ID: 927702708

View in Genome Browser
Species Human (GRCh38)
Location 2:25277907-25277929
Sequence GGGAAAAATCGTTCTGTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927702708_927702710 -5 Left 927702708 2:25277907-25277929 CCCAAAACAGAACGATTTTTCCC 0: 1
1: 0
2: 0
3: 12
4: 250
Right 927702710 2:25277925-25277947 TTCCCTATGCAGTTTCCAACTGG 0: 1
1: 0
2: 1
3: 11
4: 153
927702708_927702713 6 Left 927702708 2:25277907-25277929 CCCAAAACAGAACGATTTTTCCC 0: 1
1: 0
2: 0
3: 12
4: 250
Right 927702713 2:25277936-25277958 GTTTCCAACTGGCTTCTTTCTGG 0: 1
1: 0
2: 0
3: 29
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927702708 Original CRISPR GGGAAAAATCGTTCTGTTTT GGG (reversed) Intronic
902877564 1:19349917-19349939 TGCACAAATGGTTCTGTTTTTGG - Intronic
904389794 1:30174945-30174967 GGGAAAAGTCTTTAGGTTTTTGG + Intergenic
905324872 1:37144573-37144595 GTGAAAAATAGCTGTGTTTTGGG - Intergenic
905457026 1:38095275-38095297 GGGAAAAATATTTCTCTTTATGG + Intergenic
908193930 1:61730058-61730080 AGGAAAAATTGGTCTGTTTGGGG + Intergenic
908277511 1:62490792-62490814 GGGAAAAATTTTTTTGTTTTTGG - Intronic
911012671 1:93298086-93298108 GAGAAAAATCTTTGTGATTTTGG + Intergenic
912980874 1:114370968-114370990 AGCAAAGATCATTCTGTTTTGGG - Intergenic
914930549 1:151928181-151928203 AGCAAAGATCATTCTGTTTTGGG - Intergenic
915518660 1:156428845-156428867 GGAAAAAATGGTTCTGTATTTGG - Intronic
915652598 1:157328072-157328094 AGCAAAGATCATTCTGTTTTGGG - Intergenic
916200778 1:162269586-162269608 GAGAAAAATAGTTTTCTTTTTGG + Intronic
917232186 1:172850085-172850107 AGCAAAGATCATTCTGTTTTGGG + Intergenic
918911525 1:190578302-190578324 GTGAAAAATCGGGCAGTTTTCGG + Intergenic
920906044 1:210169280-210169302 GGGAGAAATCGTGCTTGTTTTGG + Intronic
921679756 1:218016777-218016799 AGCAAAGATCATTCTGTTTTTGG - Intergenic
923416143 1:233763292-233763314 CTGAAAAATCTTTTTGTTTTTGG + Intergenic
923870892 1:237992935-237992957 GGGAAGCATCATTCTGTTATTGG + Intergenic
923970058 1:239190223-239190245 AGGAAAAACTGGTCTGTTTTGGG + Intergenic
924100699 1:240599957-240599979 GGGAGAAATCATTTTGCTTTGGG - Intronic
924406508 1:243753364-243753386 GTGAAAAATCGTACGCTTTTAGG - Intronic
924546940 1:245037314-245037336 TGTAAAAATAGTTCTGTGTTGGG + Intronic
1064583806 10:16819498-16819520 GGGAAGAATCTTTCTTTTCTAGG - Intergenic
1065496470 10:26334105-26334127 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1065963067 10:30750048-30750070 CTGAAAAATCTTTCTGTTATAGG + Intergenic
1066249804 10:33622065-33622087 GAGAAAAATGGTTCCGTGTTTGG - Intergenic
1067301951 10:45020145-45020167 GGGAAAAATCATGCTTTTTAAGG + Intergenic
1067464124 10:46482386-46482408 CACAAAAATCATTCTGTTTTAGG - Intergenic
1067623071 10:47902265-47902287 CACAAAAATCATTCTGTTTTAGG + Intergenic
1068808802 10:61231830-61231852 AGCAAAGATCATTCTGTTTTAGG - Intergenic
1068920130 10:62474756-62474778 GGGAGAAAACGTTTAGTTTTGGG - Intronic
1071898263 10:90088549-90088571 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1074372669 10:112913053-112913075 AGGAAAAAATGTTCTGGTTTTGG + Intergenic
1074456232 10:113597800-113597822 GGGAAACCTCATTCTGTCTTGGG + Intronic
1074629920 10:115241072-115241094 GTGAAAAATCATTGAGTTTTAGG + Intronic
1076027689 10:127129910-127129932 GGGAAACATGGTTCTGTCTCTGG + Intronic
1076694759 10:132242144-132242166 GGCAAGAAACGTTCTGTTCTGGG - Intronic
1079198538 11:18354324-18354346 GGGAAAAATAGTTAACTTTTTGG - Intronic
1079828595 11:25231783-25231805 GGGTAAATTAGTTTTGTTTTGGG - Intergenic
1081557755 11:44182015-44182037 GAGAATAATCTTTCTGTTTTGGG + Intronic
1082177861 11:49082531-49082553 TTGAAAAATCGATCCGTTTTTGG - Intergenic
1082233562 11:49797883-49797905 GGGAAAAATTCTTCTGCCTTGGG - Intergenic
1083358615 11:62087677-62087699 AGCAAGAATCATTCTGTTTTGGG - Intergenic
1083422616 11:62563434-62563456 GCAAAAAATTGTTTTGTTTTAGG - Intronic
1084326898 11:68405662-68405684 GGGAAAAAGGATTCTTTTTTTGG + Intronic
1084851126 11:71941825-71941847 AGGAAAAATGGTTCTGTATGAGG + Intronic
1085227505 11:74935671-74935693 TGGAAAAAGAGGTCTGTTTTGGG + Intronic
1086687857 11:89753329-89753351 TTGAAAAATCGATCCGTTTTTGG + Intergenic
1086717994 11:90086565-90086587 TTGAAAAATCGATCCGTTTTTGG - Intergenic
1087223704 11:95574467-95574489 GGGCAAAATCATTTTGATTTTGG - Intergenic
1088514359 11:110613790-110613812 GTGCAAAATAGTTATGTTTTGGG - Intronic
1088725544 11:112631199-112631221 GGTACAAAGCATTCTGTTTTGGG - Intergenic
1091398334 12:168018-168040 AGGACAAATTGTTCTGGTTTGGG + Intronic
1092634982 12:10434507-10434529 GGGAAAAATTGTTCTGCTCCAGG + Exonic
1092956985 12:13560288-13560310 GGGAAAAAGTGTTTTGTTATGGG - Exonic
1093708807 12:22305791-22305813 AGCAAAGATCATTCTGTTTTGGG - Intronic
1094803023 12:34060032-34060054 GGGGAAAATAGTTCTGAATTTGG + Intergenic
1095116429 12:38358533-38358555 GGGGAAAATGGTTCTGAATTTGG + Intergenic
1095499141 12:42817357-42817379 GGGAATAATGGGTCTGTTCTTGG + Intergenic
1095997108 12:48097195-48097217 GAGAAAAATCAATCTGGTTTTGG + Intronic
1096659042 12:53111584-53111606 AGCAAAGATCATTCTGTTTTGGG + Intronic
1098310404 12:69142901-69142923 GGCAAAGATCATTCTGTCTTGGG - Intergenic
1098315514 12:69188436-69188458 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1098668074 12:73189770-73189792 GTGCAAAATCGTTCTATATTTGG - Intergenic
1098831258 12:75365906-75365928 AGCAAAGATCATTCTGTTTTGGG + Intronic
1098931243 12:76417487-76417509 GGGAAAAAGCTGTCTTTTTTTGG - Intronic
1099766741 12:86997320-86997342 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1101679011 12:106946648-106946670 AGCAAAGATCATTCTGTTTTGGG + Intergenic
1102817379 12:115878318-115878340 GAGAAACTTCGTTCTGTTTGAGG - Intergenic
1103255526 12:119538759-119538781 GAGAAGAAGCGTTCTGGTTTTGG + Intronic
1103365781 12:120382135-120382157 GGGAAAAATAATTCTTTCTTTGG - Intergenic
1105298379 13:19111010-19111032 AGTAAAGATCATTCTGTTTTGGG + Intergenic
1107966115 13:45599651-45599673 AGGAAAAAGTGTGCTGTTTTGGG + Intronic
1108746819 13:53404516-53404538 GGGAGAAATGGTTTTATTTTAGG + Intergenic
1108869965 13:54972789-54972811 TGGAAAATACGTTGTGTTTTTGG - Intergenic
1109210236 13:59526928-59526950 GGTTAAAATCCTTCTGTATTTGG + Intergenic
1111704960 13:91737183-91737205 AGGAAAAAGTGGTCTGTTTTGGG + Intronic
1112163444 13:96892984-96893006 GGGAAAAATGCTTCCGTTTGGGG + Intergenic
1112413533 13:99185273-99185295 AGCAAAGATCATTCTGTTTTGGG + Intergenic
1112447466 13:99478015-99478037 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1113742282 13:112719747-112719769 GAGAAAAACCGGTCTGTTTTGGG + Intronic
1114256376 14:21005201-21005223 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1114927711 14:27424829-27424851 AGGAAAAATCTTTCAGTTGTTGG + Intergenic
1116936296 14:50743867-50743889 GGGAAAAAAGGTGGTGTTTTGGG + Intronic
1116990431 14:51270233-51270255 GAGAGAAAACGTGCTGTTTTAGG - Intergenic
1119152396 14:72373665-72373687 GGAAATAATCGTTTTGTCTTTGG + Intronic
1120451580 14:84674722-84674744 GGGAGTAATTGTTCTGTCTTGGG - Intergenic
1121863363 14:97339863-97339885 GTGAAACATTGTTCTGGTTTAGG + Intergenic
1124156216 15:27226936-27226958 GGGATAAATAGTACTGCTTTAGG - Intronic
1125305180 15:38304208-38304230 GGGAAACATCTTTCTGCCTTGGG + Intronic
1125359003 15:38846403-38846425 GTGAACAAAAGTTCTGTTTTGGG + Intergenic
1126359303 15:47829459-47829481 GGTAAATATTGTTCTATTTTAGG + Intergenic
1126808068 15:52373167-52373189 GGGAAATATCATTTTTTTTTAGG - Intronic
1126829121 15:52581451-52581473 AGGAAAAATAGAACTGTTTTGGG + Intronic
1127644781 15:60947346-60947368 GGGAAAAATTCTTCTGCCTTGGG + Intronic
1128845774 15:70892904-70892926 GGGAAATATCGCTCTGTTTCTGG + Exonic
1130024839 15:80262110-80262132 GGGACAAGTAGTTCTGTTTAAGG + Intergenic
1130871960 15:87978695-87978717 TGGAAAAATCATCCTTTTTTGGG - Intronic
1131719268 15:95149677-95149699 GGGAAAAATATTTTGGTTTTGGG - Intergenic
1133712601 16:8415743-8415765 GTGGAAATTCATTCTGTTTTTGG + Intergenic
1134051419 16:11140418-11140440 GGAGAAAAACGTTCTTTTTTTGG + Intronic
1137438950 16:48482777-48482799 AAGAAAAATTGTTCTGCTTTGGG - Intergenic
1140031862 16:71345371-71345393 TGGAACAATCGTCCTGGTTTTGG + Intergenic
1140458832 16:75121996-75122018 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1143852866 17:9825827-9825849 GGGAAAAATCTCCCTGCTTTTGG + Exonic
1146152470 17:30486841-30486863 GGAAAGAATCATTCTGTTTTTGG + Intronic
1146227294 17:31078153-31078175 TGGAAAAATCAGTCTTTTTTAGG + Intergenic
1146441780 17:32902864-32902886 AGCAAAGATCATTCTGTTTTTGG + Intergenic
1147221831 17:38938494-38938516 GAGAAAAATATCTCTGTTTTAGG + Intronic
1147328442 17:39681840-39681862 AGGAAAAAGTGGTCTGTTTTGGG - Intronic
1151440355 17:74124727-74124749 GGGTCAAATCATTCTGTTTGGGG + Intergenic
1156029646 18:32697311-32697333 GGGAAGCTTCGTTTTGTTTTTGG - Intronic
1156198131 18:34798905-34798927 GGGAAAACTCATTTTGTTTCAGG + Intronic
1157912639 18:51632326-51632348 AGCAAAGATCCTTCTGTTTTGGG - Intergenic
1159181290 18:64909067-64909089 AGAAAAAACTGTTCTGTTTTTGG - Intergenic
1159830028 18:73264841-73264863 GGGAACAATTGCTATGTTTTAGG + Intergenic
1162251343 19:9446336-9446358 GGCAAAATTGGTTCTGGTTTAGG - Intergenic
1165768195 19:38363804-38363826 GGGAAAAATTCTTCTGCCTTGGG - Intronic
1168174864 19:54618649-54618671 AGCAAAGATCATTCTGTTTTGGG - Intronic
925866821 2:8235416-8235438 GGGCAAAATTGTTTTGTTGTAGG - Intergenic
927702708 2:25277907-25277929 GGGAAAAATCGTTCTGTTTTGGG - Intronic
928060318 2:28105819-28105841 GGGAAAAATAGTTATATTTGGGG + Intronic
929718973 2:44347011-44347033 GTGATAAACAGTTCTGTTTTGGG - Intronic
931021949 2:58055806-58055828 GTTAAAAATCTTTCTGTTTCTGG - Intronic
932102661 2:68914802-68914824 GGGAGAAATCGTTCTTATTCTGG - Intergenic
935957795 2:108395677-108395699 AGCAAAGATCATTCTGTTTTGGG + Intergenic
938534330 2:132222490-132222512 GGGAAAAATTCTTCTGCCTTGGG + Intronic
940200090 2:151140827-151140849 AGGAAAGATCGTTCAGTGTTAGG + Intergenic
940481528 2:154238953-154238975 GGGTAAAATGGTTCAGTTATGGG - Intronic
943261997 2:185677755-185677777 AGCAAATATCATTCTGTTTTGGG + Intergenic
943329716 2:186544246-186544268 GGGCAAAATTTCTCTGTTTTAGG - Intergenic
943666362 2:190613422-190613444 AGCAAAGATCATTCTGTTTTGGG + Intergenic
943897384 2:193382519-193382541 AGAAAAATTAGTTCTGTTTTGGG + Intergenic
944799076 2:203218888-203218910 GGAAAAAATAGCTATGTTTTAGG + Exonic
946996916 2:225403572-225403594 GGGAGAAAAGGCTCTGTTTTGGG - Intronic
947280176 2:228443271-228443293 GGGACAACTCTTTCTGATTTTGG - Intergenic
947422274 2:229951626-229951648 AGGGAAAATCGATCTGCTTTGGG + Intronic
1169696915 20:8399647-8399669 GGGAAAAATAGTTTTTTCTTGGG - Intronic
1171093217 20:22305938-22305960 TTGAAAAATCTTTCTGTGTTTGG + Intergenic
1172997407 20:39081461-39081483 GGGCAAAATAATTCTTTTTTGGG + Intergenic
1174677138 20:52369492-52369514 GGGAAAAATTGCTTTGTTTGGGG - Intergenic
1177044732 21:16155447-16155469 TGGAAACAGCTTTCTGTTTTTGG + Intergenic
1178069658 21:28949839-28949861 GGGAAAATTGGTTGTGTGTTTGG - Intronic
1181624499 22:24114173-24114195 AGGAAAAATCTCTCTTTTTTGGG + Intronic
1183112829 22:35664243-35664265 AGCAAAGATCATTCTGTTTTGGG - Exonic
1184917566 22:47581368-47581390 AGCAAAGATCATTCTGTTTTGGG - Intergenic
950918933 3:16673380-16673402 AGCAAAGATCATTCTGTTTTGGG - Intergenic
954797747 3:53170092-53170114 GGAAACAATCGTTTTGTGTTTGG - Intronic
955577261 3:60379256-60379278 GGGAAGAATGCTTCTCTTTTTGG - Intronic
958522945 3:95214584-95214606 AGCAAATATCATTCTGTTTTGGG - Intergenic
958954089 3:100448451-100448473 AGTAAAGATCATTCTGTTTTTGG + Intronic
959209652 3:103361360-103361382 GGGGAAAATAATTCAGTTTTAGG - Intergenic
959281700 3:104349807-104349829 AGCAAACATCATTCTGTTTTGGG - Intergenic
959391060 3:105774106-105774128 TGGATTAATGGTTCTGTTTTAGG + Intronic
967244588 3:187472824-187472846 AGCAAAAATCATTCTGTTTGGGG - Intergenic
969625122 4:8298576-8298598 GAGAAAAATCTTTCTGATCTTGG - Intronic
969971497 4:11052891-11052913 GAGAAGAATTGTGCTGTTTTGGG - Intergenic
971045845 4:22804362-22804384 GGGGAAAATCTTGCCGTTTTAGG + Intergenic
974139824 4:57871516-57871538 TGGGAAAATCGTTATTTTTTTGG + Intergenic
974178298 4:58353402-58353424 GGAAATAACTGTTCTGTTTTGGG - Intergenic
974957370 4:68658542-68658564 AGCAAAGATCATTCTGTTTTGGG - Intronic
974974097 4:68868180-68868202 AGCAAAGATCATTCTGTTTTGGG - Intergenic
976033673 4:80790046-80790068 GGCAAAAATTGTTTTGATTTTGG - Intronic
977761938 4:100748162-100748184 AGCAAAGATCATTCTGTTTTGGG - Intronic
981571801 4:146159658-146159680 GAGAAAAATCTTTATCTTTTTGG + Intergenic
982525154 4:156468338-156468360 GGGCATAATCTTTCTTTTTTGGG - Intergenic
982951855 4:161708496-161708518 GGGGAAAACAGTTCTATTTTTGG + Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984362705 4:178756918-178756940 AGGAAAAATCTTTCTGATATCGG - Intergenic
984932843 4:184862531-184862553 GGGATAACTCCTTCTGTTTGTGG + Intergenic
986140157 5:5022072-5022094 GTGAAAAATCACTCTGATTTTGG - Intergenic
986471108 5:8076129-8076151 GGGAATAATCTTTCTCTTTGGGG - Intergenic
988179054 5:27766179-27766201 TGGAAAAAGCGTTATGTTTGTGG - Intergenic
988301451 5:29433822-29433844 GGGAAAAATAGTTCAGAATTTGG - Intergenic
990345501 5:54866838-54866860 GGGAAAAACAGTCCTGTTCTTGG + Intergenic
990797816 5:59564521-59564543 GGGAAAACCCATTCTCTTTTTGG + Intronic
990880062 5:60529260-60529282 GGGAGAATTCATTCTGATTTTGG + Intergenic
992833443 5:80617715-80617737 GGTAAAAAGTGTTCTGTTGTGGG - Intergenic
997029869 5:130114695-130114717 AGGAAAAAGCTTTTTGTTTTAGG - Intronic
998360026 5:141577246-141577268 GTGAAATGCCGTTCTGTTTTTGG - Intronic
1002892303 6:1345898-1345920 GTGAAAAATCTTTCTGGTTCTGG - Intergenic
1002951526 6:1817329-1817351 GGGAAGAATAGTTCTTTTGTTGG - Intronic
1003028374 6:2578981-2579003 AGGAAAAACTGGTCTGTTTTGGG + Intergenic
1008461625 6:51781063-51781085 GAGAAAAATGGTTATGCTTTGGG - Intronic
1008650677 6:53558430-53558452 AACAAAAATCATTCTGTTTTAGG - Intronic
1008821510 6:55637430-55637452 ACGAAAAATTGGTCTGTTTTGGG + Intergenic
1009600354 6:65789625-65789647 GAGAAAAATAATCCTGTTTTGGG - Intergenic
1010502655 6:76620432-76620454 TTGAAAAATCCTTCTGTCTTGGG - Intergenic
1013921142 6:115405268-115405290 AGGAAAAATTGATCTGTTTTGGG - Intergenic
1013953810 6:115817624-115817646 GGGAAACAGAGTTATGTTTTAGG + Intergenic
1014108993 6:117599591-117599613 GGGAAAAATCCTAATGATTTTGG - Intronic
1014349910 6:120327621-120327643 GGAAAAGATCTTCCTGTTTTGGG - Intergenic
1014770748 6:125455552-125455574 AGATAAAATTGTTCTGTTTTAGG + Intergenic
1015236941 6:130981695-130981717 GGGAAAAATAGCTCTGCTTCTGG - Intronic
1015814021 6:137189695-137189717 AGCAAAGATCATTCTGTTTTGGG + Intergenic
1016088355 6:139944103-139944125 GGGAAAAATTATTCAGTTTATGG + Intergenic
1019720980 7:2570784-2570806 GAGAAAAATCTTACTGTTTCAGG - Intronic
1020526875 7:9273368-9273390 GGGCAAAGTTGTTTTGTTTTGGG - Intergenic
1020734674 7:11933205-11933227 GGGAAAACTAGGTCTGGTTTTGG - Intergenic
1020739758 7:11999782-11999804 GGAAAATATTGTTCTATTTTGGG + Intergenic
1022677970 7:32517783-32517805 AGCAAAGATCATTCTGTTTTGGG - Intronic
1024906761 7:54391751-54391773 AGCAAAGATCATTCTGTTTTGGG + Intergenic
1025778362 7:64577774-64577796 GGGAAAAATTCTTCTGCCTTGGG + Intergenic
1025797259 7:64750774-64750796 AGCAAAGATCATTCTGTTTTGGG + Intergenic
1026938418 7:74272456-74272478 GGGAAAGAAAGTTCTGGTTTAGG + Intergenic
1027780961 7:82519788-82519810 TGGAAAAATAATTCTCTTTTTGG + Intergenic
1027879711 7:83818857-83818879 AGGAAAAACAGGTCTGTTTTAGG + Intergenic
1027981647 7:85231863-85231885 GGGAAAAGTGGTACTGTTTTAGG + Intergenic
1030161419 7:106512292-106512314 GAGGAAAATCTTTCTTTTTTAGG + Intergenic
1030283447 7:107800601-107800623 GGGAAAAATGGTTAAGATTTGGG - Intronic
1030387704 7:108885625-108885647 AGGAAAAATCAGTCTGTCTTGGG - Intergenic
1030782725 7:113621892-113621914 AGCAAAAATCATTCTGTTTTGGG + Intergenic
1030875401 7:114807429-114807451 GGGAAAACTTGTTCCTTTTTAGG + Intergenic
1031560718 7:123234646-123234668 AGGAAAAAACGGTCTATTTTTGG + Intergenic
1036178571 8:6563433-6563455 GGGAAAAACCGATCTGTTACAGG + Intronic
1036804390 8:11819916-11819938 GAGAAGAGGCGTTCTGTTTTTGG + Intronic
1037064878 8:14566008-14566030 TGGGAAATTCGTTCTGCTTTGGG + Intronic
1037731511 8:21528472-21528494 GGGAAAAATCTTTCATATTTAGG - Intergenic
1038868193 8:31462830-31462852 GGGAAAAATCTTCCTGATGTTGG - Intergenic
1040991124 8:53351186-53351208 AGCAAAGATCATTCTGTTTTGGG + Intergenic
1041651139 8:60304374-60304396 AGGAAAAATTATTCTGTTTTGGG + Intergenic
1043607699 8:82022902-82022924 GGGAAAATTCGTGCGGTCTTTGG + Intergenic
1044347998 8:91129045-91129067 GGGAAAAGGAGTTTTGTTTTTGG + Intronic
1044449324 8:92315148-92315170 GGGAAAAAATGTTCAGTTCTGGG - Intergenic
1047133799 8:122052427-122052449 GAGAAAAATCGTCTGGTTTTTGG - Intergenic
1047720681 8:127636214-127636236 CTGAAAAATCTTTCTGCTTTAGG - Intergenic
1048161645 8:132026984-132027006 GGGAAAAATGGTGGTGTTTAGGG - Intronic
1050791970 9:9483818-9483840 GTGAAAATTCGTTCTCTGTTTGG + Intronic
1052480336 9:29016816-29016838 GGGGTAAATCGTTGAGTTTTTGG - Intergenic
1052677731 9:31648702-31648724 GAAATAAATCCTTCTGTTTTAGG + Intergenic
1053048254 9:34937303-34937325 AAGAAAAATTGTTCTGTCTTGGG + Intergenic
1053437901 9:38089328-38089350 GGGAAAAATCCTCCTGCTTGAGG + Intergenic
1055781946 9:79829979-79830001 GGGAAAAATCATCTTGTCTTTGG + Intergenic
1056210539 9:84361029-84361051 CCTAAAAATCGTTCTGGTTTGGG - Intergenic
1057309465 9:93933102-93933124 TGGAAAGAGCTTTCTGTTTTGGG - Intergenic
1058384023 9:104411617-104411639 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1060114191 9:120928036-120928058 GGGAAAAATAGTACTACTTTTGG + Exonic
1061716665 9:132522517-132522539 GGCAAAAATCGTTCATTTTGGGG + Intronic
1185524820 X:769737-769759 TGGAAGGGTCGTTCTGTTTTCGG + Intergenic
1186209685 X:7236477-7236499 AGCAAAGGTCGTTCTGTTTTGGG + Intronic
1186752301 X:12633516-12633538 GGGAAACATAGTTATGTCTTGGG - Intronic
1187139523 X:16579490-16579512 AGCAAAAATTATTCTGTTTTGGG - Intergenic
1187212422 X:17244615-17244637 GGGAAAAATTCTTCTGCCTTGGG - Intergenic
1187816414 X:23237113-23237135 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1188876602 X:35438517-35438539 AGCAAAGATCATTCTGTTTTGGG + Intergenic
1191083399 X:56538002-56538024 GGCAAAATTCCTTCTGTTTGAGG + Intergenic
1191111904 X:56810820-56810842 GAGAAAAAGTGTTCGGTTTTTGG + Intergenic
1191744221 X:64468050-64468072 AGGAGAATTCGTTCAGTTTTAGG - Intergenic
1191894118 X:65975045-65975067 GGGAAAAATTCTTCTGCCTTGGG - Intergenic
1192500004 X:71644711-71644733 GGGAAAAATTCTTCTGCCTTGGG - Intergenic
1192622994 X:72698574-72698596 GCAAAGAATCGTTCTGTTTTGGG - Intronic
1193474911 X:81951486-81951508 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1193501424 X:82279623-82279645 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1194501604 X:94689026-94689048 AGCAAAAGTCATTCTGTTTTTGG + Intergenic
1194886840 X:99326171-99326193 AGCAAAAATCATTCTGTTTTGGG - Intergenic
1196772853 X:119312352-119312374 GACAAAGATCATTCTGTTTTGGG - Intergenic
1196884543 X:120230671-120230693 AGCAAATATCATTCTGTTTTGGG - Intergenic
1196961124 X:121002930-121002952 TGCAAAGATCATTCTGTTTTAGG + Intergenic
1197481135 X:126987622-126987644 AGCAAAGATCATTCTGTTTTGGG - Intergenic
1198952215 X:142084058-142084080 AGAAAAGATCCTTCTGTTTTGGG - Intergenic
1199355951 X:146864560-146864582 AGCAAAGATCATTCTGTTTTGGG + Intergenic
1200285465 X:154818212-154818234 AGCAAAGATCATTCTGTTTTGGG + Intronic
1201683477 Y:16675551-16675573 GGGAAAAATGTTACTGTGTTGGG + Intergenic