ID: 927698869

View in Genome Browser
Species Human (GRCh38)
Location 2:25254950-25254972
Sequence GAATAAGGAAGTTTGACGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927698869 Original CRISPR GAATAAGGAAGTTTGACGGC CGG (reversed) Intronic
900943961 1:5819172-5819194 GAATGAGGAAGTTTTAGAGCAGG - Intergenic
903348519 1:22703411-22703433 AAATAAGGAAATTTGAGGGCTGG + Intergenic
907992556 1:59596898-59596920 GATTAAGAAAGTATGATGGCTGG - Intronic
908039874 1:60100553-60100575 GAATCAGTAAGTCTGATGGCTGG - Intergenic
910757259 1:90706764-90706786 AAAGAATGAAGTCTGACGGCGGG + Intergenic
911343778 1:96672746-96672768 GAATTAGTAAGCTTGAAGGCAGG - Intergenic
917075909 1:171204631-171204653 GAATATGGTAGTTGCACGGCAGG - Intronic
920442216 1:205988897-205988919 GAGTAAGGACATTTGAGGGCCGG + Intronic
922517132 1:226215836-226215858 GAAGAAGCAAGGTTGCCGGCTGG - Intergenic
924185177 1:241481171-241481193 GAATATGGAAGGTTGAAGGTAGG - Intergenic
1063515200 10:6688452-6688474 GAAAAAGGACGTTTGGCGGTGGG - Intergenic
1064522258 10:16215532-16215554 GAAAAAGGAAGAATGACGGAGGG + Intergenic
1066563665 10:36697175-36697197 AAATAAGTAAGTTTAAGGGCCGG + Intergenic
1072218730 10:93309684-93309706 GAACAAGAAAGTCTGAAGGCAGG + Intronic
1074698385 10:116071430-116071452 AAATAAGGAAGTATGACTGCAGG - Intronic
1077156381 11:1093798-1093820 CAGTAAGGAAGTGTGACGGAAGG - Intergenic
1079477794 11:20849438-20849460 GAGTATGAAAGTTTGAAGGCAGG - Intronic
1081031847 11:38094203-38094225 GAAAAAGGAAGTTTCACAGCTGG + Intergenic
1083036514 11:59642478-59642500 CAATAAGGAAGATGGACAGCTGG + Intronic
1087996903 11:104820652-104820674 GAATCAGGAATTTTGATGTCTGG - Intergenic
1104701191 12:130905396-130905418 GATTAAGGAAGTTAGAAGACTGG + Intergenic
1107988947 13:45800546-45800568 GAACAAGGAAGGTTGAGGGTGGG - Intronic
1109398430 13:61791880-61791902 GAAACAGGAATTTTGACAGCGGG - Intergenic
1109961433 13:69637603-69637625 GAATTAGTGAGTTTGATGGCAGG - Intergenic
1110162268 13:72392768-72392790 GAATATGGAGGTTTGAAGGAAGG - Intergenic
1117953612 14:61106259-61106281 GAATAATGTGGTTTGAGGGCTGG + Intergenic
1128768231 15:70264082-70264104 GAGTGAGGAAGATTGACTGCAGG + Intergenic
1130826105 15:87547910-87547932 GAATAAGGAAGTGTGGCTCCAGG + Intergenic
1133443022 16:5836504-5836526 GAATAAGGAAGTATGGAGGATGG - Intergenic
1134244252 16:12528194-12528216 AAATAAAGAAGCTTGACGTCTGG - Intronic
1141565194 16:84896943-84896965 GATTAAGGAGGGTGGACGGCCGG - Intronic
1142198268 16:88748769-88748791 AAATAAGAAACTTTGATGGCTGG + Intronic
1145233813 17:21194530-21194552 GAATATGGACGTTTGCCAGCAGG + Intergenic
1150899060 17:69250230-69250252 GACTAATGAAGTCTGATGGCTGG - Intronic
1151357142 17:73566153-73566175 GAAGAAGCAAGTTAGAAGGCAGG - Intronic
1154276933 18:12969729-12969751 GAAAAAGGAAGTTTGTGGCCAGG + Intronic
1155148811 18:23106041-23106063 AAATCAGGAAGTTTGAAGACTGG + Intergenic
1158558290 18:58492984-58493006 CATTAAGGAAGTTTGGAGGCTGG - Intronic
1166582271 19:43912257-43912279 GAACAAGCAAGTTTCAGGGCAGG + Intergenic
925401527 2:3576296-3576318 GAATAAGGAAATGTGAAGGTTGG + Intronic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
927698869 2:25254950-25254972 GAATAAGGAAGTTTGACGGCCGG - Intronic
930724077 2:54665776-54665798 TAATAAGGAAGGTTGAGGGTTGG + Intronic
931537382 2:63293770-63293792 GAATCAGGAACTTTGAAGACAGG + Intronic
936940225 2:117877204-117877226 GAATAAGTAAGCTTGAAGACAGG - Intergenic
940708622 2:157135214-157135236 GGAGAAGGAAGCTTGAAGGCAGG - Intergenic
941241240 2:163040984-163041006 GCACAAGGAAGTTTCAGGGCTGG - Intergenic
941714957 2:168754186-168754208 GAACAAGGAAGTTGGAAGGAAGG + Intronic
946931518 2:224676086-224676108 GAAAAAGTAAGTCTGAAGGCAGG - Intergenic
948271004 2:236673129-236673151 GAATATGGAAGTGTGAGGGTGGG + Intergenic
1175575416 20:60057185-60057207 CAATAAGGCACTTTGATGGCAGG - Intronic
1176136820 20:63526701-63526723 GAAGAAGGAAATTTGTTGGCTGG + Intergenic
949364348 3:3264511-3264533 GAATAAGGAAGCTGGACTGGAGG + Intergenic
953859024 3:46526595-46526617 AAATAAAGAGGTTTGACTGCTGG - Intronic
960361798 3:116721618-116721640 GAATCAGGAAGATAGAGGGCTGG - Intronic
960522673 3:118673435-118673457 GAGTTAGGAAGTTTGAGGCCTGG - Intergenic
961342303 3:126235804-126235826 GAAGAAGGAAGAATGAAGGCAGG - Intergenic
961972169 3:130980372-130980394 GAATAAAGAATTTTCAAGGCTGG - Intronic
962480552 3:135794458-135794480 GGATAGGTAAGTTTGAAGGCTGG - Intergenic
966608974 3:181849641-181849663 TAATAAGGAACATTGACGGTTGG + Intergenic
971240360 4:24883017-24883039 GGATAAGGAAGTTAGGAGGCTGG - Intronic
971573253 4:28241081-28241103 GAAGAAGGATGTTTGAGGGAGGG + Intergenic
980952875 4:139398990-139399012 GAATAAGGAGGTTTGAGGAGAGG + Intronic
980960394 4:139469292-139469314 GAATAAGCAAGCTTGAAGACAGG - Intronic
981329368 4:143489956-143489978 GAATAAGTGAGCTTGAAGGCAGG + Intergenic
983078639 4:163357351-163357373 GATTAGGGAATTTAGACGGCGGG - Intergenic
992133620 5:73720367-73720389 GAAAATGGTAGTTTGACGGGAGG + Intronic
995947816 5:117671168-117671190 GAATAAAGAAGTGTGACAGGAGG + Intergenic
1003034414 6:2630656-2630678 GAATGAAGAATTTTGATGGCAGG - Intronic
1004048253 6:12047383-12047405 GAATCAGGAAGTTGGACGGTTGG + Intronic
1008319424 6:50089783-50089805 GAATAGGGAACCTTGAGGGCAGG - Intergenic
1020704072 7:11520856-11520878 GAAAAAGTAAGTTTGATGACAGG + Intronic
1021579160 7:22133863-22133885 GAAAGAGGAAGATTGAGGGCTGG + Intronic
1022429257 7:30300074-30300096 GAAAAAGCAGGTTTTACGGCCGG - Intronic
1026166885 7:67918235-67918257 GAAAAAGGAAGTGAGATGGCAGG + Intergenic
1027657994 7:80955201-80955223 GAATCAGGAAGTGTCAGGGCAGG - Intergenic
1030263504 7:107591437-107591459 CAAAAAGGAATTTTGACCGCAGG + Intronic
1037033001 8:14132117-14132139 GAATAAGGAAAGTTGAAGACAGG - Intronic
1038889105 8:31698626-31698648 GAATTAGGAAGTTAGAAAGCGGG + Intronic
1043030015 8:75122700-75122722 AAATAAGTAAGTTTGAAGCCAGG + Intergenic
1043402479 8:79897567-79897589 AATTAAGGGAGTTTGATGGCTGG - Intergenic
1058953795 9:109927201-109927223 AAAGAAAGAAGTTTGAAGGCGGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1187178012 X:16914288-16914310 AAAGAAGGAAGTTAGATGGCTGG - Intergenic
1187516870 X:19979847-19979869 TAATAAGGAACATTGAAGGCTGG + Intergenic
1188923499 X:36009009-36009031 GAAAAAGGAAGTGTGAGGCCAGG - Intergenic
1189732476 X:44035919-44035941 AAATATGGAAGTCTGAGGGCTGG + Intergenic
1196287902 X:113903514-113903536 GAATAAAGAAGTTGGTCGGTGGG - Intergenic
1197296717 X:124728228-124728250 TAATATGGAAGTTTAACAGCAGG + Intronic
1197544616 X:127809608-127809630 GAATTAGTAAGTTTGAAGACAGG + Intergenic
1198919976 X:141714686-141714708 GAATGAGGAAGTCAGAAGGCAGG + Intergenic