ID: 927703685

View in Genome Browser
Species Human (GRCh38)
Location 2:25284031-25284053
Sequence CCATTCTTCTTGAGGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 123}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927703685_927703696 10 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703696 2:25284064-25284086 TGTGGGACAGGAACAGGCAGGGG 0: 1
1: 0
2: 2
3: 55
4: 503
927703685_927703698 24 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703698 2:25284078-25284100 AGGCAGGGGTCCCCATGGCTCGG 0: 1
1: 0
2: 1
3: 30
4: 381
927703685_927703690 -7 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703690 2:25284047-25284069 AGAATGGAGGTGTCCAGTGTGGG 0: 1
1: 0
2: 3
3: 19
4: 225
927703685_927703692 4 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703692 2:25284058-25284080 GTCCAGTGTGGGACAGGAACAGG 0: 1
1: 0
2: 0
3: 30
4: 214
927703685_927703691 -2 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703691 2:25284052-25284074 GGAGGTGTCCAGTGTGGGACAGG 0: 1
1: 0
2: 5
3: 26
4: 259
927703685_927703694 8 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703694 2:25284062-25284084 AGTGTGGGACAGGAACAGGCAGG 0: 1
1: 0
2: 8
3: 37
4: 369
927703685_927703689 -8 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703689 2:25284046-25284068 AAGAATGGAGGTGTCCAGTGTGG 0: 1
1: 0
2: 2
3: 19
4: 223
927703685_927703695 9 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703695 2:25284063-25284085 GTGTGGGACAGGAACAGGCAGGG 0: 1
1: 0
2: 2
3: 32
4: 394
927703685_927703697 19 Left 927703685 2:25284031-25284053 CCAGGACACCTCAAGAAGAATGG 0: 1
1: 0
2: 2
3: 3
4: 123
Right 927703697 2:25284073-25284095 GGAACAGGCAGGGGTCCCCATGG 0: 1
1: 0
2: 1
3: 34
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927703685 Original CRISPR CCATTCTTCTTGAGGTGTCC TGG (reversed) Intronic
901875564 1:12165296-12165318 CCATTGGTCTTGAGGTGTGTGGG + Intergenic
903649787 1:24915637-24915659 CCATGCATCTGGGGGTGTCCGGG + Intronic
903655741 1:24947932-24947954 CCTTTCTTCCTGGGGTGACCTGG + Intronic
909180631 1:72419599-72419621 TCATTCTCCTTGAGCTGTCTTGG + Intergenic
912955061 1:114149666-114149688 CCTTTCTGCTTGAGGGGTCAGGG + Intronic
913611784 1:120515988-120516010 ACATTCATCTTGGTGTGTCCTGG - Intergenic
914579407 1:149006251-149006273 ACATTCATCTTGGTGTGTCCTGG + Intronic
914965034 1:152248920-152248942 TCATTCTTCATGAGGTCTCCAGG - Intergenic
916830486 1:168485723-168485745 CCCTTCTTCTTCAGGTCTGCTGG - Intergenic
922683072 1:227616992-227617014 CCATGGTGCTTGAGGTGTCATGG + Intronic
1063938307 10:11101891-11101913 TCATTATTGTTGAGGTATCCTGG + Intronic
1070996829 10:80791544-80791566 CCTTTTTTTGTGAGGTGTCCAGG + Intergenic
1073256851 10:102157771-102157793 CCATTCTGCTTGAGGAGTTTGGG + Intronic
1075733221 10:124648539-124648561 CAATTATTCTTGAGGTCTCATGG - Intronic
1075968265 10:126631441-126631463 CCATTCTGCTTCAGGTGTAGAGG - Intronic
1077112759 11:869170-869192 CCATGCTCCCTGATGTGTCCAGG + Exonic
1077537841 11:3133017-3133039 CCACTGTTCCTGAGGTCTCCAGG + Intronic
1077758760 11:5066725-5066747 CCACCCTCCTTGAGGTGTTCAGG + Intergenic
1080469148 11:32528249-32528271 CCATTTTTCATGAGATGCCCTGG - Intergenic
1080798491 11:35587969-35587991 CCTTTCTTGATGTGGTGTCCGGG + Intergenic
1081388254 11:42498923-42498945 TCATTCTTCTTGAGAGTTCCTGG + Intergenic
1084562136 11:69911098-69911120 CGAGTGGTCTTGAGGTGTCCTGG - Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1093231956 12:16555925-16555947 CCATCCTTCTTGAAGTGTTAGGG - Intronic
1097664647 12:62465499-62465521 ACATTATTCTTGAGGTCTCAGGG - Intergenic
1099735765 12:86564906-86564928 CAATGGTTCTTGAGGTGTCAGGG + Intronic
1105620284 13:22059995-22060017 TCATTCTTCCTGTGGTTTCCAGG - Intergenic
1105705486 13:22965445-22965467 CCATTCCTCTTGAGATGACACGG + Intergenic
1109676583 13:65683777-65683799 CCATCTTTGGTGAGGTGTCCAGG + Intergenic
1110355008 13:74557604-74557626 CCTTTCTTCTTGAAGTGGACCGG - Intergenic
1111432999 13:88168021-88168043 CCATTAATCTGGAGGTGTTCTGG + Intergenic
1112327960 13:98456373-98456395 CAGTTCATCTTCAGGTGTCCAGG - Intronic
1114625098 14:24123737-24123759 CCTTTCTTCCTGAGGTCTCTAGG + Exonic
1114875174 14:26707911-26707933 CAATTCTTCTTGATATTTCCTGG - Intergenic
1115634318 14:35276662-35276684 TCCTCCTTCTTGTGGTGTCCAGG - Intronic
1117654378 14:57939463-57939485 CCTTTCTTCTTCTGGTCTCCAGG - Intronic
1118842203 14:69521789-69521811 CTATTTTTCTTGAGGTATCTGGG - Intronic
1118999284 14:70866704-70866726 CCTTTCTTCTTGAGGTCCCAAGG + Intergenic
1120074327 14:80138513-80138535 AAATTCTCCTTGAGGTGTTCTGG + Intergenic
1120143233 14:80952933-80952955 TAATTCTTCTTGAGGTAGCCTGG - Intronic
1120491517 14:85184353-85184375 CCATTCTTCTTTGTCTGTCCTGG - Intergenic
1121250666 14:92497382-92497404 CCAGTCTGCTTGGGGAGTCCGGG - Exonic
1125680966 15:41529945-41529967 CCATTCTTTCTGAGGGGTCACGG + Exonic
1127283523 15:57512739-57512761 TCATTCTTCCTGAGATTTCCGGG + Intronic
1128739250 15:70072388-70072410 ACCATCTTCTTGAGGTTTCCAGG - Intronic
1131571925 15:93546590-93546612 CCATTCTTGCTGAGGTACCCAGG + Intergenic
1141211571 16:81985576-81985598 TCATTTTTCTTGAGGTTTCTAGG - Intergenic
1146825835 17:36022790-36022812 CCATTCTTCTGCAGGTCTGCTGG + Intergenic
1147530335 17:41270553-41270575 CCATTCATCTTGATTTGTCTGGG - Intergenic
1156638606 18:39062566-39062588 CCTTTCTTCCTGAAGTGTCTGGG + Intergenic
1158980327 18:62754370-62754392 CCACTCTTCTAGAGGTGTAGAGG + Intronic
1159208004 18:65279155-65279177 CCACTCTTCCTGTCGTGTCCAGG + Intergenic
1160738505 19:675580-675602 ACATTCTTGTTGAGGTGATCTGG + Intergenic
1164715967 19:30390603-30390625 CCAGTCTTCTTGAGGTCTGAAGG + Intronic
1166290892 19:41862766-41862788 ACATCCTGCTTGAGGTTTCCAGG - Intronic
1167724635 19:51201706-51201728 CAACTCTTCTCAAGGTGTCCTGG + Intergenic
925670834 2:6308445-6308467 CCATTCAGCATGAGGTCTCCTGG + Intergenic
927703685 2:25284031-25284053 CCATTCTTCTTGAGGTGTCCTGG - Intronic
928204684 2:29275496-29275518 ACATTCCTCTTGATGTGTACAGG - Exonic
932197367 2:69796218-69796240 CAATTCTTCTTAAAGTGCCCTGG + Intronic
932321056 2:70822325-70822347 CCATGCCTCCTGAGGTGACCAGG + Intergenic
933667247 2:84973239-84973261 GCATTCTAATTGAAGTGTCCTGG + Intronic
942890141 2:180979659-180979681 CCATTCTTTTTGCAGTCTCCAGG - Intronic
1170559431 20:17544097-17544119 CCACTCTTCTACTGGTGTCCTGG - Intronic
1171988372 20:31676578-31676600 CCATTCTTCTCCCAGTGTCCAGG + Intronic
1174536159 20:51253180-51253202 CCAGGCTTCTTGGGGTTTCCAGG - Intergenic
1174899727 20:54485844-54485866 CCATTCTTCTAGATGTGTCGTGG + Intronic
1176389347 21:6155684-6155706 CCATCCTTCTGGAGGCTTCCCGG - Intergenic
1176516721 21:7789670-7789692 CCATTCTCCTTGGTGTGGCCAGG - Intergenic
1176897928 21:14405237-14405259 CCATTCTTCTGGAGACTTCCTGG - Intergenic
1178650749 21:34419682-34419704 CCATTCTCCTTGGTGTGGCCAGG - Intronic
1179219899 21:39396750-39396772 CCATTCTTTTTGAGCAGTGCTGG - Intronic
1179383816 21:40923605-40923627 TCCTTTTTCTTGAGGTGGCCTGG - Intergenic
1179556906 21:42184844-42184866 CCTCTCTTCCTGATGTGTCCAGG + Intergenic
1184726253 22:46348421-46348443 TCATTCTTCTTCAGTTGCCCTGG + Intronic
1185043823 22:48518910-48518932 CCTTTCTTCCTGGGGTGACCAGG + Intronic
949359503 3:3216592-3216614 GCATTCTTCTTGAGGTTTCCCGG - Intergenic
955465932 3:59237270-59237292 CCATTTCTGTGGAGGTGTCCAGG + Intergenic
956286800 3:67619140-67619162 TCATTCTTCTTGGGGTGCCTTGG + Intronic
956942118 3:74175185-74175207 CCATACTTCTTAAGGGTTCCAGG + Intergenic
959547868 3:107618842-107618864 ACATTCTTTTTCAGGTGCCCAGG - Intronic
961849436 3:129800509-129800531 CCATTCTGGTAGAGGTGTCATGG + Intronic
961942748 3:130655146-130655168 CCATTGTTCCTGAGGTGTCCAGG + Intronic
969429633 4:7146586-7146608 CCCTCCTCCTTGAGGTGGCCAGG - Intergenic
971070988 4:23091119-23091141 CCATTCATCTTCATGTTTCCCGG + Intergenic
971111855 4:23593733-23593755 ACATTATTTCTGAGGTGTCCAGG - Intergenic
971334714 4:25711791-25711813 CCATTCATTGTGAGATGTCCAGG - Intergenic
974308077 4:60167932-60167954 TCATTCTTCTTAAGGTTTCATGG + Intergenic
975161790 4:71133160-71133182 CAATTCTTCTAGAGGGGTTCAGG - Intergenic
976507475 4:85864990-85865012 CCCTTCTTCATGTGGTGTCATGG + Intronic
976829757 4:89301967-89301989 CCAATCTTCTAGAGGTGGCTTGG + Intronic
986941081 5:12950781-12950803 CACTTCTTCTTGTGGTCTCCAGG - Intergenic
993678912 5:90850976-90850998 CCTTTCCTTTTGAGTTGTCCAGG + Intronic
997575135 5:134969696-134969718 CCATTCTTTTTCAGAGGTCCAGG + Intronic
997665045 5:135623907-135623929 CCATTCCTCATGAGGTACCCGGG - Intergenic
998569352 5:143243659-143243681 TCATTCTCCTTGACCTGTCCTGG + Intergenic
999857655 5:155612667-155612689 CCATTCTACTTTAGCTGTGCTGG - Intergenic
1000334188 5:160229683-160229705 CCATTCTACTTTAGGGTTCCTGG - Intronic
1001769824 5:174285493-174285515 CCAAACTTCTTGAGTTGTCTGGG - Intergenic
1003395933 6:5751966-5751988 CCCCTCTTCATGGGGTGTCCTGG + Intronic
1005446497 6:25929552-25929574 CCACTCATCTTGAGGATTCCAGG - Intronic
1006838087 6:37011240-37011262 CCATTCTGCCTGTGGTGCCCAGG + Intronic
1010276445 6:73972986-73973008 CCCTTCTTCTGCAGGTGTGCTGG - Intergenic
1013765185 6:113566088-113566110 CCCTTCTTCTTCATGGGTCCTGG + Intergenic
1014427578 6:121327512-121327534 AAAGTCTTCTTGAGGTATCCAGG - Intronic
1014709869 6:124794287-124794309 GCTTTTTTCTGGAGGTGTCCAGG - Intronic
1014848152 6:126305720-126305742 CCATTCTTCCTTTGTTGTCCTGG + Intergenic
1015264555 6:131277810-131277832 CCAATCTTCTAGATCTGTCCTGG - Intronic
1020756166 7:12206046-12206068 ACATTCTGCTGGAGGTGTTCTGG + Intergenic
1022071318 7:26917952-26917974 ACATTCTTCTTAAAGTATCCAGG + Intronic
1024798781 7:53051450-53051472 CCATTTTCCTTCAAGTGTCCTGG - Intergenic
1028632543 7:92950845-92950867 CGATTCTGATTCAGGTGTCCTGG - Intergenic
1038898507 8:31814907-31814929 CCATTTTTATTTGGGTGTCCAGG - Intronic
1042338940 8:67658667-67658689 CCATTCTGTTTGAGATGTCTGGG - Intronic
1042732397 8:71951743-71951765 CCATTCTCCTTGAGGTTGTCTGG - Intronic
1045236607 8:100357724-100357746 CCATTCTTCTGGGGAAGTCCGGG - Intronic
1046044506 8:108947786-108947808 CCAATCTTCAAGAGGTGTCTAGG - Intergenic
1046591602 8:116213820-116213842 CCATTGTTCTTGAGGTGCCTGGG - Intergenic
1058615725 9:106825295-106825317 GCATTCTTCTTGGGGTGCCGGGG - Intergenic
1060036395 9:120259667-120259689 CCCTTGTTGCTGAGGTGTCCTGG - Intergenic
1060178098 9:121512403-121512425 TCATTGTTGTTGAGGTGTCATGG + Intergenic
1060513269 9:124249410-124249432 CATTTCTTCTCCAGGTGTCCAGG - Intergenic
1061386240 9:130291090-130291112 CCTTTCTTCTTCAGCTTTCCAGG + Intronic
1061394853 9:130338234-130338256 CCATACCCCTTGAGGGGTCCTGG + Intronic
1187946546 X:24431623-24431645 CCAATCTTCATGATGTGTACAGG + Intergenic
1189245056 X:39557013-39557035 ACTTTGTTCTTTAGGTGTCCAGG - Intergenic
1200971907 Y:9161738-9161760 CCATTCTTCCTAAGGTACCCTGG - Intergenic
1202021169 Y:20466510-20466532 CAATTCTTCTTAAAGTGCCCTGG + Intergenic
1202139123 Y:21702553-21702575 CCATTCTTCCTAAGGTACCCTGG + Intergenic