ID: 927698617

View in Genome Browser
Species Human (GRCh38)
Location 2:25253282-25253304
Sequence CCTCGAGGGCAGAGCCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927698617_927698626 15 Left 927698617 2:25253282-25253304 CCCTGTTGGCTCTGCCCTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 191
Right 927698626 2:25253320-25253342 TAGACTTGGAGAAATATGAAAGG 0: 1
1: 0
2: 5
3: 29
4: 363
927698617_927698624 1 Left 927698617 2:25253282-25253304 CCCTGTTGGCTCTGCCCTCGAGG 0: 1
1: 0
2: 0
3: 14
4: 191
Right 927698624 2:25253306-25253328 GTTGAAGATTCCACTAGACTTGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927698617 Original CRISPR CCTCGAGGGCAGAGCCAACA GGG (reversed) Intronic
900093275 1:929811-929833 CCTCAAGGGCTGGGCCAACCAGG + Intronic
900300789 1:1976133-1976155 CCACGAGGGCAGGGCCCCCATGG + Intronic
900616591 1:3568310-3568332 CCTGGAGGCCAGAGCCCTCAGGG - Intronic
900795185 1:4703500-4703522 TCTCAAGGGCAGAACCACCAGGG + Intronic
901042996 1:6376818-6376840 CCTGGGAGGCAGAGCGAACATGG + Intronic
902224295 1:14987025-14987047 CCTGGTGGGCAGAGCAAACTGGG + Intronic
902571935 1:17352574-17352596 TCTGGAAGGCAGAGCCAGCAGGG + Intronic
902621398 1:17652975-17652997 CTATGAGGGCAGAGCCATCAAGG - Intronic
903227804 1:21903773-21903795 CCTCCAAGGCAGAGACCACATGG - Intronic
904251158 1:29225277-29225299 CCCCGAGGGAAGAGAAAACATGG - Intronic
905709284 1:40087128-40087150 CCACAAGGGCAGAGAGAACAGGG - Intronic
905791605 1:40792518-40792540 GCTCAAGGGCACAGCCCACACGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906719211 1:47993583-47993605 CTCCCAGGGCTGAGCCAACAAGG - Intronic
907089088 1:51707791-51707813 CTTAGAGGGGAGAGCCAAAAGGG - Intronic
907262803 1:53234060-53234082 CCTTGAGGGCAGAGGCCCCAGGG + Intronic
911276625 1:95868072-95868094 GTTCGAGGGCAGCCCCAACATGG + Intergenic
912508525 1:110172872-110172894 CCTTAAGGGCAAAGCCTACAGGG + Intronic
915265965 1:154718042-154718064 CCTGGTGGGCAGAGGCACCAGGG + Intronic
915468930 1:156114421-156114443 GCTAGAGGGCAGAGCCAAGGAGG - Intronic
915600386 1:156919942-156919964 CCACCAGGGCAGAACCATCAGGG + Intergenic
915669076 1:157472314-157472336 CCTGGAGGGCGGAGCAAAAAGGG - Intergenic
916214574 1:162384279-162384301 CCCCAGGGGCAGAGCAAACATGG - Intronic
917106588 1:171498438-171498460 CTGTGAGGGCAGAGCCCACATGG + Intronic
923782034 1:237033242-237033264 CCTGGAGTGCAGAGTGAACAAGG - Intergenic
1062874954 10:935578-935600 CCTCAAGGGCAGAGGCAGCGAGG + Intergenic
1067066280 10:43105860-43105882 CCTGGTGGGCAGAGCCATCCAGG + Intronic
1068426234 10:56868177-56868199 CCATGAGGGCAGAGCCCTCATGG + Intergenic
1072493866 10:95935299-95935321 CTTTGAAGGCAGAACCAACAGGG - Intronic
1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG + Intergenic
1075401275 10:122163295-122163317 CCTGGAGGGATGAGCCAACAGGG + Intronic
1075977201 10:126706290-126706312 CTGTGAGGGCAGAGCCAGCAGGG + Intergenic
1076020191 10:127066137-127066159 ACTCGAGGGCAGAGGCAATGGGG - Intronic
1077013875 11:391573-391595 CCTCCAGGGCAGAGCCTGCGTGG - Intergenic
1077430089 11:2512022-2512044 CCTGGAGGGCAGAGACATCAGGG + Intronic
1078037539 11:7823355-7823377 CGTCTAGGGCAGTGCCTACAAGG + Intergenic
1078467606 11:11561779-11561801 CCCATTGGGCAGAGCCAACAAGG + Intronic
1082793987 11:57366898-57366920 CCATGAGGGCAGAGCCCGCAGGG + Intronic
1082794368 11:57369096-57369118 CCATGAGGGCAGAGCCCGCAGGG + Intronic
1083768911 11:64855533-64855555 CCCCGAGAGCAGAGCCTCCAAGG + Intronic
1083927987 11:65820569-65820591 CCTCAAGGGCAGAGCCCCCGAGG - Intergenic
1089091892 11:115885279-115885301 CCTGGTGGGCAGTGCCTACAGGG - Intergenic
1089195983 11:116694346-116694368 CCAAGAGGGCAGATCCAAGAGGG + Intergenic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1090504563 11:127297589-127297611 TCTCCAGGGCAGAGGCAAAATGG - Intergenic
1093238549 12:16640969-16640991 CCGCAAGGGCAGAGCCCTCATGG - Intergenic
1093300817 12:17452256-17452278 CCACGAGTGCAGAGACAAAAGGG - Intergenic
1094811463 12:34142688-34142710 CCTCGTGGGCCCAGCCACCACGG + Intergenic
1096353474 12:50919077-50919099 CTTGGAGGCCAGAGGCAACATGG + Intergenic
1105207000 13:18233531-18233553 CTTCCAGGGCATCGCCAACAGGG + Intergenic
1105330699 13:19412694-19412716 CTCCCAGGGCAGAGCCCACAAGG + Intergenic
1105918773 13:24941468-24941490 CTCCCAGGGCAGAGCCCACAAGG + Intergenic
1107221213 13:37982828-37982850 TCTTGAGGGCAGAGCCCCCATGG + Intergenic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1109171841 13:59107083-59107105 TCTCGAGGGCAGGGGCAAAATGG - Intergenic
1122247986 14:100417649-100417671 CCTCACTGGCAGAGACAACAAGG - Intronic
1124008033 15:25810295-25810317 CCGAGAGGGCAGAGCCCACAGGG + Intronic
1124477719 15:30049411-30049433 CCATGAGGGCAGAGCCCCCATGG + Intergenic
1125004923 15:34806736-34806758 CCACCAGGGTAGAGTCAACAAGG + Intergenic
1127860825 15:62993042-62993064 CCTCAAGGGCAGAGGCCATAAGG - Intergenic
1128589757 15:68885158-68885180 CCCCGAGGACAGTGCCAAAATGG + Intronic
1129328837 15:74816453-74816475 CCCCAAGGACAGAGCCTACATGG - Exonic
1130707465 15:86246647-86246669 TCTCTAGGTCAGAGGCAACAGGG + Intronic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132858028 16:2056137-2056159 CCTGGATGGCCGAGCCACCACGG - Intronic
1133468122 16:6047541-6047563 CAGCAAGGGCAGAGCCAGCAGGG + Intronic
1134030695 16:10990195-10990217 CCTCAATGGCAAAGCCAAAAGGG - Intronic
1134195514 16:12156456-12156478 CCAAGAGGGCTGGGCCAACAAGG - Intronic
1134715846 16:16357746-16357768 CCTCCAGGCCTGAACCAACACGG - Intergenic
1134746219 16:16590936-16590958 CCTAGAGGGCAGAGCTAGGATGG + Intergenic
1134999262 16:18762764-18762786 CCTAGAGGGCAGAGCTAGGATGG - Intergenic
1137221449 16:46455409-46455431 ACTCGAGGGAGGAGCCAAGATGG - Intergenic
1138690920 16:58767891-58767913 CTTCGAAGACAGAGGCAACATGG - Intergenic
1139320754 16:66111936-66111958 CCACAAGGGCAGAGCCCTCATGG - Intergenic
1140198943 16:72879004-72879026 CCTCGAGGGCAGCCTCCACAGGG - Intronic
1142250368 16:88989196-88989218 CCTCAAGGGGAGAGGCAACTCGG + Intergenic
1144399735 17:14884418-14884440 TCTCTAGGGCAGAGACAAAATGG + Intergenic
1146283861 17:31561250-31561272 CCTCCAGGACAAAGCTAACATGG - Intergenic
1146732400 17:35204939-35204961 CATCGAGGGTGGAGCCAAGATGG - Intergenic
1147409828 17:40242035-40242057 ACTCTATGTCAGAGCCAACATGG - Intronic
1148744087 17:49908750-49908772 CCTGGAGGCCAGGGCCACCAGGG + Intergenic
1150603914 17:66675290-66675312 CCAGGAGGGCAGAGCCTCCATGG - Intronic
1150835490 17:68560054-68560076 CCATGAGGGCAGAGCCCTCATGG + Intronic
1151466917 17:74291498-74291520 GCTATAGGGCAGAGCCCACATGG + Intronic
1151748780 17:76025412-76025434 ACGTGAGGGGAGAGCCAACAGGG + Intronic
1151874944 17:76862583-76862605 CCTCGAGTGCAGAGGCCACGAGG - Intergenic
1152346487 17:79755546-79755568 CCCGGAGGGCAGAGCCATTACGG + Intergenic
1152862223 17:82703094-82703116 CAGCGGGGGCAGAGGCAACAAGG + Intergenic
1155524900 18:26706158-26706180 GCTGCAGGGCAGAGGCAACATGG - Intergenic
1156242607 18:35268019-35268041 GCTCGAGGGCAGAGTCCACCAGG - Intronic
1156883823 18:42111493-42111515 CCTCAAGTTCAGAGGCAACATGG + Intergenic
1157077179 18:44478903-44478925 TCTCTAGGGCAGAGGCAAAATGG - Intergenic
1161516789 19:4700884-4700906 CCTGGAGGCCAGAGCCACGAGGG - Intronic
1164511072 19:28897658-28897680 CCATGAGGGAAGAGCCTACATGG + Intergenic
1166415591 19:42593058-42593080 CCTCCTGGGCAGGGCCAACTAGG - Intronic
1166774210 19:45302698-45302720 CCTCGAGCTCTGAGCCACCACGG + Exonic
1166786585 19:45370673-45370695 CCGCTAGGGCAGAGCCAATCGGG + Intronic
1168179864 19:54654608-54654630 CCTCCAGGGCAGAGACAAGGTGG - Intronic
1168346364 19:55651994-55652016 CGTCGAGGGCAGGGCCACCTTGG + Intronic
926167613 2:10531248-10531270 CCTGGAGTGCAGAGCCACCATGG + Intergenic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
927893076 2:26764491-26764513 CCAGGAGGGCAGGGCCAAGAAGG - Intronic
932317718 2:70796975-70796997 CCAGGAGGGCAGACCCAGCAGGG - Intergenic
936609424 2:113987617-113987639 CCTCCAGGGCATAGCCTCCAGGG - Intergenic
937653189 2:124344059-124344081 CCACAAGGGCAGAGCCCTCATGG + Intronic
944018575 2:195073525-195073547 CCTGGAGGGAGGAGCCAAGATGG - Intergenic
946359281 2:219209395-219209417 CCTGGAGGGCAGAGACAAGCGGG + Exonic
947588598 2:231371723-231371745 CTCCCAGGGCAGAGCCACCAAGG + Intronic
948456244 2:238105919-238105941 CCCCGGGGGCAGAGCCAGCCTGG - Intronic
1168773237 20:429130-429152 CCTCTAAGGCAAAGCCCACAAGG - Intronic
1168978970 20:1988883-1988905 CCAGGGAGGCAGAGCCAACAAGG - Intronic
1173853689 20:46235700-46235722 CATTGAAGGTAGAGCCAACAGGG - Intronic
1174502201 20:50993488-50993510 ACTCAAGGGTGGAGCCAACATGG + Intergenic
1175547291 20:59786489-59786511 CCCTGGGGGCAGAGCCATCAAGG + Intronic
1176111952 20:63414990-63415012 CCTCGAGGACAGCCCCAGCAAGG - Exonic
1177525728 21:22287780-22287802 CCTCAGGGGCAGAGCCCTCAAGG + Intergenic
1178454078 21:32730518-32730540 TCTGGAGGCCAGAACCAACAGGG - Intergenic
1180228276 21:46411420-46411442 CCTCGTGGGCAGGCCCTACAGGG + Exonic
1180281362 22:10699346-10699368 CCTCGACGGCAGGGGCAAAAAGG - Intergenic
1180564190 22:16649153-16649175 CTCCCAGGGCAGAGCCCACAAGG - Intergenic
1180920791 22:19520610-19520632 CCTCGAGACCAGAGCCACAATGG - Exonic
1181573736 22:23781357-23781379 CCTCGAAGGCAGCGTCCACAGGG - Exonic
1183717133 22:39540107-39540129 TCTCGAAGGCTGAGCCCACAGGG - Intergenic
1184207905 22:43016714-43016736 TCTCCAGGACTGAGCCAACAGGG + Intergenic
1185214377 22:49590046-49590068 GCCGGAGGGCAGAGCCCACAGGG - Intronic
949876507 3:8629377-8629399 CCTAGAGGTCAGAGCCAAGCAGG + Intronic
950106685 3:10393084-10393106 CCTGGAGGGCAGGGACCACAGGG - Intronic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
953617279 3:44502708-44502730 CCTGAAGGGCAGAGTCATCAAGG + Intronic
953625624 3:44568245-44568267 CCTGAAGGGCAGAGTCATCAGGG - Intronic
955376255 3:58399781-58399803 CCTGGAGGGCAGACCCTTCAAGG - Intronic
959627129 3:108465303-108465325 CCCCGAGGCCAGAGCCCACTTGG + Intronic
960131080 3:114056744-114056766 CCTCCAGTGCAGAGCCAATCAGG - Exonic
961424823 3:126836790-126836812 CCTCCAGAGCAGAGCCAGCCTGG - Intronic
963487952 3:145960200-145960222 CCTCGAGTGAAGACCCTACAAGG + Intergenic
964359344 3:155878108-155878130 GCATGAGGGCAGAGCCCACACGG - Intronic
967645282 3:191915490-191915512 CCTACAGGGCATCGCCAACATGG - Intergenic
968927688 4:3558553-3558575 CCCAGAGGGAGGAGCCAACAGGG - Intergenic
969350509 4:6595631-6595653 TCACGAGGGCAGAGCCTTCATGG + Intronic
969408822 4:7014678-7014700 ACTCAAGGGCAGGGCCATCAGGG - Intronic
975154877 4:71059839-71059861 CCTCGGGGGAGGAGCCAAGATGG - Intergenic
975504909 4:75126802-75126824 CCTAGAGGGACGAGCCAAGATGG + Intergenic
976349344 4:84043097-84043119 TCTTGAGGGCAGAGCCCTCATGG + Intergenic
977037896 4:91978208-91978230 ACTCGAGGGAGGAGCCAAGATGG + Intergenic
977954372 4:103010382-103010404 CCTTGAGGGCTGTGCCCACATGG - Intronic
982401405 4:154972032-154972054 CCTGAAGGGTAAAGCCAACATGG - Intergenic
984820363 4:183876396-183876418 CCTCCTGGTCAGAGCCAACCAGG - Intronic
984902747 4:184599664-184599686 CCTGGAGGTCAGAGGCAAGATGG - Intergenic
987879396 5:23722631-23722653 CCTTCAGGTCAGAGGCAACATGG + Intergenic
993699668 5:91103473-91103495 CCATCAGGGCAGAGCCATCAGGG + Intronic
995120742 5:108533035-108533057 CCTCTAGGGCAGGGGCAAGAAGG + Intergenic
997750910 5:136344962-136344984 CCATGAGGGCAGAGACTACAGGG + Intronic
998391441 5:141789323-141789345 CCTGGAGGGGAGAGCAAGCAGGG - Intergenic
999324132 5:150632623-150632645 CCTGGAGGGCAGAGCCGAAAGGG - Intronic
999738937 5:154534591-154534613 CCTAAAGGGCAGAGCCCACCTGG + Intergenic
1000044602 5:157511820-157511842 CCGCGAGGAGAGAGCCAAGACGG + Intronic
1001453858 5:171846100-171846122 CTTCTAGGGCTGGGCCAACAAGG + Intergenic
1001982308 5:176045701-176045723 CCTCAAGGGCAAAGGCCACACGG - Intergenic
1002235153 5:177798356-177798378 CCTCAAGGGCAAAGGCCACACGG + Intergenic
1002884575 6:1282043-1282065 CCTCGAGGGCAGTGACATGAGGG + Intergenic
1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG + Intergenic
1003687215 6:8315759-8315781 CCACGGGGGCAGGGCCAAGATGG - Intergenic
1006401779 6:33821938-33821960 TCACGAGGGCAGAGCCTTCATGG - Intergenic
1006423718 6:33950990-33951012 CCTCCAGGGCAGGGCCATCTGGG - Intergenic
1010280120 6:74013619-74013641 ACTCGGGGGTAGAGCCAAGATGG - Intergenic
1011038372 6:83002349-83002371 CCATGAGGGCAGAGCCATCATGG - Intronic
1011787110 6:90859332-90859354 CCTCGAGGCCAGTTCCCACATGG - Intergenic
1014130299 6:117823385-117823407 CCCCAAGGGCAGAGCCAGCCTGG - Intergenic
1016540511 6:145159105-145159127 TCTCTAGGGCAGGGCCAAAATGG - Intergenic
1018393248 6:163356672-163356694 CCTCTAGGGTAGAGCCAGCTGGG + Intergenic
1018538186 6:164846366-164846388 TCCCCAAGGCAGAGCCAACATGG - Intergenic
1018714940 6:166524908-166524930 TCTCTAGGGCACTGCCAACATGG - Intronic
1019171629 6:170136330-170136352 CCCCGAGGGCAAAGCGAGCAGGG - Intergenic
1020462542 7:8441774-8441796 CCGCGAGGGCAGGGCAAACTTGG - Intronic
1020581793 7:10011845-10011867 CTGCGAGGGCAGAGCCCTCAGGG + Intergenic
1022104402 7:27188072-27188094 CCTCGAGGGCCGAACCGAGAGGG + Intergenic
1022292669 7:29019344-29019366 CTTCTAGGTCAGAGCCAACAAGG + Intronic
1022369785 7:29759619-29759641 CCATGAGGGCAGAGCCCTCATGG - Intergenic
1026289566 7:68994189-68994211 CCAAGAGGGCAGAGTGAACAGGG - Intergenic
1026950738 7:74344885-74344907 CCTCCATGGCAGAGACACCAGGG + Intronic
1028583786 7:92433693-92433715 CTTTGAGGGCAGAGACAGCAAGG - Intergenic
1032852343 7:135805731-135805753 TCACGAGGGCAGAGCCCTCATGG + Intergenic
1034932879 7:155177126-155177148 CCACGAGAGCAGAGCCCTCATGG + Intergenic
1037149317 8:15616711-15616733 TCTCGAGGTCAGAGCCCCCAAGG - Intronic
1037916838 8:22778043-22778065 CCTCCTGGGCAGTGCCATCACGG + Intronic
1038338366 8:26663302-26663324 GCTCAAGGGCAGAACCAACCTGG + Intergenic
1038530910 8:28317378-28317400 CCGGGAGGGCAGGGCCACCAGGG + Intronic
1039608677 8:38902078-38902100 CCTCGAGGGCTCACCCAACCTGG - Intronic
1039626721 8:39061768-39061790 CCCAGAGGGCAGAGCCATCATGG + Intronic
1043207938 8:77471142-77471164 TTTCGAAAGCAGAGCCAACAGGG + Intergenic
1047735410 8:127760912-127760934 CCTCCAGGGCAGAGCCAGGATGG - Intergenic
1052522232 9:29562994-29563016 CCACAGGGGCAGAGCCATCATGG + Intergenic
1053802546 9:41773632-41773654 CCCAGAGGGAGGAGCCAACAGGG - Intergenic
1054190854 9:61984978-61985000 CCCAGAGGGAGGAGCCAACAGGG - Intergenic
1054462442 9:65472588-65472610 CCCAGAGGGAGGAGCCAACAGGG + Intergenic
1054647518 9:67602739-67602761 CCCAGAGGGAGGAGCCAACAGGG + Intergenic
1056456663 9:86766979-86767001 TTTCGTGGGCAGAGCCAAAAGGG - Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057192174 9:93094397-93094419 CCTGGAGGCCAGAGCCAGCCTGG + Intergenic
1061373744 9:130212296-130212318 CCTCGGGGGCAGAACCACCCAGG - Intronic
1061634656 9:131899690-131899712 TCTCGATGGCAGAGCCAGGAGGG - Intronic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1061955828 9:133960869-133960891 CCCCGGGGACAGAGCCAACGGGG + Intronic
1190284778 X:48954895-48954917 CCTCGTGGCCAGGGCCAAGAAGG - Intronic
1191650918 X:63537015-63537037 CCTCGTGGGCATAGACCACATGG + Intergenic
1201627028 Y:16026046-16026068 CCTCGAGAGAGGAGCCAAGATGG + Intergenic