ID: 927702227

View in Genome Browser
Species Human (GRCh38)
Location 2:25275905-25275927
Sequence CTGCCTTCCTGCTCCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 464}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927702227_927702242 17 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702242 2:25275945-25275967 GAGGGGGTGCAGGAAGGCCTGGG 0: 1
1: 2
2: 8
3: 65
4: 640
927702227_927702244 25 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702244 2:25275953-25275975 GCAGGAAGGCCTGGGCCAGAGGG 0: 1
1: 0
2: 6
3: 70
4: 523
927702227_927702233 -8 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702233 2:25275920-25275942 GAAGGCAGAGGGGGTGCGGAAGG 0: 1
1: 0
2: 18
3: 115
4: 884
927702227_927702237 0 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702237 2:25275928-25275950 AGGGGGTGCGGAAGGAGGAGGGG 0: 1
1: 1
2: 10
3: 279
4: 2107
927702227_927702239 7 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702239 2:25275935-25275957 GCGGAAGGAGGAGGGGGTGCAGG 0: 1
1: 0
2: 8
3: 167
4: 1980
927702227_927702241 16 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702241 2:25275944-25275966 GGAGGGGGTGCAGGAAGGCCTGG 0: 1
1: 3
2: 17
3: 103
4: 1093
927702227_927702234 -5 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702234 2:25275923-25275945 GGCAGAGGGGGTGCGGAAGGAGG 0: 1
1: 0
2: 4
3: 72
4: 1062
927702227_927702238 1 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702238 2:25275929-25275951 GGGGGTGCGGAAGGAGGAGGGGG 0: 1
1: 0
2: 33
3: 444
4: 3780
927702227_927702240 11 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702240 2:25275939-25275961 AAGGAGGAGGGGGTGCAGGAAGG 0: 1
1: 0
2: 30
3: 391
4: 2777
927702227_927702236 -1 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG 0: 1
1: 0
2: 8
3: 285
4: 2655
927702227_927702235 -2 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702235 2:25275926-25275948 AGAGGGGGTGCGGAAGGAGGAGG 0: 1
1: 0
2: 11
3: 164
4: 1616
927702227_927702243 24 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702243 2:25275952-25275974 TGCAGGAAGGCCTGGGCCAGAGG 0: 1
1: 1
2: 6
3: 51
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927702227 Original CRISPR CTGCCTTCCTGCTCCTCCTT TGG (reversed) Intronic
900189085 1:1345763-1345785 CCAGCTTCCTGCTCCGCCTTGGG - Intronic
901154364 1:7125571-7125593 GTGAGTTCCTACTCCTCCTTGGG - Intronic
901202263 1:7473412-7473434 TTGTCCTCCTCCTCCTCCTTGGG - Intronic
901255530 1:7822635-7822657 CTCCTTTCCTGCTCTTCTTTGGG - Intronic
901668526 1:10840046-10840068 CTGCCTTCCCACTCCACCTGGGG + Intergenic
901971438 1:12912082-12912104 CTGTCTCCCAGCTCCTCCCTGGG - Intronic
902013730 1:13289658-13289680 CTGTCTCCCAGCTCCTCCCTGGG + Intergenic
902372423 1:16014876-16014898 CTGCCGTCCTGCGCCTGCTGGGG - Exonic
902606696 1:17573112-17573134 CTGCCTGCCTCATCCTCCTGGGG + Intronic
903030342 1:20459433-20459455 CTGTCTCCCTTCTCCTCCTCTGG - Intergenic
903197053 1:21698298-21698320 CTGTCTTCCTTTTCCTTCTTTGG - Intronic
903649362 1:24913628-24913650 CAGCATTCCTGCTCCCACTTTGG - Intronic
903768330 1:25748853-25748875 CTGTCTTCCTGCTGAGCCTTGGG + Intronic
904647380 1:31977980-31978002 TTGCCTTCTGGCTCCTTCTTGGG - Intergenic
905656676 1:39690432-39690454 CCACCTTCCTGCTGCTCCGTGGG - Intronic
905821687 1:40997551-40997573 CTGCTTCCCTGCTCATCCTTTGG - Intronic
906154707 1:43607080-43607102 CTGCCTTCCTGCTGAGCCTGAGG - Intronic
906207712 1:43996013-43996035 CTGCCTGCCTGCACCTCCTCTGG + Exonic
906840911 1:49138278-49138300 ATCCCTACCTGTTCCTCCTTTGG - Intronic
907243829 1:53094760-53094782 CGGGCTTCCTGCCCCTCCTCAGG + Intronic
908176741 1:61563326-61563348 TTGTCTTCCTGCTACTCCATTGG - Intergenic
908887364 1:68804860-68804882 CTGCCCCCCTGTTCCTCCTGTGG - Intergenic
908918286 1:69158238-69158260 CTGCCTTTCTTCTCCTTCCTAGG + Intergenic
909005905 1:70276070-70276092 TTGCTTTCCTGCTCCTGTTTAGG - Intronic
909515327 1:76501030-76501052 CAGTCTTCCTCCTCCTCCTGGGG - Intronic
910855151 1:91687433-91687455 CTGACTTCCTGCTACCTCTTTGG + Intronic
912392391 1:109313016-109313038 CTGCCTATCTGCTGCTTCTTAGG - Exonic
912547477 1:110461270-110461292 GAGGCTTCCTGCTCCTCCTTGGG - Intergenic
912561426 1:110554492-110554514 CTCCCTGTCTGCTTCTCCTTGGG - Intergenic
912754555 1:112313633-112313655 CAGGCTTCTTGGTCCTCCTTGGG - Intergenic
912800176 1:112715303-112715325 CTGCCTCCCTGCCCCGCCCTCGG + Exonic
914220980 1:145681656-145681678 CTGAATTCCAGCTCCTACTTGGG - Intronic
914473552 1:148004533-148004555 CTGAATTCCAGCTCCTACTTGGG - Intergenic
916444966 1:164863793-164863815 CTGTCTTCCTCATCTTCCTTGGG - Intronic
916947304 1:169741767-169741789 CAGACTTCTTGCCCCTCCTTGGG - Intronic
917700250 1:177573444-177573466 CTCCCTACCTCCTCCTGCTTTGG - Intergenic
917728935 1:177854956-177854978 CTCCCTCCCTGCACCTACTTGGG + Intergenic
917794115 1:178520689-178520711 CTGAGTTCCTGCTGCTCCTTTGG - Exonic
917843740 1:179003268-179003290 CTGCCTGCCTGCCCCTGCTTAGG - Intergenic
918203036 1:182285089-182285111 CTGTCTTCTTGCTCCACTTTGGG - Intergenic
919621232 1:199866440-199866462 CTGAATTCTTGCTCCTCCTAGGG + Intergenic
919753389 1:201052204-201052226 CTGCATTCCTGCTCATGCTCTGG + Intronic
920106190 1:203555423-203555445 CTACCTTCCTGCGCTGCCTTTGG - Intergenic
920116638 1:203626459-203626481 CTGGCTTCCTGCAGCTCCTACGG - Intergenic
920197858 1:204241509-204241531 CTGCCTTCCTGCTCTCCATGAGG - Intronic
920282394 1:204853955-204853977 CTTCTTTTCTGCTCCTCCTTGGG + Intronic
920750879 1:208675643-208675665 TGGCCTTGCTGCTTCTCCTTGGG + Intergenic
920757545 1:208748662-208748684 TTACCATCCTGCTCCTCCTCTGG + Intergenic
921060250 1:211578961-211578983 CCGCCCTCCTGCTCCTGCTCCGG - Intergenic
921185954 1:212669750-212669772 CTGCTGGCCTGCTCCTCCTCGGG - Intergenic
921919466 1:220650174-220650196 CTGCCTTTCTTCACCTGCTTGGG - Intronic
922012595 1:221606217-221606239 CTGTCTTCCTCCCTCTCCTTGGG + Intergenic
922880255 1:228975353-228975375 CTGACTTCCTGCCCTCCCTTGGG + Intergenic
923467513 1:234262570-234262592 CTCCCTTCCTGGTCCTCCGGAGG + Intronic
924153679 1:241154300-241154322 TTCCCTTCCTGTTTCTCCTTGGG - Intronic
1063135511 10:3213225-3213247 TTCCATTCCTGCTCCTCTTTGGG - Intergenic
1063320612 10:5049185-5049207 CTGCCTGCCTGCTCCTCTCTTGG + Intronic
1063478762 10:6351796-6351818 ATGCCTTCCTGCTTCTCCAAGGG - Intergenic
1065431025 10:25655714-25655736 CTCCCTTCTTGCTCCTGCTCTGG - Intergenic
1066160605 10:32723622-32723644 CTCTCTTCCTCCTCCTCTTTAGG + Intronic
1067279615 10:44861318-44861340 CTGGCTTCCTTCTCTGCCTTGGG - Intergenic
1067546383 10:47195394-47195416 CTGCCTTGCCGCTCCTCCTGAGG + Intergenic
1067738580 10:48878232-48878254 CAGCCTGCCTGCTCCTCTGTGGG - Intronic
1068076750 10:52265259-52265281 CTCCCTTCATGCTCTACCTTAGG - Intronic
1068134678 10:52940132-52940154 CTCCCTTCCGGCTCCCCCATCGG + Intergenic
1069418611 10:68225310-68225332 CTGTCTTCCTCCTCCACATTTGG - Intergenic
1069779587 10:70946296-70946318 CTGCCTTCCTGCTGTCCCTACGG - Intergenic
1070900504 10:80023964-80023986 CTCCCTTCCTCCTCCTCTTTTGG - Intergenic
1070902251 10:80039845-80039867 CTCCCTTCCTCCTCCTCTTTTGG - Intergenic
1071835926 10:89416644-89416666 CAGCCCTCCTCATCCTCCTTGGG + Intronic
1072635416 10:97174540-97174562 GTCCCTGCCTCCTCCTCCTTGGG - Intronic
1072718050 10:97764756-97764778 CTGCCTTCCTGCTCTGCCATGGG - Intergenic
1074080628 10:110165691-110165713 CTTCCTGCCACCTCCTCCTTGGG + Intergenic
1074416116 10:113268413-113268435 GTGGCTCCCTGCTCATCCTTGGG - Intergenic
1075556194 10:123434389-123434411 CTTCCTTCCTGCTCGGGCTTGGG - Intergenic
1075895188 10:125989010-125989032 CTGCCTGCCTGAGCGTCCTTGGG + Intronic
1077310420 11:1886469-1886491 CTGCCTCCATGCTCCTCATGGGG - Intronic
1077370759 11:2180559-2180581 CCTCCTTCCTGCTCCTGCTCAGG - Intergenic
1077881419 11:6353659-6353681 CTTCCTCCCTCTTCCTCCTTCGG - Intergenic
1078667450 11:13338583-13338605 CTGCCCTCTTTCTCCTACTTGGG + Intronic
1079010827 11:16826733-16826755 CTGCCTAACTTCTGCTCCTTTGG + Intronic
1080481655 11:32657594-32657616 CTGCCTTCTGGCTCCTGATTGGG + Intronic
1081812446 11:45921719-45921741 CAGCTTTCTTGCTCCTCCTCCGG - Intronic
1082774364 11:57234404-57234426 CTGGGTTCCTGCTCCTTCTTGGG - Exonic
1083631516 11:64097799-64097821 AGGCCTTCCTGCTCCTGCTCAGG + Intronic
1083712115 11:64555888-64555910 CTGCCTTCCTGCCCCTCAGCCGG - Exonic
1084129410 11:67121249-67121271 CTGCCTTCCTCTTCCTCCTTAGG - Exonic
1084268041 11:68014961-68014983 CTGCCTGCCTGCTCACCCTCGGG + Intronic
1084962673 11:72725568-72725590 CTGACTTAATGCTCCTCCCTGGG + Intronic
1085084165 11:73655762-73655784 CTCCCTCCCTCCTCCTTCTTGGG + Intronic
1086140991 11:83500087-83500109 CTGCCTTCCTCATGCCCCTTCGG + Intronic
1086310617 11:85532374-85532396 AAGCCTTCCTGCTCCTCATATGG - Intronic
1086766894 11:90706729-90706751 CTGCCTTCCTGCTACTACTTTGG + Intergenic
1087770974 11:102209749-102209771 CTCCCTCCCTGCTCCTCCTAGGG + Intronic
1088691592 11:112333111-112333133 CTGCCATCCTGCTTCTCCATTGG + Intergenic
1088879300 11:113961047-113961069 CTGGCCTCCTGTTCCTCCTCTGG - Intergenic
1088936326 11:114404100-114404122 CTGCCTTCCTACTCCATTTTAGG - Intronic
1089277176 11:117345284-117345306 CTGTCTTCCTCCTCCTCCTGAGG + Intronic
1089678574 11:120106949-120106971 CTCCATTCCTGCTCCTCATCAGG + Intergenic
1089780912 11:120872680-120872702 CTGCCTTCCTGGACCCCCTCAGG + Intronic
1090204836 11:124878414-124878436 CTGCCCTCCAGCTCCTCCTCCGG - Exonic
1090243816 11:125201920-125201942 CTGCCTTGTGGCTGCTCCTTGGG + Intronic
1090372643 11:126267548-126267570 ATGACTTCCTGCGGCTCCTTCGG - Exonic
1090815915 11:130295353-130295375 CTGCATTGCTGCTTCTCCATTGG - Intronic
1090851144 11:130571730-130571752 CAGCCTTCATTCTCCCCCTTGGG - Intergenic
1091215869 11:133901269-133901291 CTCCTTCCCTGCTCTTCCTTTGG - Intergenic
1091777306 12:3192792-3192814 CTGCCCTCCTCCTCCTCCTCAGG - Intronic
1091897521 12:4117275-4117297 CTTCTCTCCTGCTCCTCCTTTGG + Intergenic
1092424942 12:8367327-8367349 CTGCCTCCATGCTTTTCCTTGGG + Intergenic
1094586569 12:31782429-31782451 CTCCCTTCTGGCTCCTCCATCGG + Intergenic
1096121461 12:49091862-49091884 CTTCCTTCCTCCTCCTCCTTTGG + Intronic
1096434873 12:51581073-51581095 CTGTCTTTCTTCTTCTCCTTGGG + Intergenic
1096519967 12:52179442-52179464 CTGCCTTCCTGCTGCTCCCAAGG + Intronic
1096600992 12:52729340-52729362 CTGCCTTCCTGGAGCTACTTTGG + Intergenic
1096785894 12:54017124-54017146 CTGCATTCCTCCTGCCCCTTGGG - Intronic
1100687629 12:97004088-97004110 CTGCCTTCCACCTCCTCCTATGG + Intergenic
1101348464 12:103906690-103906712 CTGGCTTGCTCCTCCTCCCTTGG + Intergenic
1102036349 12:109772440-109772462 CTGACTACCTGTGCCTCCTTGGG + Intergenic
1102240205 12:111320428-111320450 CTGTCCTCCTCCTCCTCCTCTGG + Exonic
1102623890 12:114219048-114219070 CTGCCTTCCTGTCTCTCTTTGGG + Intergenic
1102879668 12:116474554-116474576 CTGCATTTCTAGTCCTCCTTCGG - Intergenic
1103034792 12:117647691-117647713 CAGACTTCCTTCTCATCCTTAGG - Intronic
1103143675 12:118575049-118575071 CTTCCATCCTGTTCCACCTTGGG + Intergenic
1105682669 13:22745224-22745246 CTGCCTATCTGCTCCTCTCTAGG + Intergenic
1105717525 13:23082090-23082112 CTCCCTTCTTCCTCCTCCTCAGG + Intergenic
1105812952 13:24010719-24010741 CCTCCCTCCTGCTCCTCCATGGG + Intronic
1105955906 13:25282457-25282479 CTGGCTGCTTCCTCCTCCTTGGG - Intronic
1106593531 13:31118155-31118177 CTGCCTCACTCTTCCTCCTTAGG + Intergenic
1107212313 13:37871452-37871474 CTGCCTAACTGCTCCTCTATGGG + Intergenic
1107805899 13:44153686-44153708 CTGCCACCCTGCACCTCCCTGGG - Intronic
1108456155 13:50615794-50615816 CTGCCATGCTGATCCTCCTAAGG + Intronic
1109980243 13:69897630-69897652 CTGCCTTTCCCCTCCTCTTTAGG - Intronic
1110835177 13:80074678-80074700 CTCCCTTCTGGCTCCTCCATTGG + Intergenic
1111938302 13:94581421-94581443 CAGCCTTCCTGCAATTCCTTTGG - Intronic
1113599654 13:111559659-111559681 CAGCCTTCTTCCTCCACCTTGGG + Intergenic
1113630220 13:111877330-111877352 TTGCCTACCTGCCCCACCTTCGG - Intergenic
1114065625 14:19057215-19057237 CTGCCTTCCTGGTCTTCTTCTGG + Intergenic
1114096636 14:19342786-19342808 CTGCCTTCCTGGTCTTCTTCTGG - Intergenic
1114773670 14:25457049-25457071 TTGCTTTTCTGGTCCTCCTTGGG - Intergenic
1114996991 14:28365796-28365818 CTGTCTGCATGCTCCTCCTAGGG + Intergenic
1115697058 14:35910430-35910452 CTGCCTTTTTGCTGGTCCTTTGG + Intronic
1117448088 14:55823947-55823969 CTGCCTTAGTGCTCCACTTTTGG - Intergenic
1117920123 14:60720905-60720927 CTTCCTACCTCCTGCTCCTTTGG - Intronic
1118662785 14:68032934-68032956 CTGCCTTCCTGATCCTTCTTGGG + Intronic
1118790151 14:69083675-69083697 CTGCATTGCTGCTTCTCCATTGG - Intronic
1119272988 14:73326094-73326116 CTCCCTTCCTGTGCCTTCTTTGG - Intronic
1119485621 14:74984849-74984871 GTCCCCTCCTGCTCCTCCTGGGG + Intergenic
1119612912 14:76078831-76078853 CTGGCCACCTCCTCCTCCTTGGG + Intronic
1119899130 14:78244873-78244895 GTGCCTCCCTGCTTCTCCCTGGG - Intronic
1121738359 14:96234443-96234465 TTGCCTTCCGGCTTCTCTTTGGG - Intronic
1122366296 14:101196839-101196861 ATGCCTACCTGCTCCTGCTTTGG - Intergenic
1122893530 14:104744036-104744058 CTCCCTTCCTGGTCCATCTTCGG - Intronic
1123019997 14:105393176-105393198 CTGTCATCTTGCTGCTCCTTCGG - Intronic
1123136349 14:106031032-106031054 CTGCCCCACCGCTCCTCCTTGGG + Intergenic
1124165036 15:27318772-27318794 CTGCCTCCCTCCTCCTCTCTGGG + Intronic
1124512677 15:30340343-30340365 GTGCCTTCCTTCTCCCCCTGGGG - Intergenic
1124730238 15:32190407-32190429 GTGCCTTCCTTCTCCCCCTGGGG + Intergenic
1126067571 15:44837749-44837771 CTGCCTTTCTTCTCCTCCCAGGG - Intergenic
1126092307 15:45063133-45063155 CTGCCTTTCTTCTCCTCCCAGGG + Intronic
1126107168 15:45154201-45154223 CTGGGTTCCTGCCCCTACTTTGG + Intronic
1127386220 15:58469393-58469415 CTTCCTTTGTGCTCTTCCTTTGG - Intronic
1127471616 15:59295439-59295461 TTGCCTTCCTGGCCCTCCTTCGG - Intronic
1128542908 15:68549491-68549513 CTTCCCTCCTGCTCCCACTTTGG + Intergenic
1129021885 15:72527421-72527443 CTGTCTCCCTGCTCCTGCCTGGG + Intronic
1129108078 15:73322730-73322752 CTGCCTTCCCGCTCTTCCCCAGG - Exonic
1129175636 15:73837967-73837989 CTGCCTTGCAGCTCCTCCCCAGG + Intergenic
1129412267 15:75356505-75356527 CTGGCTTCCTGCCCCTTCTAGGG - Exonic
1129440610 15:75578706-75578728 CCGCTTACCTGCTCCTCCTCCGG + Exonic
1129664780 15:77573470-77573492 CTTACTTCCTACTCCGCCTTGGG - Intergenic
1130024507 15:80259948-80259970 CTGCCTTCTTCCTTCTTCTTGGG + Intergenic
1130832554 15:87616386-87616408 CTCCCTTGTTCCTCCTCCTTGGG - Intergenic
1131095963 15:89654616-89654638 CTGCCTTCCAGCTCCTGGTCTGG - Intronic
1132225135 15:100134445-100134467 ATGTCTTCCTGCTCCAACTTGGG - Intronic
1133073409 16:3261921-3261943 CTGGCTTACTCCTCTTCCTTTGG - Intergenic
1133373297 16:5262707-5262729 CTGCCTCCATGCTTTTCCTTGGG - Intergenic
1134599111 16:15519632-15519654 CTGCCCTCCTTGGCCTCCTTGGG + Intronic
1136561233 16:31040315-31040337 CTGCCTTTCTGCACCCCCATAGG + Intronic
1136609582 16:31358072-31358094 GTGCCTTCCAGCACCTCCGTGGG + Intronic
1136632525 16:31497225-31497247 CAGCCCTCCAGCTCCTGCTTGGG + Intronic
1137308725 16:47231945-47231967 CTGCCTTCCTCTTTCTCCTATGG - Intronic
1138507561 16:57485919-57485941 CTGCCTTCCTGCTCCTCCCCGGG - Intronic
1139525360 16:67512450-67512472 CTCCCTTCCTTCTCCTCCCTGGG - Intergenic
1139979235 16:70840297-70840319 CTGCTTTCCTGCTTCACCTGAGG - Intronic
1140297698 16:73725395-73725417 GGGTCTTCCTGCTCTTCCTTTGG - Intergenic
1140342166 16:74175026-74175048 CTGCCTCCCTGCTAATCTTTGGG - Intergenic
1140805822 16:78531323-78531345 CTGCCTTCTTTCTCATCCTAAGG - Intronic
1141878376 16:86841882-86841904 CTGCCTCCATTCTCCTCCCTGGG + Intergenic
1141985510 16:87577226-87577248 CTGCCTGCCTCAGCCTCCTTGGG + Intergenic
1142535562 17:615532-615554 CTCCCTTGCTGCCCCTCCCTAGG - Intronic
1142866090 17:2792460-2792482 CTGCCTTCCTCTCCTTCCTTGGG - Intronic
1143186340 17:5012657-5012679 CTGCCTTCCTGCCACCCCTTAGG - Intronic
1143521484 17:7446750-7446772 CTCCCTTCCTGGGCTTCCTTTGG + Intronic
1144778993 17:17798553-17798575 CTGCCTGCCTGCCTGTCCTTTGG - Intronic
1146176537 17:30668995-30669017 CAGCCTTCCTGCTTCGCCTAGGG + Intergenic
1146285272 17:31570356-31570378 CTGCCTTCAGGCTCCTCCTATGG - Intergenic
1146349999 17:32085109-32085131 CAGCCTTCCTGCTTCGCCTAGGG + Intergenic
1146673595 17:34758219-34758241 CTTCCTTCCTCCTCATCCCTGGG + Intergenic
1147716694 17:42513447-42513469 CTGCCCTCCTGCAGGTCCTTAGG + Intronic
1148474363 17:47917148-47917170 CTGTCCTCCTTCTCCTCCTCTGG + Intronic
1148777814 17:50105454-50105476 CTGCCTTCCTGCCCCACCCAGGG - Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1149932453 17:60769583-60769605 CTGCCTAGCTGCTCCTACTGAGG - Intronic
1150816610 17:68396869-68396891 CTGCCTGGCTGCTCCTGCTTAGG - Intronic
1151275078 17:73028071-73028093 CTGCCTTCATTCTGCTCCTGGGG + Intronic
1151717114 17:75836541-75836563 CTGCCTTCCTCTTCCTCGGTGGG - Intronic
1152228282 17:79102623-79102645 CCCTCTCCCTGCTCCTCCTTGGG + Intronic
1152258059 17:79251827-79251849 CTGCCCACCTGCTTCTCCCTCGG + Intronic
1152407139 17:80104274-80104296 CTGCCTTGCTGGTCTTCCTGGGG + Intergenic
1152408254 17:80109441-80109463 CTGCCTCCCACCTCCTCCTCTGG - Intergenic
1152431876 17:80252840-80252862 CTGGCTTCCTTCTCTTCCCTGGG - Exonic
1152444316 17:80332227-80332249 GCGGCTTCCTGGTCCTCCTTAGG - Exonic
1152570772 17:81120442-81120464 CTGTCCTCCTCCTCCTCCTCCGG + Exonic
1153310517 18:3673241-3673263 ATGCCTCCCTGGTCCTCCTGCGG + Intronic
1154042800 18:10874798-10874820 CTGCCATCCTTCTCAGCCTTTGG - Intronic
1155147293 18:23094634-23094656 CTTCCTTCCTCCCCCTCCCTGGG - Intergenic
1155567380 18:27150469-27150491 CTGCCTCCCAGCTCTTACTTAGG + Intronic
1156030493 18:32707217-32707239 CTGGCTTCCTGCTCCTCAGGAGG - Intronic
1157160888 18:45313284-45313306 CTCCCTTCCTGCTCCACACTAGG + Intronic
1157514016 18:48298312-48298334 CTGCCTTACTTGTCCTCCTGGGG + Intronic
1158820186 18:61150422-61150444 CTGACTTTCTGCTCCATCTTAGG + Intergenic
1159080048 18:63726415-63726437 CTCCCTTACTGCTTATCCTTAGG - Intronic
1160509515 18:79445359-79445381 ATGCCTTCCTTCTCGTGCTTTGG + Intronic
1160568774 18:79802569-79802591 CTGCCTTCCTTCTCCAGCTCAGG + Intergenic
1161058948 19:2204846-2204868 CGCCCTTCCTGCTCCTCCTGAGG + Intronic
1161494391 19:4579652-4579674 CTGCATCCCAGCTCCTCCTAAGG - Intergenic
1161566299 19:5004712-5004734 CCGCCTTCCTGCCCCTCTGTGGG - Intronic
1161636486 19:5392565-5392587 CTGCCTTCCTGCCTCTCCAGCGG + Intergenic
1162186612 19:8910002-8910024 CTTCCTTGCTGCACCTCCTAGGG - Intronic
1162700882 19:12513770-12513792 CTTCCTTACTACGCCTCCTTTGG + Intronic
1162725229 19:12686274-12686296 CTCAGTTCCTTCTCCTCCTTTGG + Intergenic
1162982287 19:14247894-14247916 CAGCCTTCCTGCTTCGCCGTAGG - Intergenic
1163837329 19:19582864-19582886 CTGACTGCATGCTCCCCCTTAGG + Intronic
1163842355 19:19619033-19619055 CAGAGTTCCTGCTCCTCCTCAGG + Intergenic
1164455577 19:28403986-28404008 CTGGCCTCCAGCTGCTCCTTGGG + Intergenic
1164849316 19:31468383-31468405 CTCCCTTCCTGCTCCCTTTTTGG - Intergenic
1165730367 19:38141221-38141243 ATGCTTTCCTGCTCCGTCTTGGG - Exonic
1165855612 19:38878044-38878066 CTTCCTTCCTGCTCTTGCCTGGG - Intronic
1166473073 19:43096921-43096943 CTGCCTTCCTGGGCCTACTTAGG + Intronic
1166510662 19:43406700-43406722 CTGTCTTCCTGCGCTCCCTTCGG - Intronic
1167304056 19:48696723-48696745 CTGTCTTCCTGCACCTCCCCGGG - Intronic
1168092414 19:54095032-54095054 CTTCCTTTCAGCTACTCCTTGGG + Exonic
1168719805 19:58548740-58548762 TAGCCTTCCTGCACCTCCATGGG - Exonic
926000404 2:9327063-9327085 CAGCTTTCCACCTCCTCCTTGGG + Intronic
927080597 2:19626086-19626108 CTGCCTACATGCACCTCCCTGGG + Intergenic
927702227 2:25275905-25275927 CTGCCTTCCTGCTCCTCCTTTGG - Intronic
927721016 2:25382179-25382201 CTCCCTACCTTCACCTCCTTGGG + Intronic
927805997 2:26147267-26147289 CTGTCTTCCTGCTCCCCTCTGGG - Intergenic
927910770 2:26897919-26897941 CTTCCTTCATGCTCCTATTTTGG - Intronic
928181713 2:29072775-29072797 TTGTCTTCCTCCTCCTCCTCTGG + Exonic
928967588 2:36992759-36992781 CTGCACTCCAGCTCTTCCTTGGG - Intronic
930152018 2:48068895-48068917 CTGCCTCACTGCTCCTTCTCAGG - Intergenic
931671803 2:64654075-64654097 GCCCCTTCCTGCTCCTCCTGCGG - Intronic
932232740 2:70095883-70095905 CTGCCCTCCTTCTCCTCCCAGGG + Intergenic
932295242 2:70618753-70618775 CTGGCTCCCTGCTCCTCCTTAGG - Intronic
932445097 2:71775754-71775776 CTGCACTCCAGCTCCTGCTTTGG + Intergenic
933509246 2:83218825-83218847 CTGGCTTCCTTCTTCACCTTTGG + Intergenic
933613758 2:84462986-84463008 CTGCCTTCCTCCTCCCTCTGGGG - Intergenic
933655139 2:84880881-84880903 CGGCCTCTCTGCACCTCCTTGGG - Intronic
934890141 2:98060427-98060449 CTGTCTCCCAGCTCCTCCTAGGG - Intergenic
935066270 2:99651288-99651310 CTGCCTTCCTTGGCCTCATTGGG - Intronic
935559839 2:104548608-104548630 CAGCCTTCCTCCTTCTCCTTAGG + Intergenic
936500084 2:113059823-113059845 CTGCCTCCCTGCTACTCTTTGGG + Intronic
936600466 2:113890121-113890143 CTGCTTTCTTGCTACTGCTTCGG + Exonic
936933735 2:117817639-117817661 CTGCATTGCTGCTTCTCCATTGG - Exonic
937076501 2:119111233-119111255 TTGTCTTCCTGCCCCTCCCTTGG - Intergenic
938241693 2:129747392-129747414 CTGCCTGCCTTCTCCTCCCTAGG - Intergenic
938483041 2:131677579-131677601 CTGCCTTCCTGGTCTTCTTCTGG + Intergenic
939869550 2:147511630-147511652 CTGCCTTCCTCCTCCTCCCAGGG + Intergenic
940805425 2:158181615-158181637 GTGCATTCCTGCTCCTTCTTTGG - Intronic
941646849 2:168049797-168049819 CTGTGTTCCTACTCTTCCTTGGG + Intronic
941762979 2:169265050-169265072 ATGCCTTCATTCTCCTTCTTGGG - Intronic
942225738 2:173814228-173814250 CTGCCTTCCTTGAGCTCCTTAGG - Intergenic
944144301 2:196489715-196489737 CTGCCTTCCCACTTCTCTTTGGG - Intronic
944450166 2:199834460-199834482 CTGCCTCCCTCTTCCTTCTTAGG + Intronic
944557708 2:200904470-200904492 CTGCCTGCCTGCTGCTGGTTGGG + Intergenic
944613911 2:201440469-201440491 CTGGCTTTCTCCTCCTCCTTTGG + Intronic
945745568 2:213716934-213716956 TTGCTTTCCTGCACATCCTTTGG + Intronic
946113430 2:217440163-217440185 CCCCCTTTCTGGTCCTCCTTGGG + Intronic
946429779 2:219619138-219619160 CTGATTTCCTGCTTCTCCCTTGG - Intergenic
946603002 2:221372312-221372334 CTGGCCTCCTGCTCTTTCTTAGG + Intergenic
946798481 2:223383208-223383230 ATGCCATCCTTTTCCTCCTTGGG + Intergenic
947202590 2:227628078-227628100 CTGGCTTCCTGTTCTTGCTTTGG + Intronic
948133232 2:235616654-235616676 CTGGCTTCCTGCCCCACCTGTGG + Intronic
1168764709 20:373770-373792 TGGCCTTCCTGCCTCTCCTTAGG + Intronic
1169328551 20:4697757-4697779 CAGCCTCCCTGCTCCTCCCCTGG - Intronic
1169422574 20:5471794-5471816 CTGCCTTCCTGTTCTTCCCCTGG + Intergenic
1169802696 20:9527143-9527165 CCTCCTTTCTGCTCCACCTTGGG + Intronic
1169970367 20:11263473-11263495 CTGCTTTCCTGATTCTTCTTTGG + Intergenic
1170334274 20:15250704-15250726 CTGCCTCCCTTCTTATCCTTTGG + Intronic
1170441632 20:16385408-16385430 CTGCCTTCCTGCCCCCCTATAGG - Intronic
1170781534 20:19430049-19430071 CTTCCTTCCCTCTCCCCCTTGGG - Intronic
1172112405 20:32554795-32554817 CTCCCTTCCTGGACCACCTTTGG - Intronic
1172388841 20:34552550-34552572 CTGCCTCCCCGCTACTCCTCTGG - Intronic
1172929380 20:38573687-38573709 CTGTGTTCCTGCTTCTCCTCTGG + Intronic
1173773576 20:45684514-45684536 CTACCCTCCTTCTCCTTCTTTGG - Intergenic
1175428530 20:58887252-58887274 CTTCCTTCCTGCTTCTACTGTGG - Intronic
1175935254 20:62511017-62511039 CTGCCTTCCTGCCCCAACTCAGG - Intergenic
1176258773 20:64167944-64167966 CTGCCGTGCTGCTCCCCCGTGGG + Intronic
1177932117 21:27298121-27298143 CTTCCTTCCTTCTCCTCCCCTGG - Intergenic
1178793496 21:35722101-35722123 CTGACTCCCTGCCCCTCCTCAGG + Intronic
1179480964 21:41678402-41678424 CTGCCTCCCTGCTTCTCCATCGG + Intergenic
1179546125 21:42113367-42113389 CTGCATCCTTGCCCCTCCTTGGG - Intronic
1179889919 21:44330294-44330316 CTGCCATCCTGCTGCTGCTGCGG - Exonic
1180173861 21:46078091-46078113 CGGCCTTCCTGCTCCCCACTGGG + Intergenic
1180484106 22:15779808-15779830 CTGCCTTCCTGGTCTTCTTCTGG + Intergenic
1181688872 22:24547176-24547198 CTGCTTCCCTGCTCCTGCTTAGG - Intronic
1181748700 22:24973993-24974015 CTGCCCAGCTGCACCTCCTTTGG + Intronic
1181779307 22:25181262-25181284 ATGGCTTCCTGGTCCACCTTTGG + Intronic
1182353855 22:29713389-29713411 CTGCTCTCCTGCTACTCCTGGGG - Intergenic
1183077006 22:35433636-35433658 CTGTCGTCCTGCCCCTTCTTGGG + Intergenic
1183545089 22:38451162-38451184 CTGCTTCCCAGCTCCTCTTTGGG + Intronic
1183586722 22:38757051-38757073 CAGCCTTCCTGTTCCTGCCTCGG - Intronic
1184304861 22:43590878-43590900 CTGCCCTTCTTCTCCTCCTTAGG - Intronic
1184340454 22:43883041-43883063 CTCCCTTCCTGCTCCTCGAATGG + Intronic
949122104 3:398760-398782 CTGCCTTCATTATCCTTCTTTGG + Intronic
950410210 3:12831243-12831265 GTGCTTTTCTGATCCTCCTTGGG + Intronic
950532504 3:13560456-13560478 CTGTCTCCCTCCTCCTCCTTGGG + Intronic
950569368 3:13790675-13790697 CTGCCCTCCTGCTTCCCATTGGG + Intergenic
950751653 3:15133875-15133897 CTGCCTCCATGCTTTTCCTTGGG - Intergenic
951476547 3:23112659-23112681 CTGCCTTCTGGCTCCTGGTTGGG + Intergenic
953334257 3:42080442-42080464 CTGCCTTCCTGCAGCTCTCTAGG + Intronic
953540439 3:43813254-43813276 ATGCTTTCCTTCTCCACCTTGGG + Intergenic
953839145 3:46374784-46374806 CATCCTTCCTGACCCTCCTTTGG - Exonic
953988293 3:47462864-47462886 CTCCCTTCCTGCTTCCCCATAGG + Intronic
954070643 3:48140444-48140466 CTGCCTCCCTGTTCGTCCTCGGG - Intergenic
954241595 3:49298123-49298145 CAGCCATGCTGCTCCCCCTTGGG - Intronic
955155087 3:56408829-56408851 CTGCGTTGCTGCTGCTCCTGGGG - Intronic
955193673 3:56785207-56785229 CTGCCTTCCTTTTCTTCCTGTGG + Intronic
956289528 3:67647047-67647069 CAGCCCTCCTGAACCTCCTTAGG + Intronic
956694661 3:71908144-71908166 CTGTCTGCCTGCTCCTCACTTGG - Intergenic
959269732 3:104192333-104192355 CTCCCTTCTGGCTCCCCCTTTGG - Intergenic
960387337 3:117035986-117036008 CTGCCTCTCTGCTCCTCCCCTGG - Intronic
960869030 3:122230784-122230806 CCACCTAGCTGCTCCTCCTTGGG - Intronic
960951210 3:122999667-122999689 CTGCATGACTGCTCCTCCCTGGG - Intronic
961163036 3:124745665-124745687 CTCCCTTCCTGCTCCTTCTGTGG - Intergenic
961184681 3:124904287-124904309 CCCCCTTCCTGATCCCCCTTTGG - Intergenic
963035177 3:141019552-141019574 CTGCCTTGCTGCTCCACCCCAGG + Intergenic
964290919 3:155179243-155179265 TTCTCTTCCTGTTCCTCCTTAGG - Intronic
964476262 3:157100430-157100452 CCTCCTTCGTGCTCTTCCTTCGG + Intergenic
964883969 3:161458996-161459018 CTCACTTCCCACTCCTCCTTTGG + Intergenic
965537366 3:169837071-169837093 CTGCCTTCCTGCTCCTTACTGGG - Intronic
965735109 3:171810935-171810957 AAGCCTTCTTGCACCTCCTTAGG + Intronic
965783807 3:172315603-172315625 CTGCCTTTCTGCTCCTAATGGGG - Intronic
966715084 3:183006553-183006575 CAGCCTTGCTGCCCCTCCGTGGG - Intergenic
967549066 3:190767999-190768021 CCGCCTTCCTAGGCCTCCTTTGG - Intergenic
968446667 4:655571-655593 CTGCCTTCTTCCTCCTCCCCAGG - Intronic
968622216 4:1608942-1608964 TCTCCCTCCTGCTCCTCCTTGGG - Intergenic
969013293 4:4084974-4084996 CTGCCTCCATGCTTTTCCTTGGG + Intergenic
969146884 4:5131615-5131637 TTGCCTGCCTGCTGCTCCTGGGG + Intronic
969183486 4:5459249-5459271 CTGACTTCCAGCTCCACCTGTGG + Intronic
969407282 4:7001949-7001971 CTACCTTCCTGCTCTTTCTTGGG + Intronic
969438175 4:7200337-7200359 CTGCCTTCCCTCTCCTCCCTGGG + Intronic
969456435 4:7302478-7302500 CTGGCTCTCTGCCCCTCCTTCGG + Intronic
969535992 4:7756414-7756436 CTGCCCTCCTGCTGCGACTTAGG + Intergenic
969608841 4:8216056-8216078 CTGCCTCCCTGCCCCTCTTCTGG + Intronic
969725429 4:8915587-8915609 CTGCATCCCTGCCCCTCCTGGGG - Intergenic
969740559 4:9022832-9022854 CTGCCTCCATGCTTTTCCTTGGG - Intergenic
969799903 4:9555661-9555683 CTGCCTGCATGCTTTTCCTTGGG - Intergenic
972413448 4:38815632-38815654 CTTCCTTCCTAAGCCTCCTTAGG + Intronic
972641319 4:40927723-40927745 CTGCCTGCCTGAGCCTCCCTAGG + Intronic
972963892 4:44486394-44486416 CTGCCTGGATGCTTCTCCTTTGG + Intergenic
976061831 4:81137649-81137671 CTGCCTTGCTTCTGCTCCTGTGG + Intronic
976180426 4:82393744-82393766 CTGCCTTCATGCTCTTCCTCAGG + Intergenic
977451694 4:97206998-97207020 CTTCCCTCCCACTCCTCCTTAGG - Intronic
981681733 4:147407419-147407441 GTGGCTTCCTGCTGCTCCCTTGG + Intergenic
981965221 4:150591927-150591949 CTGCCTTCCTGCTTGTCGTAAGG - Intronic
982173986 4:152688223-152688245 CTGCCTACATTCTCCTCCTCTGG + Intronic
982319618 4:154064564-154064586 CTGCATCCCTGCTCCTCTTTGGG + Intergenic
982563951 4:156965714-156965736 CTCCCTTCCTGCAGCTCTTTTGG - Intronic
982870375 4:160572658-160572680 CAGCCTTCCTCCTCTTTCTTGGG - Intergenic
984670878 4:182486053-182486075 CTGTCTTCCGGCTCCAGCTTTGG - Intronic
984785647 4:183565168-183565190 CTGTCTTCCCTTTCCTCCTTGGG + Intergenic
985341465 4:188959216-188959238 CACCCTTCCTGCTGCTGCTTTGG + Intergenic
986017666 5:3771857-3771879 CTGCCTCCTTACTCCTGCTTCGG - Intergenic
986067148 5:4245769-4245791 CTGACCTCGTTCTCCTCCTTGGG + Intergenic
986074121 5:4316746-4316768 CTGCCTTCCTGGAAGTCCTTAGG - Intergenic
986314095 5:6574553-6574575 CTCCCTTGCAGCCCCTCCTTTGG - Intergenic
987158747 5:15117700-15117722 ATGCATTCCTCCTCCTCCTTTGG + Intergenic
989464700 5:41741197-41741219 CTGCCTGCCTCGGCCTCCTTTGG + Intronic
991446614 5:66707147-66707169 CTGACTTCCAGTCCCTCCTTGGG + Intronic
992052218 5:72951674-72951696 CTCCCTGCCTGCTCCTCATGTGG - Intergenic
994531842 5:100982297-100982319 CTGTCTGCATGCTCCTCCTAGGG + Intergenic
996242442 5:121220824-121220846 CTGGCTTCTTGCTCTTCCTGGGG - Intergenic
997411789 5:133696374-133696396 CAGCCTTCCTGCAGGTCCTTGGG + Intergenic
997579047 5:135005836-135005858 CTCCCTGCCTCCTCCTCCTGGGG + Intronic
997598889 5:135126163-135126185 CTGCCACCCTGCCCCACCTTAGG + Intronic
998131135 5:139651514-139651536 CTGCCTGCCTCCTACTCATTTGG + Intronic
998208372 5:140175433-140175455 CTGCCTCCCTGCCCCTCCCCAGG - Intronic
998599857 5:143574666-143574688 CTGCCCTCTAGCTCCTCCATTGG + Intergenic
999136662 5:149324870-149324892 CAGCCTTGCTGTTCCTTCTTGGG - Intronic
999449076 5:151665119-151665141 CTGCATCCCTGCCCCTCCCTGGG - Intronic
999833296 5:155341460-155341482 CTGCCTTCCTGCTGCACTGTGGG - Intergenic
1000012344 5:157244599-157244621 CTCCCTTCCTTCACCTACTTTGG + Intronic
1000215220 5:159148924-159148946 TTGCCTTTCCTCTCCTCCTTGGG - Intergenic
1000775130 5:165410206-165410228 CTGCCTTCGTGCTGCTACTCTGG - Intergenic
1002066368 5:176654050-176654072 TTCTCTTCCTTCTCCTCCTTTGG - Intronic
1002290712 5:178198859-178198881 CAGACTTCCTCCTCCTCCTATGG - Intergenic
1002305035 5:178278251-178278273 CTGCCCTCCTGCCCCACCCTTGG + Intronic
1002533952 5:179865858-179865880 CTTCCTTCTTGCTCTTCCTGTGG + Exonic
1002644318 5:180645699-180645721 CTGGCGCCCTGCTCCTCCTCCGG + Intronic
1003212469 6:4079486-4079508 CGGCCTTCCTGGGCCTCCTCGGG + Exonic
1003493398 6:6642857-6642879 CTCCCTCCCTCCTCCTCCTCCGG + Intronic
1003522363 6:6868915-6868937 CCCCCTTCCTGCTCTTTCTTTGG - Intergenic
1003949060 6:11101498-11101520 TTTCCTTCCATCTCCTCCTTCGG - Intronic
1004040957 6:11975087-11975109 CTCCCTTAGTGCTCATCCTTGGG - Intergenic
1004485612 6:16063614-16063636 TTGCCTTCCTCCTCCTCTTCTGG - Intergenic
1005021442 6:21423210-21423232 CTGCCCTCCGGCTGCTTCTTCGG + Intergenic
1005172305 6:23002048-23002070 CTACCTATCTGCTTCTCCTTGGG - Intergenic
1005198298 6:23314386-23314408 CTTCCTTTCTGCTCCTGCATGGG + Intergenic
1005498474 6:26409587-26409609 CTGTCTTGCTGCTGCTTCTTGGG + Exonic
1005812985 6:29530498-29530520 CTTCCTTCATGCTCATCCTGTGG + Intergenic
1006361255 6:33588649-33588671 CTTCCTCCGTGCTCCTCCCTAGG - Intergenic
1006735388 6:36269464-36269486 CTCCCCAGCTGCTCCTCCTTGGG + Intronic
1006991428 6:38217997-38218019 CTGCCTTCAATCTACTCCTTAGG + Intronic
1007382860 6:41502065-41502087 CTCTCTTCCTGCCCCTCCCTTGG - Intergenic
1007578277 6:42939751-42939773 CAGCCTCTCTGCTCCTCCCTTGG - Intergenic
1007964602 6:45992209-45992231 CTGCATTCCTGCACATCCTGTGG + Intronic
1008226166 6:48919771-48919793 CTGCCTCCCTGCTCAGCCTCAGG + Intergenic
1008497366 6:52146531-52146553 CTGCCTGCCAGCTCTTCCTCTGG - Intergenic
1011328135 6:86173381-86173403 CTGGCTTCTTGCTCTTCCTTGGG + Intergenic
1011947097 6:92919235-92919257 CTGCCATCCTGCTCCTCTTCAGG + Intergenic
1013343324 6:109236504-109236526 CTGTCTGCATGCTCCTCCTTGGG - Intergenic
1014747836 6:125220758-125220780 CTGACATCCTCCTCCTCCCTAGG - Intronic
1015293819 6:131567979-131568001 CTGCCTTCTTTCTCGTCGTTTGG - Intergenic
1015729663 6:136335026-136335048 CTGTCTGCCTGCTCCCCCTAGGG + Intergenic
1015881149 6:137870977-137870999 CTGCCTTCCTTCTCTTGTTTAGG + Intronic
1016889171 6:148988651-148988673 CTGCCTTCCTGCCAATCTTTCGG - Intronic
1017918640 6:158852917-158852939 GTGTGTGCCTGCTCCTCCTTCGG - Intergenic
1017980185 6:159394486-159394508 CTGTCTGCCTGCTCCCCCTAGGG + Intergenic
1019348058 7:540079-540101 CTGCCTTCCTGCTCCCACTCTGG - Intergenic
1019603344 7:1896123-1896145 CCGCCTGCCTCCTCCTCCTGGGG + Intronic
1021434175 7:20595331-20595353 CCTCCTTCCTGCTCCTCCACTGG - Intergenic
1022982531 7:35617957-35617979 CTGCCTTCCAGCTCCACTGTTGG + Intergenic
1023722655 7:43112573-43112595 CTCCCTGCCTGCTCCTCTGTGGG - Intergenic
1024440315 7:49408727-49408749 CTGTCTGCATGCTCCTCCTAGGG + Intergenic
1025246165 7:57319241-57319263 CTGGCTTCCTGGTGCTGCTTAGG + Intergenic
1026247540 7:68634508-68634530 CTGACTTCCAGCCCCTCCCTGGG - Intergenic
1026287229 7:68973970-68973992 CTGGCTTCCTGGGTCTCCTTGGG - Intergenic
1026297959 7:69072301-69072323 GTGCCTTCTTCCTCCTCTTTTGG - Intergenic
1028530259 7:91830934-91830956 CTGCCTTCCTTCTCTTTCTCAGG + Intronic
1028654908 7:93193938-93193960 CTGTCCTCATCCTCCTCCTTTGG + Intronic
1028707237 7:93864436-93864458 CTACCTTCCACCTCCACCTTGGG + Intronic
1028720421 7:94024244-94024266 CTCCCTTCCTGCCCCTACCTGGG + Intergenic
1029071937 7:97906610-97906632 CTGCCTCCATGCTTTTCCTTGGG + Intergenic
1029323185 7:99783410-99783432 TTTCCTTCCTTATCCTCCTTGGG + Intronic
1029720893 7:102363889-102363911 CTGGCTTCCTGCGCCTCTTCAGG + Exonic
1031950027 7:127882344-127882366 CTGCCTTCCTTCCCCTCCTATGG - Intronic
1032301301 7:130689921-130689943 CTCCCTGCCTACTACTCCTTGGG + Intergenic
1032376551 7:131425313-131425335 CTGCCTTCCTGCTGGTGCATAGG + Intronic
1033138535 7:138804457-138804479 GAGCCTTCCTGGTCATCCTTGGG + Exonic
1033282726 7:140017418-140017440 CTCCCTCCCTGCCTCTCCTTAGG - Intronic
1033462668 7:141561866-141561888 GTGCTCTCCTGCTCCTCCTAGGG + Intronic
1033529473 7:142247744-142247766 CTCTCTTCCTGCTCCTCCCTAGG - Intergenic
1034016819 7:147596735-147596757 CTGCATTCCTGGACATCCTTAGG + Intronic
1034424662 7:151008164-151008186 CAGCCTTCCTGCTTCTGGTTCGG - Intronic
1034477336 7:151293219-151293241 CTGCCTTCCTGCCAGTGCTTGGG - Intergenic
1034898040 7:154890163-154890185 CTTCCTGCCTTCTGCTCCTTTGG + Intronic
1035317281 7:158004050-158004072 CTGCTTTTCGGCTCCTCGTTTGG + Intronic
1035374889 7:158401396-158401418 CTGCCTCCATGCTGCTCCCTTGG - Intronic
1036691509 8:10947589-10947611 CTGTCTTTCTCCTCCTTCTTTGG - Intronic
1036888507 8:12578634-12578656 CTGCCTCCATGCTTTTCCTTGGG + Intergenic
1037458322 8:19084669-19084691 CTCCCTTCCTTCTTTTCCTTTGG + Intronic
1037572908 8:20173512-20173534 GTGCTTTCCTGCTCTTCCCTGGG - Intronic
1038303688 8:26379827-26379849 TTGGCTTTCTGCTCCTCCATGGG + Intergenic
1039436398 8:37562253-37562275 GGGCCTTCCTGCCCCTTCTTGGG - Intergenic
1040825707 8:51618608-51618630 CTGCAAACCTGCTCCTCCCTGGG - Intronic
1041082589 8:54227458-54227480 CTGCCTTTCCCTTCCTCCTTGGG - Intergenic
1041189891 8:55342687-55342709 CTTGCTTCCTCTTCCTCCTTTGG + Intronic
1041237957 8:55823778-55823800 CTTCCTTCCTCCTCCTCCCCAGG - Intronic
1041762051 8:61377812-61377834 CTGCCCTACTTCTCCTCCTCTGG - Intronic
1042575801 8:70217384-70217406 CTGCCTGGCTGCTCCTCCATCGG + Intronic
1044111503 8:88281044-88281066 ATGACTTTCTGCTCCTGCTTTGG - Intronic
1044582759 8:93838479-93838501 CTTCCCTCCTGCTCCTACTCTGG - Intergenic
1044744303 8:95357378-95357400 CTGCCTTTCGGCTCCTTCTGGGG + Intergenic
1045299697 8:100900346-100900368 GTGCCTTCCAGCTGCTGCTTAGG + Intergenic
1047926256 8:129685858-129685880 CTGGCTTCCTTCTGCTGCTTTGG - Intergenic
1048336660 8:133507664-133507686 CAGGTTTCCTGCTCGTCCTTTGG - Intronic
1048361787 8:133703681-133703703 CTGCCTTCCAGCACTGCCTTTGG + Intergenic
1048517240 8:135122283-135122305 CTGCCTTCCTCCGCCTCCCAAGG + Intergenic
1049370230 8:142260921-142260943 CTGCCTTGCTGCTTCCCCTTAGG - Intronic
1049741734 8:144244307-144244329 CAGCCTCCGTCCTCCTCCTTGGG - Exonic
1050831975 9:10025919-10025941 ATGCCTGCCTGGTCTTCCTTTGG - Intronic
1050957823 9:11687256-11687278 CTCCCCTGCTACTCCTCCTTGGG - Intergenic
1051932717 9:22406244-22406266 CTGCCTGCCAGCTCCTCCCAGGG + Intergenic
1052271503 9:26632614-26632636 CTGCCCTCCTGCTCATGTTTTGG - Intergenic
1053225457 9:36351820-36351842 CTGCCTACCTGCTCCTCTCAAGG - Intronic
1053596500 9:39566999-39567021 CTTCCTTCCTGCTGCTCCACAGG + Intergenic
1053854465 9:42323639-42323661 CTTCCTTCCTGCTGCTCCACAGG + Intergenic
1054569759 9:66798019-66798041 CTTCCTTCCTGCTGCTCCACAGG - Intergenic
1055506921 9:76957492-76957514 CTGCCTTCCTGTGGCTGCTTAGG + Intergenic
1055787267 9:79884252-79884274 CACCCTCTCTGCTCCTCCTTGGG - Intergenic
1055854532 9:80669982-80670004 CTGCCTCCCTTCTCCCTCTTTGG + Intergenic
1056773280 9:89495187-89495209 CTGCCTTGCTGCTTCCCCTGGGG - Intronic
1056969049 9:91187443-91187465 CTCCCTTCCTGCACCTTCCTAGG - Intergenic
1057293785 9:93823878-93823900 CTGCCTTCCTGCTCCGTCTCTGG + Intergenic
1057571856 9:96210398-96210420 CTGCCTTTTTGTTCCTCCTTTGG + Intergenic
1057961766 9:99464150-99464172 ATGCCTTCCTGATCCTTCTATGG + Intergenic
1058864565 9:109149691-109149713 CTTCCCTACTGCTCCTCCTGTGG - Exonic
1058969148 9:110064208-110064230 ACTCCTTCCTCCTCCTCCTTAGG - Intronic
1059389445 9:113989624-113989646 CTGCCTTCCTGGTCCAGCTCTGG + Intronic
1059712358 9:116880696-116880718 CTCCCTTCCTGTTCCTTCTAGGG + Intronic
1059995215 9:119902495-119902517 CTGCCTTCATGATCCTGCTCAGG + Intergenic
1061533039 9:131229719-131229741 CTCCCTTCCTCCTCCTGCCTTGG - Intronic
1061783348 9:133008421-133008443 TTTCCTTCCTGCTCCCCTTTTGG - Intergenic
1062158130 9:135065465-135065487 CTCCCATCCTGCTTCCCCTTGGG + Intergenic
1062635502 9:137488522-137488544 CTGCCTTCCTCTCCATCCTTTGG - Intronic
1062707430 9:137953258-137953280 CTGGCTTCCTGCTCCCACCTTGG + Intronic
1203790690 EBV:150101-150123 CTGCCTCCCTGCCCCTCGGTGGG - Intergenic
1185673901 X:1833124-1833146 CTGTCTTCCTCCTAGTCCTTGGG - Intergenic
1186025663 X:5308121-5308143 CTGTCTTCATGCTGCTCTTTGGG - Intergenic
1186485036 X:9927779-9927801 CTGCCTCCACGCTCCTCCCTGGG - Intronic
1187097322 X:16162200-16162222 CTGTCTGCATGCTCCTCCTAGGG + Intergenic
1187606250 X:20886279-20886301 GTGCCTTCCATCCCCTCCTTTGG - Intergenic
1188900154 X:35722370-35722392 CTTCCTTCCGGCTCCTCCAATGG + Intergenic
1189058652 X:37728110-37728132 ATGCCATCCTCCTCCTCCTGTGG + Exonic
1189876713 X:45443966-45443988 CTACCTTCTTGCTCCCTCTTAGG + Intergenic
1190509661 X:51162595-51162617 CTTCCTCCCTGCTCCTCCTCTGG + Intergenic
1190708248 X:53048398-53048420 CTGCCAGCCTGGTCCTCCCTGGG - Intergenic
1190904366 X:54711176-54711198 CTGCCTTTCTTTTACTCCTTTGG + Intergenic
1191739538 X:64422361-64422383 CTGCTTTGCTGCTCCACCCTGGG - Intergenic
1192159321 X:68771159-68771181 CTGCTTTCTTGCTACTGCTTGGG + Intergenic
1192197335 X:69037180-69037202 CTGCCTTCCTGCTCCTGCAGGGG - Intergenic
1194056529 X:89141217-89141239 CTGTCTTACTTCTCCTCCATAGG + Intergenic
1195040375 X:101008646-101008668 CTTTCTGGCTGCTCCTCCTTGGG + Intergenic
1195679888 X:107537119-107537141 CTGATTTCCTTCTCCTTCTTAGG + Intronic
1196088835 X:111716749-111716771 CTGTCTTCCTACTCTTCCCTGGG - Intronic
1198321491 X:135521863-135521885 CGGTCTTCCTCCCCCTCCTTGGG + Intronic
1198808406 X:140510527-140510549 CTGCCATCCTGCGCCCCCTGTGG - Intergenic