGCAGCTGCTGG - Intronic
1148897114 17:50845448-50845470 TAGGGCCTCCAGGAAGCTGTGGG + Intergenic
1149507242 17:57204453-57204475 TAGGCTGCCCAGGAGGCTTTGGG - Intergenic
1149995926 17:61405872-61405894 GAGAAGGCCCAGGGAGCTGGCGG + Intronic
1150466278 17:65395523-65395545 AATGAGGTACAGGAAGCTGTAGG + Intergenic
1150578092 17:66447713-66447735 CAGGGGGCCCTGGAGGCTGTTGG - Intronic
1151368598 17:73632856-73632878 TAGGGGGTCCAGGAAGCCATGGG + Intronic
1151384131 17:73744793-73744815 TATTAGGCCCAGGGAGCTGTGGG + Intergenic
1151888016 17:76934562-76934584 AGGGAAGCCCGGGAAGCTGTGGG + Intronic
1152242149 17:79166308-79166330 AAGGAGGCCCGGGCAGTTGTGGG + Intronic
1152463078 17:80451409-80451431 CAGGAAGCCCAGGAGGCTGTGGG + Intergenic
1153555699 18:6311018-6311040 CAGGAGGCCCAGGGAGGAGTTGG - Intronic
1154008291 18:10554128-10554150 TGGGAGGGCCAGAATGCTGTTGG + Intergenic
1157720532 18:49920486-49920508 TAGGAGGCCCAGGACATAGTTGG - Intronic
1157889963 18:51406272-51406294 TAGAAGGTGCTGGAAGCTGTGGG + Intergenic
1160054016 18:75462670-75462692 TGGGAGGCCCTGGAAGCACTGGG + Intergenic
1161152529 19:2717127-2717149 GAGGAGGCCGAGGAGGGTGTCGG + Exonic
1162710530 19:12590461-12590483 TAGGAGGCCGAGGCAGGGGTTGG - Intronic
1164193325 19:22931458-22931480 TAGGAGACCCAGGACCCTATTGG - Intergenic
1164624505 19:29717130-29717152 AATGAGGCCCAGGAGGCTGATGG - Intergenic
1164940437 19:32248904-32248926 AAAGAGGCCAAGGAAGCTGTGGG - Intergenic
1165079418 19:33299046-33299068 AAAGAGGCCCAGGAGGCTGATGG - Intergenic
1166074919 19:40408350-40408372 CAGGAGGCCCAAGGAGCTGGAGG - Exonic
1166104234 19:40589586-40589608 GAGGAGACCCAGGGAGCTGTAGG + Intronic
1167332985 19:48867803-48867825 TAGGCGGCCCTGGCAGCTGCGGG + Intronic
1167521426 19:49958371-49958393 ATGGAGGCTCAGGGAGCTGTTGG + Exonic
1167523948 19:49972348-49972370 TTGGAGGATCAGGGAGCTGTTGG - Intergenic
1167748104 19:51364600-51364622 GAAGAGGCCCAGGGAGCTGTAGG + Intronic
1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG + Exonic
1167756115 19:51414909-51414931 ATGGAGGCTCAGGGAGCTGTTGG + Exonic
925503091 2:4528874-4528896 TAGGCGGGCCAGGCAGCTCTGGG - Intergenic
927598989 2:24423597-24423619 TGGGAGGCCCTGGGGGCTGTAGG + Intergenic
927698523 2:25252798-25252820 TAGGAGGCCCAGGAAGCTGTAGG + Intronic
928870123 2:35965977-35965999 CTGGAGACCCAGGAAGCTGGTGG - Intergenic
929553584 2:42909551-42909573 TAGGAGGCGGAGGTTGCTGTGGG + Intergenic
930954271 2:57185902-57185924 TATGAGGACCAGGAAACTTTCGG - Intergenic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
932420911 2:71600867-71600889 CAGGAGGCCCAGGCAGGAGTGGG + Intronic
935956664 2:108383694-108383716 TGGGAGCACCAGGAAGCTGCAGG - Intronic
937277132 2:120692239-120692261 TGGGAGTCCTAGGAAGCTGGTGG + Intergenic
937524290 2:122748211-122748233 GAGAAGGCCCAGCAAGCTTTGGG - Intergenic
937896447 2:126979887-126979909 GAGGGGGCCCAGGCTGCTGTAGG - Intergenic
937956752 2:127426098-127426120 TGGGAGGCCCTGGAAGCGGATGG + Exonic
938163784 2:129009145-129009167 GAGGATGCCCAGGAAGGTGCAGG + Intergenic
938389879 2:130896752-130896774 TAGAAGGGCCAGGAAGAAGTAGG + Intronic
938934263 2:136115474-136115496 TCAGAGGCCAAGGAAGCTGTTGG - Exonic
941508192 2:166374104-166374126 AAGGAGGCCCAAGATGCTTTTGG + Intronic
943769099 2:191695582-191695604 GATGAGGCCCAGGAAGCTTTTGG + Intronic
946427927 2:219609229-219609251 GTGGGGGCCCAGGAGGCTGTGGG + Intronic
946651420 2:221895888-221895910 TAGGAGGGCCAGGAAGCGGCGGG - Intergenic
946866849 2:224048673-224048695 GAGAAGCCCCAGAAAGCTGTGGG - Intergenic
947591167 2:231386843-231386865 TGGGAGGCTCAGGAAGCTCTTGG + Intergenic
947752953 2:232542200-232542222 TTGAAGGCCCAGGAGGCTGCAGG - Intronic
948312946 2:237003027-237003049 AAGGAGACCCAGGAAGCCCTAGG + Intergenic
948515214 2:238499200-238499222 CTGGAGGCCCAGGCAGCTCTAGG + Intergenic
1168986771 20:2055930-2055952 CAGGGAGCCCAGGGAGCTGTGGG - Intergenic
1169277519 20:4243729-4243751 TGGGACCCCCAGGAAGCTGCTGG - Intronic
1169404875 20:5314912-5314934 CAGGAGGGCCAGGATGCTGCGGG + Intergenic
1169973308 20:11295286-11295308 TATGAGTCCTAGAAAGCTGTAGG - Intergenic
1170842964 20:19938951-19938973 TACAAGGCCCAAGAAGCTGGAGG - Intronic
1171424998 20:25043546-25043568 TCAGAGTCCCAGGAAGCTGAGGG - Intronic
1173629612 20:44501723-44501745 AAGGAAGCCTAGGAAGCTGTGGG - Intronic
1174219259 20:48939543-48939565 GAAGAGGCCCATGAAGTTGTGGG - Intronic
1175645223 20:60665050-60665072 AAGGAGGCCCAGGAAGGTGGAGG - Intergenic
1175665734 20:60858152-60858174 CAGGAGGCCCAGGAACCTGGAGG + Intergenic
1178295289 21:31404895-31404917 TAGGAGGAACAGGGAGCTGTTGG - Intronic
1178302914 21:31467841-31467863 TAGGAGGCCAAGGCAGGTGGGGG + Intronic
1178339584 21:31774609-31774631 TAGGAGGCAAAGGAAACTGATGG + Intergenic
1179436273 21:41364188-41364210 GTGAAGGCCCAGGAAGCTGGTGG - Intronic
1180104976 21:45612629-45612651 TCGGAATCCCAGGAAGCTTTGGG + Intergenic
1181278617 22:21703036-21703058 GAGGAGGCCGAGGAGGCTGCAGG - Intronic
1181775760 22:25159098-25159120 TGGGAGGCCCAGGCTCCTGTCGG - Intronic
1184246423 22:43237984-43238006 ACGGAGCCCCAAGAAGCTGTGGG - Intronic
1184428672 22:44428342-44428364 TAGGAGGCCCCGGAAGAGGAGGG + Intergenic
1184692510 22:46123685-46123707 CAGGAGGCCCTGGCAGCTGGTGG + Intergenic
1184799350 22:46750525-46750547 TAGCAGGCCCTGGAATCTGGGGG + Intergenic
1185317131 22:50184118-50184140 TTTGGGGACCAGGAAGCTGTAGG + Intergenic
949424889 3:3906408-3906430 TAGCAAGCCCAGGAACCTGATGG + Intronic
950492589 3:13314970-13314992 CAGGAAGCCCAGGTAGCTGCAGG - Intergenic
950638424 3:14332558-14332580 AAGGAGGTCAAGGATGCTGTGGG + Intergenic
951411794 3:22374697-22374719 TAGGAGGCCGTGGAAGCACTAGG + Intergenic
952472086 3:33665974-33665996 TAGGAGGCCCACAAAGCTCTAGG + Intronic
952783231 3:37125399-37125421 TGGGAGGCCCAGGAAGGTGTGGG + Intronic
954238736 3:49277071-49277093 GGGGCGGGCCAGGAAGCTGTGGG - Exonic
956790344 3:72675330-72675352 CAGGAGGCCCAGGAATCACTCGG - Intergenic
960671635 3:120160098-120160120 GAGGAGGACCAGGTAGCTCTAGG + Intergenic
960671986 3:120163166-120163188 AAGGGGACTCAGGAAGCTGTTGG + Intergenic
961853745 3:129848540-129848562 AAGGAGGCCAAGGAAGCTAAGGG - Intronic
962211204 3:133480125-133480147 TAGGAGGCCTATAAAACTGTTGG - Intergenic
962211219 3:133480224-133480246 TAGGAGGCCTATAAAACTGTTGG - Intergenic
962345834 3:134618492-134618514 GGGTAGGCTCAGGAAGCTGTGGG + Intronic
963277794 3:143350139-143350161 TAGGAGCCCCAGGTGACTGTGGG - Intronic
964842299 3:161007443-161007465 AAGGAGGCCCATGTAGCTGGAGG + Intronic
966302229 3:178492631-178492653 TACAAAGCCCAGGAAACTGTGGG + Intronic
966626682 3:182024507-182024529 TGGGAGGCCAAGGAAGATTTCGG + Intergenic
966926852 3:184649992-184650014 GAGGAGGCACAGGAAGTGGTGGG + Intronic
968077353 3:195823867-195823889 TAGGAAGGCCAGGAAGAGGTGGG + Intergenic
968936574 4:3614227-3614249 TGGGAGGCCGAGAAACCTGTCGG - Intergenic
969057711 4:4412517-4412539 TAGGAAGGCCAGGGAGCTGCTGG + Intronic
969058100 4:4414454-4414476 TAGGAAGGCCAGGGAGCTGCTGG + Intronic
969607591 4:8210252-8210274 AAGGGGGCCCAGGAAGCTGCTGG + Intronic
971412410 4:26388238-26388260 TGGGAGGCCAAGGAAGCAGGAGG - Intronic
971487716 4:27177069-27177091 TAGGAAGCTCAGGAAGCTGGGGG + Intergenic
972773338 4:42218833-42218855 TAGCAGCCCCAGGAGGCTGAAGG - Intergenic
975860192 4:78668869-78668891 TAGGAGGTTCAGGAATCAGTTGG - Intergenic
982203635 4:152981120-152981142 TAGGAGATCCAGTGAGCTGTGGG - Intergenic
984957327 4:185058382-185058404 AAGGAGACCAAGGGAGCTGTAGG - Intergenic
985549250 5:524742-524764 TGGGATGCCCGGGCAGCTGTGGG + Intergenic
985728360 5:1527284-1527306 TACCAGCCCCAGGGAGCTGTGGG - Intergenic
985967400 5:3348119-3348141 GAGGGGGCACAGGAAGCTGGAGG - Intergenic
985968507 5:3356088-3356110 GAGGAGGCACAGGGAGCTGCTGG - Intergenic
988569922 5:32354171-32354193 TTAGAGGGCCAGGAAACTGTAGG - Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
993614709 5:90097286-90097308 TGGGAGGCCGAGGAAGCTGGTGG + Intergenic
996903053 5:128565885-128565907 AAGGAAGGCCAGGAAGCTGGAGG - Intronic
997374254 5:133385499-133385521 TAGGGGGACCAGGAGCCTGTGGG - Intronic
998368082 5:141644086-141644108 TGGGAGGCCCAGGCCACTGTAGG + Intronic
999082185 5:148855125-148855147 TAGAAGGCCCTGGACGCAGTGGG + Intergenic
999374719 5:151078975-151078997 TCGGGGCCCCAGGAAGCTGTGGG - Intronic
999379273 5:151108901-151108923 GAGGAGGCCCAGGAAGGAGAGGG - Intronic
1000634760 5:163631373-163631395 TAGGAAGTCCTGGAAGATGTAGG + Intergenic
1001137427 5:169114276-169114298 CAGGAGGCCCAGGCAGATGGAGG - Intronic
1001565356 5:172696337-172696359 CGGGAGGCCCAGGAGGTTGTAGG - Intergenic
1002280075 5:178124666-178124688 CAAGAGGCCCAGGGAGCTGCTGG - Exonic
1002720804 5:181260596-181260618 GAGGAGGACGAGGAAGCGGTGGG - Exonic
1002789798 6:428626-428648 CACGAGTCCCTGGAAGCTGTGGG + Intergenic
1003498721 6:6686984-6687006 GAGGAGGCCCAGGAAGGGGCGGG - Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1005494538 6:26376907-26376929 TAGGAGGCTCAGGAAGTTTCAGG - Exonic
1005503738 6:26452009-26452031 TAGGAGGCTCAGGAAGTTTCAGG - Exonic
1006278839 6:33029832-33029854 AAAGAGGCCGTGGAAGCTGTCGG + Intergenic
1008000130 6:46351737-46351759 TAGATGGTCCAGGAAGCTGATGG + Intronic
1008200933 6:48589273-48589295 GTGGAGGCCCAGGAAGCAGTGGG + Intergenic
1013979254 6:116110411-116110433 TAGGAGGCACAGGAAGCACCTGG - Intronic
1015473526 6:133633825-133633847 AAGTAGGCCCAGGATGCTGGTGG + Intergenic
1015601238 6:134912925-134912947 AAAGAGGCCTAGAAAGCTGTTGG - Intergenic
1018598028 6:165504506-165504528 TTGAAGCCCCAAGAAGCTGTTGG - Intronic
1018790296 6:167143180-167143202 AAGGAGGCCCAGAAGGCTGAAGG - Intergenic
1018863169 6:167726939-167726961 CAGGAGGCAGAGGAGGCTGTGGG + Intergenic
1019138459 6:169927466-169927488 TGGGTGGCCCAGGAAGCTGGTGG + Intergenic
1019958373 7:4435479-4435501 CAGGGGGCACAGGAACCTGTTGG - Intergenic
1020213834 7:6173939-6173961 TGGGAGGCCCAGGGAGGTGTGGG - Intronic
1021112332 7:16709554-16709576 TGGGTGGCCCAGGAGGCTGGAGG + Intergenic
1021752331 7:23814954-23814976 TAGGAGCCCCAGGAACCATTTGG + Intronic
1021924730 7:25523342-25523364 TGGGAAGCCCAGAAAGCTCTTGG + Intergenic
1022017739 7:26366582-26366604 TATGAGGCCCAGGTGGCTGATGG + Intronic
1022926404 7:35059466-35059488 GAGGAAGCCAGGGAAGCTGTAGG - Intergenic
1024007549 7:45238202-45238224 AAGGAGACCCAGGGAGCAGTTGG - Intergenic
1024060025 7:45690549-45690571 TAGGAGGCCCAGGACCCTGTTGG + Intronic
1026380208 7:69791970-69791992 TAGGAGGCTGGGGAAGGTGTTGG + Intronic
1026808127 7:73440587-73440609 TAGGAGGCAGGGGAAGCTGGCGG + Exonic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1028241123 7:88421917-88421939 TAGGATGCCAAGGGAGCTCTTGG + Intergenic
1029319150 7:99742036-99742058 TGGTAGGCCCAGGAACCTGTGGG - Intergenic
1029324112 7:99791006-99791028 TGGTAGGCCCAGGAACCTGTGGG - Intergenic
1030981165 7:116186547-116186569 GAGGAGGCCCAGGCAGCAGGGGG + Intergenic
1032428090 7:131837956-131837978 TAGGAGGCTGAGGAAGTTGAAGG - Intergenic
1032520295 7:132538710-132538732 CAGGAGAGCCAGGATGCTGTAGG + Intronic
1032752203 7:134852573-134852595 TAGAAGGTCTGGGAAGCTGTTGG - Intronic
1035384935 7:158465119-158465141 GAGGAGGCCCAGCATGCTTTAGG - Intronic
1036645122 8:10607892-10607914 GAGGAGGCACAGGAGGCTGAAGG - Exonic
1036830771 8:12018009-12018031 TAGGAGGCAGAGGTAGCAGTGGG + Intergenic
1044967375 8:97586336-97586358 GATGAGGCCCAGGAAGCAGGTGG + Intergenic
1045726050 8:105174935-105174957 TAGGATGTCCAGAAAGCTTTGGG + Intronic
1047994773 8:130323956-130323978 TAGGAAGCCCTGGCAGCTCTGGG - Intronic
1048341576 8:133543526-133543548 AAGGAGGTCCAGGAATTTGTTGG + Intronic
1048866903 8:138768089-138768111 GCGGAGGGCCAGGAGGCTGTGGG - Intronic
1049547299 8:143239083-143239105 GAGGATGCCCAGGATGGTGTGGG - Intergenic
1049653879 8:143789312-143789334 AGGGAGGGCCAGGAAGCTGGGGG + Intergenic
1049661360 8:143821045-143821067 CTCGAGGCCCAGGAACCTGTCGG + Intronic
1049755268 8:144308756-144308778 TGGGAGGCCCAGGGGGCTGGCGG - Intronic
1050387582 9:5107249-5107271 TAGTAGGGCCAGTAAGGTGTCGG - Intronic
1055798214 9:79999596-79999618 TAGCAGGCTCTGGAAGCTGTGGG - Intergenic
1056180614 9:84078816-84078838 GAGCAGGCCCAGAAAGCTGAAGG + Intergenic
1056378295 9:86035373-86035395 GAGGAGGAGCAGGAAGCTGCCGG - Exonic
1056547266 9:87623165-87623187 CAGCAGGCCCAGGAGGATGTGGG - Intronic
1056698430 9:88880356-88880378 TCGGATGCCCAGGCAGCTGGAGG + Intergenic
1057024662 9:91725790-91725812 ACGGAGGCCCAGGAACCTCTGGG - Intronic
1057194818 9:93111081-93111103 TAGGAGCGCCATGCAGCTGTGGG - Intronic
1057942582 9:99297853-99297875 CAGTGGCCCCAGGAAGCTGTGGG + Intergenic
1060545130 9:124454895-124454917 CAGAAGGCCCAGGAAGCTGGAGG - Exonic
1061394123 9:130333991-130334013 CAGGATGTTCAGGAAGCTGTGGG + Intronic
1061553493 9:131351226-131351248 TAGGAGGCCCAGGAGGAGTTTGG + Intergenic
1062388945 9:136326600-136326622 CGGAAGGCCCAGGATGCTGTCGG + Intergenic
1185913671 X:4010375-4010397 CTGGAGACCCAGGAAGCTGGTGG + Intergenic
1186350251 X:8732409-8732431 TGGGAGGGGCAGGAAGCGGTTGG - Intergenic
1187068365 X:15863488-15863510 TAGGAAGGCCAGGGACCTGTGGG + Intergenic
1192240395 X:69323681-69323703 TAGGAGGGCCAGGAAGCTTGGGG - Intergenic
1192496037 X:71617187-71617209 TAGGTGGAGCAGGAAGGTGTCGG + Exonic
1195577313 X:106466535-106466557 GAGGAGGCTCAAGAAGCTGGAGG - Intergenic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic
1200150073 X:153946999-153947021 CAGGAGGCCCAGAAAGCTCCGGG - Intergenic
1200182963 X:154162366-154162388 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200188617 X:154199480-154199502 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200194266 X:154236621-154236643 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200200022 X:154274424-154274446 CAGGAGGCCCAGGAGGGTGGCGG + Intronic
1201416166 Y:13751450-13751472 TAGGAGGGGCAGGAAGCGGTTGG + Intergenic
1201748091 Y:17402641-17402663 AAGGAGGCCCAGAAATTTGTTGG + Intergenic