ID: 927704916

View in Genome Browser
Species Human (GRCh38)
Location 2:25291021-25291043
Sequence TCTCAAGTCTGTGCACGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927704916_927704927 28 Left 927704916 2:25291021-25291043 CCGTCACGTGCACAGACTTGAGA 0: 1
1: 0
2: 2
3: 10
4: 104
Right 927704927 2:25291072-25291094 CACTGCCAGCCACAGGACAGAGG 0: 1
1: 0
2: 3
3: 48
4: 418
927704916_927704929 30 Left 927704916 2:25291021-25291043 CCGTCACGTGCACAGACTTGAGA 0: 1
1: 0
2: 2
3: 10
4: 104
Right 927704929 2:25291074-25291096 CTGCCAGCCACAGGACAGAGGGG 0: 1
1: 0
2: 5
3: 39
4: 343
927704916_927704924 21 Left 927704916 2:25291021-25291043 CCGTCACGTGCACAGACTTGAGA 0: 1
1: 0
2: 2
3: 10
4: 104
Right 927704924 2:25291065-25291087 AGACACCCACTGCCAGCCACAGG 0: 1
1: 0
2: 1
3: 29
4: 267
927704916_927704928 29 Left 927704916 2:25291021-25291043 CCGTCACGTGCACAGACTTGAGA 0: 1
1: 0
2: 2
3: 10
4: 104
Right 927704928 2:25291073-25291095 ACTGCCAGCCACAGGACAGAGGG 0: 1
1: 0
2: 7
3: 29
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927704916 Original CRISPR TCTCAAGTCTGTGCACGTGA CGG (reversed) Intronic
900928792 1:5722836-5722858 ACTCTGGTCTGTGCAAGTGAAGG - Intergenic
902610309 1:17593254-17593276 TGTAAAGTCCGTGCACGTGTAGG - Intronic
903543522 1:24109929-24109951 GCTCAAGTCTAGGCCCGTGATGG + Intronic
905386630 1:37608926-37608948 TTTCATGTCTGTGCACCTGCAGG - Intergenic
912161420 1:106990076-106990098 TTTCTAGTTTGTGCATGTGAAGG - Intergenic
915327154 1:155086432-155086454 TCTCAAGCTTGGGCACCTGAGGG - Exonic
915854320 1:159365366-159365388 TCTCATGTCTCTGCACATGTAGG - Intergenic
918974082 1:191458283-191458305 TTTCAAGTCTGCCTACGTGAGGG + Intergenic
919707955 1:200696821-200696843 TCACAAATCTGTGCACTTAAAGG - Intergenic
920231292 1:204472057-204472079 TCTCAACTCTGTTCACGTCATGG - Intronic
920444239 1:206003432-206003454 TCCCAAGTCTGTGCACGAGAGGG - Intronic
921377410 1:214488845-214488867 TCTGATGTCTGTGCTTGTGATGG - Intronic
922276669 1:224085643-224085665 TCTAAAATCTGTGCATGTGTTGG - Intergenic
923344084 1:233034299-233034321 TCTCATGTCTGTTCTCCTGAGGG - Intronic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1065278874 10:24114609-24114631 TCTCGTGTCTGTTCACTTGAGGG - Intronic
1066441676 10:35445369-35445391 TCTCAAGGCAGTGCACTGGAAGG + Intronic
1067164430 10:43853993-43854015 TCTCGAGTCTGTGCATCTGAAGG + Intergenic
1072871973 10:99130000-99130022 TTTCTAGTTTGTGCACGTAAAGG - Intronic
1075007925 10:118843748-118843770 TCCCAAGTCTGGGCCCCTGAAGG - Intergenic
1075274396 10:121080348-121080370 TCTCAAGTCAGAAAACGTGAGGG - Intergenic
1078669998 11:13356073-13356095 TCTGAAGTCTGTGAAAGGGAGGG + Intronic
1084716348 11:70876722-70876744 TCTAGGGTCTGTGCAAGTGAAGG + Intronic
1085381235 11:76120857-76120879 TCTCAAGCCTGTGCTCCTTAGGG + Intronic
1088680469 11:112237293-112237315 TCTCAGTTCTGTGCACCAGAAGG + Intronic
1089167007 11:116485102-116485124 TCTCTTGTTTGTGCACGTGGAGG - Intergenic
1089744266 11:120606035-120606057 TTTCAAGTGTCTGCACCTGAAGG - Intronic
1089862099 11:121598703-121598725 TCTCAAGTCAGAGCACATCAAGG - Intronic
1097000487 12:55872253-55872275 TCTCAAATCAGTGCCTGTGATGG - Intergenic
1098120663 12:67234387-67234409 TCTCAAGCTTGTGCACTTGCAGG - Intergenic
1104322847 12:127768212-127768234 TCTCAAGTGTCTGCACTTGGTGG - Intergenic
1104903254 12:132200279-132200301 TCCCCAGTCTGTGCAGGGGATGG - Intronic
1109018800 13:57057185-57057207 TCTCAAGTGTTTGCATATGAGGG + Intergenic
1113504482 13:110805740-110805762 TCTCAAGTCTGCCCACTGGATGG + Intergenic
1117007977 14:51441613-51441635 TCTCAAATCTGTGAAAGAGAGGG + Intergenic
1118008337 14:61585428-61585450 TCTCAGGGCTGTGCAAGTGCAGG - Intronic
1119582413 14:75798213-75798235 TTTCTAGTTTGTGCACGTAAAGG + Intronic
1120519245 14:85507541-85507563 TCTCAAATCTCTGCACCTGAAGG + Intergenic
1127688948 15:61375944-61375966 TCTTAAGTCTGTGGACCTGAAGG + Intergenic
1130643838 15:85706156-85706178 TTTCAAGTCTGTGCATGGGAAGG + Intronic
1132796293 16:1724931-1724953 TCACAAGTCTGTGGTCCTGAAGG + Intronic
1138590510 16:57997077-57997099 TCTCGAGGGTGTGCACGTGCTGG + Exonic
1138813674 16:60179437-60179459 TCTCAAGTCTGTCCACAGAAAGG + Intergenic
1142796236 17:2309470-2309492 GCTCAATTCTCTGCACCTGAGGG - Intronic
1153490042 18:5637778-5637800 TCTCCAGTTTGTGCACGGGTAGG - Intergenic
1153556899 18:6324133-6324155 CCTCAATTCTGTGCACCTGTGGG - Intronic
1162877109 19:13628520-13628542 TCCCAAGTCGGTGCAGGGGATGG - Intergenic
1165419154 19:35714508-35714530 TTTCAAGCCTGTGGATGTGAGGG - Exonic
927704916 2:25291021-25291043 TCTCAAGTCTGTGCACGTGACGG - Intronic
932384603 2:71320191-71320213 TTTCAAGTTTATGCACGTAAAGG + Intronic
932870329 2:75392051-75392073 TTTCTAGTCTGTGCATGTAAAGG - Intergenic
933406709 2:81869495-81869517 TATCAAGTCTGTGAACATGAAGG + Intergenic
939116482 2:138067526-138067548 TCTAAAGTCTGTGAAGGAGATGG - Intergenic
940619649 2:156095144-156095166 TCTTTAGTCTGTTAACGTGATGG + Intergenic
943349424 2:186779656-186779678 TCTCAGGTCAGGGCACATGATGG - Intergenic
1169959598 20:11144426-11144448 TCTCAAGTCCGTGTAAGTTATGG - Intergenic
1171375318 20:24689664-24689686 TTTCTAGTTTGTGCACGTCAAGG + Intergenic
1171378392 20:24711944-24711966 TTTCTAGTTTGTGCACGTGAAGG + Intergenic
1179371520 21:40810263-40810285 CCTCAGGTCTGTGCACAGGAAGG + Intronic
1181122122 22:20677475-20677497 TTTCTAGTCTGTGCACATAAGGG + Intergenic
1185414951 22:50704793-50704815 TCTCGAGTCGGTGGACGTGGAGG + Intergenic
951657838 3:25028993-25029015 TCTCAACTCTGTGCTAGGGATGG + Intergenic
951690759 3:25393681-25393703 GTTCTAGTTTGTGCACGTGAAGG + Intronic
952434968 3:33264121-33264143 TTTCTAGTCTGTGCATGTAAAGG + Intergenic
958692600 3:97486711-97486733 TTTCCAGTGTGTGCACTTGAGGG + Intronic
964703486 3:159593972-159593994 TTTCTACTCTGTGCAGGTGAGGG - Intronic
966354575 3:179066304-179066326 ACTCAACTCTCTGCACCTGAGGG + Intronic
974922765 4:68262536-68262558 CCTCATGTCTGTCCACGTTAGGG - Intergenic
984590855 4:181616231-181616253 TCTCAAATCTGAGAAGGTGATGG + Intergenic
988606080 5:32679459-32679481 TCTCAAGGTTGTGCAAGAGAAGG - Intergenic
994996346 5:107068167-107068189 TCTCAGGTCTTTGAACTTGAAGG + Intergenic
995330648 5:110942072-110942094 TCTCAAGTCTGTGTACAAGCAGG + Intergenic
996326748 5:122283555-122283577 TTTCTAGTTTGTGCACGTAAAGG + Intergenic
997508573 5:134437576-134437598 TATCAAGTCTGTCCATGTGCTGG - Intergenic
998396788 5:141823875-141823897 TCCCAAGTTTGGGCACATGAGGG + Intergenic
1003363546 6:5451424-5451446 TCTCAAGTATGTCAAGGTGATGG + Intronic
1004165007 6:13249256-13249278 TCTCAGAACTGTGCATGTGAGGG + Intronic
1004260579 6:14104069-14104091 GCTCAGGTCTGTGCACGTGGGGG + Intergenic
1007904883 6:45449558-45449580 TGTCAAGTCTGTGTAAGTGTTGG + Intronic
1008551862 6:52640276-52640298 TCCCCAGTGTGTGCACGGGAGGG + Intergenic
1011599285 6:89044952-89044974 TCCCAGGTCTGTGCAAGAGAAGG - Intergenic
1012437330 6:99228013-99228035 TCTCATGACAGTGCATGTGAAGG - Intergenic
1013829074 6:114251430-114251452 TCTCAAGTGTGAGCACTTGAGGG + Intronic
1018781522 6:167071262-167071284 TTTCTAGTTTGTGCACATGAAGG + Intergenic
1018789938 6:167140621-167140643 GCTCAAGGCTGTGCACGGGTGGG - Intergenic
1020698377 7:11445711-11445733 TAACAAGTCTGTGCACAGGAAGG - Intronic
1023594489 7:41814781-41814803 TCTCAGGTGGGTGCAGGTGATGG + Intergenic
1024706381 7:51964856-51964878 TCTCAAGTGTGTGAACTTTATGG + Intergenic
1028197462 7:87923909-87923931 TTTCCAGTTTGTGCATGTGAAGG - Intergenic
1038935562 8:32246443-32246465 TCTCAAGGTTGTGTAAGTGACGG + Intronic
1039257504 8:35735063-35735085 TCTAAAGGCTGGGCACGTGGTGG - Intronic
1040809594 8:51437070-51437092 TTTCTAGTTTGTGCACATGAAGG - Intronic
1045367742 8:101492687-101492709 TTTCAAGTCTGTGCAGGTGAAGG - Exonic
1048398524 8:134039513-134039535 TCTCAATGCTCTGCAAGTGAGGG + Intergenic
1049398660 8:142414680-142414702 TTGCATGTCTGTGCATGTGAGGG - Intergenic
1051609320 9:18945912-18945934 GCTCCAGTCTGTGCAAGGGAGGG + Intronic
1053523046 9:38801239-38801261 TTTCTAGTCTGTGCATGTAAAGG - Intergenic
1053666195 9:40319596-40319618 TCCCAAGCCTGTGCACCTGCTGG - Intronic
1053915779 9:42944643-42944665 TCCCAAGCCTGTGCACCTGCTGG - Intergenic
1054195271 9:62025659-62025681 TTTCTAGTCTGTGCATGTAAAGG - Intergenic
1054377348 9:64459624-64459646 TCCCAAGCCTGTGCACCTGCTGG - Intergenic
1054518414 9:66056687-66056709 TCCCAAGCCTGTGCACCTGCTGG + Intergenic
1054643137 9:67563030-67563052 TTTCTAGTCTGTGCATGTAAAGG + Intergenic
1056195703 9:84226464-84226486 GTTCAATTCTGTGCACCTGAGGG - Intergenic
1056443625 9:86643924-86643946 TCTCGCGTCTGTGACCGTGATGG - Intergenic
1057643139 9:96847536-96847558 TTTCTAGTTTGTGCACATGAAGG - Intronic
1059353403 9:113681930-113681952 GCTCAATTCTGAGCTCGTGAAGG - Intergenic
1061460370 9:130733191-130733213 ACTCAATTCTGTTCAAGTGAAGG - Intronic
1061593756 9:131615464-131615486 TCTGAAGCCTGTGCAGGGGACGG + Intronic
1062295607 9:135824125-135824147 TCTCAAGTCAGTACACCAGAAGG + Intronic
1185830702 X:3300291-3300313 GCTCAATTCTGTGCACATGTGGG - Intergenic
1186320976 X:8425158-8425180 TATCAAGTCTGTGCATGTTCAGG - Intergenic
1186638389 X:11429093-11429115 ACTGTAGTCTGTGCACATGATGG + Intronic
1192315222 X:70045951-70045973 TCTCAGGGCTGTGCAAGTGATGG - Intronic
1194748459 X:97656484-97656506 TAACAAGTCTTTGCACGTCAAGG + Intergenic
1195297819 X:103497495-103497517 TCTCCAGTCTCTGCAACTGACGG + Intergenic
1195818294 X:108912886-108912908 TTTCAAGTTTGTGCACATAATGG - Intergenic