ID: 927702227

View in Genome Browser
Species Human (GRCh38)
Location 2:25275905-25275927
Sequence CTGCCTTCCTGCTCCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 464}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927702227_927702242 17 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702242 2:25275945-25275967 GAGGGGGTGCAGGAAGGCCTGGG 0: 1
1: 2
2: 8
3: 65
4: 640
927702227_927702243 24 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702243 2:25275952-25275974 TGCAGGAAGGCCTGGGCCAGAGG 0: 1
1: 1
2: 6
3: 51
4: 523
927702227_927702241 16 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702241 2:25275944-25275966 GGAGGGGGTGCAGGAAGGCCTGG 0: 1
1: 3
2: 17
3: 103
4: 1093
927702227_927702235 -2 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702235 2:25275926-25275948 AGAGGGGGTGCGGAAGGAGGAGG 0: 1
1: 0
2: 11
3: 164
4: 1616
927702227_927702236 -1 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG 0: 1
1: 0
2: 8
3: 285
4: 2655
927702227_927702238 1 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702238 2:25275929-25275951 GGGGGTGCGGAAGGAGGAGGGGG 0: 1
1: 0
2: 33
3: 444
4: 3780
927702227_927702244 25 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702244 2:25275953-25275975 GCAGGAAGGCCTGGGCCAGAGGG 0: 1
1: 0
2: 6
3: 70
4: 523
927702227_927702240 11 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702240 2:25275939-25275961 AAGGAGGAGGGGGTGCAGGAAGG 0: 1
1: 0
2: 30
3: 391
4: 2777
927702227_927702234 -5 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702234 2:25275923-25275945 GGCAGAGGGGGTGCGGAAGGAGG 0: 1
1: 0
2: 4
3: 72
4: 1062
927702227_927702237 0 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702237 2:25275928-25275950 AGGGGGTGCGGAAGGAGGAGGGG 0: 1
1: 1
2: 10
3: 279
4: 2107
927702227_927702239 7 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702239 2:25275935-25275957 GCGGAAGGAGGAGGGGGTGCAGG 0: 1
1: 0
2: 8
3: 167
4: 1980
927702227_927702233 -8 Left 927702227 2:25275905-25275927 CCAAAGGAGGAGCAGGAAGGCAG 0: 1
1: 0
2: 6
3: 57
4: 464
Right 927702233 2:25275920-25275942 GAAGGCAGAGGGGGTGCGGAAGG 0: 1
1: 0
2: 18
3: 115
4: 884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927702227 Original CRISPR CTGCCTTCCTGCTCCTCCTT TGG (reversed) Intronic