ID: 927706623

View in Genome Browser
Species Human (GRCh38)
Location 2:25300166-25300188
Sequence CCACGGCACGGAAGGTGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927706623_927706634 11 Left 927706623 2:25300166-25300188 CCGCCCCACCTTCCGTGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 174
Right 927706634 2:25300200-25300222 TGGCGCTCCTCCTTGCCACGCGG 0: 1
1: 0
2: 0
3: 9
4: 60
927706623_927706632 -9 Left 927706623 2:25300166-25300188 CCGCCCCACCTTCCGTGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 174
Right 927706632 2:25300180-25300202 GTGCCGTGGTGCTGGGCTCTTGG 0: 1
1: 0
2: 0
3: 35
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927706623 Original CRISPR CCACGGCACGGAAGGTGGGG CGG (reversed) Exonic
901656575 1:10773019-10773041 CCAAGGAAAGGAAGGAGGGGAGG + Intronic
902454321 1:16521107-16521129 CCAGGGCAGGGATGGTGGTGAGG + Intergenic
902498133 1:16889210-16889232 CCAGGGCAGGGATGGTGGTGAGG - Intronic
903389783 1:22955497-22955519 TCAACTCACGGAAGGTGGGGAGG - Intronic
903393644 1:22982760-22982782 CCCCTGCATGGAAGGTGTGGAGG - Intergenic
905313134 1:37064459-37064481 CCAGGGCTTGGGAGGTGGGGAGG + Intergenic
908156753 1:61361151-61361173 CCACAGCACTCAAGGTGTGGTGG + Intronic
913655110 1:120952769-120952791 CCAGGGCAGGGATGGTGGTGAGG + Intergenic
914006462 1:143736443-143736465 CCAGGGCAGGGATGGTGGTGAGG + Intergenic
914095370 1:144540142-144540164 CCAGGGCAGGGATGGTGGTGAGG + Intergenic
914303156 1:146393754-146393776 CCAGGGCAGGGATGGTGGTGAGG - Intergenic
914645295 1:149646929-149646951 CCAGGGCAGGGATGGTGGTGAGG + Intergenic
915296772 1:154926947-154926969 CTAAGACAGGGAAGGTGGGGAGG - Intronic
916724532 1:167510811-167510833 CCAAGCCATGGCAGGTGGGGAGG - Intronic
918124317 1:181569320-181569342 CCCCGGCAGAGTAGGTGGGGAGG + Intronic
920539792 1:206769746-206769768 CCAAAGCATGGAAGGTGGTGGGG - Intronic
922698881 1:227746336-227746358 CCACTGCAGGGAAGGAGGTGTGG - Intronic
923914339 1:238485583-238485605 CCCCGGCAGGGAAGGGAGGGCGG + Intergenic
1063227349 10:4027985-4028007 CCAAGGCAAGGATGGTGGTGGGG + Intergenic
1063357227 10:5412674-5412696 CCATGGCACGGAGGAGGGGGTGG - Exonic
1065021622 10:21506718-21506740 CCAGTGCACGGAAGGAAGGGAGG - Intergenic
1065287689 10:24201703-24201725 CCACAGAATTGAAGGTGGGGCGG - Intronic
1065916465 10:30358016-30358038 CCATGGCAGGGAAGGCGGGTGGG - Intronic
1068545130 10:58335654-58335676 GGAGGGCAAGGAAGGTGGGGTGG + Intronic
1069842361 10:71347813-71347835 CCAGGGCAGGAAAGTTGGGGAGG - Intronic
1071417575 10:85455378-85455400 CCCCGGATGGGAAGGTGGGGAGG + Intergenic
1075721726 10:124591368-124591390 CCATGGCAGGGGAGGTGGTGGGG - Intronic
1077112613 11:868655-868677 CCACAGGACGGGAGCTGGGGAGG - Exonic
1077181979 11:1220834-1220856 GCACGGCACGGTGGGAGGGGTGG - Intergenic
1077299683 11:1841229-1841251 CCCCGGCAGGGTAGGTGTGGTGG - Intronic
1077316202 11:1920470-1920492 CCAGGGCAGGGAGGGTGGGTGGG - Intronic
1077990128 11:7399928-7399950 CCACGGCAGGGAAGCTGGACTGG + Intronic
1078151954 11:8766947-8766969 CCAAGGGAAGGATGGTGGGGAGG + Intronic
1078840570 11:15073117-15073139 CCACGGCAGGGAAGGAGGGGGGG - Intronic
1079001737 11:16763417-16763439 CCAAGGCAGGGAAAGTGGGTGGG - Intergenic
1081927200 11:46840808-46840830 CCAAGGCAGGGAATGGGGGGCGG + Intronic
1082782682 11:57299894-57299916 CCAGGGAAGGGAAGGTGTGGGGG + Exonic
1083265936 11:61546867-61546889 TGACTGCACAGAAGGTGGGGTGG + Intronic
1084564464 11:69921282-69921304 CCACCCCTAGGAAGGTGGGGAGG + Intergenic
1084793975 11:71491941-71491963 CCACCACACAGGAGGTGGGGAGG - Intronic
1085810918 11:79680287-79680309 CCACAGCAGGGAAGGTAGGGAGG - Intergenic
1089150299 11:116358759-116358781 CCAAGGCAGGGGAGGTGGGGAGG - Intergenic
1090074233 11:123569425-123569447 CCATGTCACGGCAGGTGGGAAGG - Intronic
1090344764 11:126061524-126061546 CCAAGGAGAGGAAGGTGGGGAGG - Intronic
1091346071 11:134855084-134855106 CAAGAGCACGCAAGGTGGGGTGG + Intergenic
1091816967 12:3446073-3446095 CCAAGGAACTGAGGGTGGGGAGG - Intronic
1092106865 12:5927530-5927552 ACAGGGCACAGAAGCTGGGGAGG - Intronic
1092161445 12:6317527-6317549 CCACTGCAGGGAAGGTGGGTGGG - Exonic
1093414768 12:18907499-18907521 CCAGGGCACAGAAGAAGGGGTGG + Intergenic
1096544423 12:52327969-52327991 GTACAGCACGGAGGGTGGGGTGG - Intergenic
1097397667 12:59095288-59095310 ACAGAGCATGGAAGGTGGGGAGG + Intergenic
1105913709 13:24893963-24893985 CCAGGGCAGGTAAGGTGGCGGGG + Intronic
1106036642 13:26050633-26050655 CGACGGCTCGGCAGGTAGGGCGG - Exonic
1111828178 13:93295249-93295271 CCATTGCACAGAAGCTGGGGTGG + Intronic
1113575023 13:111389249-111389271 CCAGGGCACGGGAGCTGGGTGGG - Intergenic
1114532041 14:23402455-23402477 AGACGGCACCGAAGGTGGGAGGG - Exonic
1115993336 14:39171492-39171514 CCGAGGCACGGGGGGTGGGGGGG + Intergenic
1121252930 14:92513414-92513436 CCGCGGGCCGGCAGGTGGGGAGG - Intergenic
1121675446 14:95748736-95748758 CCACAGCACAGGAGGTGAGGCGG + Intergenic
1122140358 14:99659804-99659826 CTGCGGCACAGCAGGTGGGGTGG - Intronic
1122324428 14:100874227-100874249 CCAAGGGACGGAGGATGGGGAGG - Intergenic
1122393898 14:101409194-101409216 CCACGGGACGGACGGTGTGCAGG + Intergenic
1123783868 15:23649368-23649390 CCCCTGCAGGTAAGGTGGGGGGG - Intergenic
1124490398 15:30151624-30151646 CCATGGCAAGGGAGGTGGGTGGG + Intergenic
1124753134 15:32386705-32386727 CCATGGCAAGGGAGGTGGGTGGG - Intergenic
1124887488 15:33700773-33700795 TCACGGCAATGAATGTGGGGAGG + Intronic
1124974873 15:34522405-34522427 CCATGGCAAGGGAGGTGGGTGGG - Intergenic
1126736088 15:51733474-51733496 ACATGGCAGGGAAGTTGGGGAGG + Intronic
1129742007 15:77993821-77993843 CCAGGACTCGGAAGGTAGGGAGG + Intronic
1129870206 15:78935017-78935039 CCAGTCCACGGAAGGTGGGTAGG + Exonic
1129895869 15:79105432-79105454 CCAAGGCAGAGAAGATGGGGTGG - Intergenic
1130736367 15:86554443-86554465 CCACGGCCCGGGTGGTGGTGTGG + Exonic
1131563247 15:93462551-93462573 CCACGCCAGGGACTGTGGGGAGG - Intergenic
1132185484 15:99798946-99798968 CCATGGCAAGGGAGGTGGGTGGG + Intergenic
1132431511 15:101765595-101765617 CCATGGCAAGGGAGGTGGGTGGG - Intergenic
1132733102 16:1372630-1372652 CCACTGCACAGAAGTTGGGTTGG + Intronic
1132784042 16:1644632-1644654 CCAGGGAAAGGAAGGTGGGAAGG + Intronic
1132827369 16:1911997-1912019 CCAGGGCGCGGAAGCTGGGCAGG + Exonic
1133276111 16:4639364-4639386 CCCAGGCCGGGAAGGTGGGGCGG + Intronic
1135589444 16:23694766-23694788 CCCCGGCACGGAAGGCTGGATGG - Exonic
1136004472 16:27319170-27319192 CCACAGCAAGGAAGCTGGTGTGG + Intronic
1137586666 16:49668007-49668029 CCTCGGGAAGGAAGGTGGAGCGG - Intronic
1137608453 16:49802652-49802674 CCTAGGCAGGGCAGGTGGGGTGG - Intronic
1140194643 16:72846340-72846362 CCAGGGCACAGAAGGAGGGCTGG + Intronic
1140205218 16:72927909-72927931 TCAATCCACGGAAGGTGGGGAGG + Intronic
1142586738 17:979096-979118 GCACAGCGCGGAAGGGGGGGGGG + Intronic
1146141191 17:30369345-30369367 CCACGACTCCTAAGGTGGGGAGG + Intergenic
1147599149 17:41734952-41734974 CCCCGGCGCGGCAGCTGGGGAGG - Intergenic
1152256757 17:79244487-79244509 GCACTGCCCTGAAGGTGGGGAGG - Intronic
1152723482 17:81934133-81934155 GCAGGAAACGGAAGGTGGGGAGG + Intronic
1153488867 18:5628913-5628935 GCGCGGCGCGGGAGGTGGGGTGG - Intronic
1157384194 18:47247941-47247963 CCGCGGCAGGGAAGGTGTAGGGG + Intronic
1158344553 18:56503000-56503022 CCATGGCAGGGAAGTTGGTGTGG + Intergenic
1160411272 18:78677068-78677090 CCAAGGAATGGAAGGTGGAGAGG - Intergenic
1161211017 19:3065811-3065833 CCACGGCAGTGGGGGTGGGGTGG - Intergenic
1161828555 19:6586211-6586233 CCACGGCCAGGGTGGTGGGGTGG + Exonic
1163364327 19:16867781-16867803 CCACGGGAAGGGAGGTGGGAGGG - Intronic
1163566054 19:18052009-18052031 CCAGGCCAGGGAAGGTGGGGAGG + Intergenic
1165056171 19:33177486-33177508 CCACGCCACAGAAGGCGGCGTGG - Intergenic
1166273488 19:41733995-41734017 CCTGGGCATGGAAGGTGGGGAGG - Intronic
1166966064 19:46530010-46530032 CCAAGGAACGGAAGGTTGTGGGG - Intronic
1167210492 19:48131147-48131169 CCACGCCCTGGAAGGCGGGGAGG - Exonic
1167706860 19:51086310-51086332 CCACGGCACGGCAGGTGCTGAGG - Intergenic
925609159 2:5690388-5690410 CCACCGGAGGGAGGGTGGGGTGG - Intergenic
926907212 2:17816822-17816844 CCACCGCCCTGAAGGTGGGTGGG - Exonic
927706623 2:25300166-25300188 CCACGGCACGGAAGGTGGGGCGG - Exonic
928179970 2:29062146-29062168 CCACTCCAGGGAAGATGGGGAGG - Exonic
929007742 2:37411985-37412007 CCACGGTGCGGAAGGAGGAGAGG - Intergenic
929440708 2:41964177-41964199 GCGCGACAAGGAAGGTGGGGAGG - Intergenic
934117073 2:88808414-88808436 CCAAGGCACAGAAACTGGGGTGG + Intergenic
934304580 2:91810366-91810388 CCGCGGCACGGTGGGCGGGGGGG - Intergenic
934307530 2:91839864-91839886 CCACGGCACCTGAGGAGGGGAGG - Intergenic
934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG + Intergenic
948263306 2:236620455-236620477 CCACTGCACAGAAGCTGGGGTGG + Intergenic
948452139 2:238082401-238082423 CCATGGCAGGGATGATGGGGGGG + Intronic
948941288 2:241198127-241198149 GAAAGGCACGGAAGGTGGAGGGG - Intronic
1172951119 20:38724151-38724173 CGAGGGCAGGGGAGGTGGGGGGG - Intergenic
1175828860 20:61951177-61951199 CCAGGAAAAGGAAGGTGGGGGGG - Intergenic
1176190667 20:63808230-63808252 GCACGGCACAGACGGAGGGGGGG + Intronic
1179067710 21:38041695-38041717 CAAAGGCAGGGAAGGAGGGGTGG - Intronic
1183323618 22:37179783-37179805 CCCCGGGGCGGGAGGTGGGGGGG + Intergenic
1184643345 22:45883549-45883571 GCCCAGCAAGGAAGGTGGGGTGG - Intergenic
1185398458 22:50604244-50604266 CCACGGGCAGGAAGGCGGGGCGG - Exonic
949953487 3:9248526-9248548 CCATGGCAGGGAAGGGGTGGAGG + Intronic
952924296 3:38309910-38309932 CCATGTCATGGGAGGTGGGGAGG + Intronic
953848968 3:46450671-46450693 CCTCTGCAGGGAAGGTGAGGTGG + Exonic
954383414 3:50231729-50231751 CCAGGGAATGAAAGGTGGGGAGG + Intronic
956209878 3:66791713-66791735 CAACGGGACCAAAGGTGGGGGGG + Intergenic
956523038 3:70126540-70126562 CCGAGGCAGGGAAAGTGGGGAGG + Intergenic
961462973 3:127064612-127064634 CCACTGAACTGAAGGTGGCGAGG - Intergenic
962812438 3:138971278-138971300 CCAGGGTGCTGAAGGTGGGGTGG - Intergenic
965528547 3:169747333-169747355 CCAGAGCAAAGAAGGTGGGGAGG + Intergenic
965896617 3:173585082-173585104 CCACTGCGCGGAAGGTGATGCGG + Intronic
968470720 4:781228-781250 CCAAGGTATGGGAGGTGGGGCGG + Intergenic
968624598 4:1621495-1621517 CCACTGCAAGGAAGGTTGGGAGG + Intronic
968632094 4:1657002-1657024 CCACTGCACGGACAGTGGGTGGG + Intronic
968902532 4:3438357-3438379 CCACCGCACAGATGGGGGGGTGG + Intronic
969218862 4:5746377-5746399 CCATGGGGCGGCAGGTGGGGAGG + Intronic
969961775 4:10952010-10952032 CCATGGCCTGGGAGGTGGGGCGG - Intergenic
970106806 4:12594920-12594942 CCAAGGCAAGGGAGGTGGTGAGG + Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
975379124 4:73678379-73678401 CCACGGAAGTGAAGGTGAGGTGG + Intergenic
980905445 4:138944152-138944174 CCAGAGCATGGAAGGTGGTGAGG + Intergenic
981536148 4:145801912-145801934 TCATGGCAGGGAGGGTGGGGAGG + Intronic
985663623 5:1169852-1169874 CTACAGCAGGGAAGGAGGGGAGG + Intergenic
985842744 5:2320876-2320898 CCATGGCCAGGAGGGTGGGGTGG + Intergenic
991356404 5:65773608-65773630 TCATGAGACGGAAGGTGGGGAGG + Intronic
993495094 5:88599968-88599990 CCAGGGCAGGGAAGGTGGAGAGG + Intergenic
1002044640 5:176535030-176535052 CCAGGGCAGGGAAGGTGGTAAGG + Intronic
1002641111 5:180631026-180631048 TCACAGCTGGGAAGGTGGGGAGG + Intronic
1003053159 6:2797723-2797745 CAACAGCAAGCAAGGTGGGGAGG + Intergenic
1004299025 6:14440467-14440489 ACAGGGCACTGAAAGTGGGGAGG + Intergenic
1006379310 6:33688440-33688462 CCACGGGCGGGAGGGTGGGGCGG + Intronic
1019452877 7:1108588-1108610 ACATGGCAGGGAAGCTGGGGTGG - Intronic
1019577942 7:1746540-1746562 CCTCGGCTCGGAAGGCGCGGGGG - Exonic
1021566710 7:22023716-22023738 CCAAGGCACGGAGGAAGGGGAGG - Intergenic
1024243667 7:47454066-47454088 CCAAGGGAGGGGAGGTGGGGAGG + Intronic
1024276678 7:47683050-47683072 CCAAGGCCCGGGAGGTGGAGTGG + Intergenic
1024516839 7:50266535-50266557 CCAAGGCAATGAAGGTGGAGGGG - Intergenic
1025928967 7:65980126-65980148 CCACGGCATGTATGCTGGGGTGG - Intronic
1025978441 7:66388117-66388139 CCAGGGCAAGGTAAGTGGGGAGG - Intronic
1030688616 7:112510537-112510559 GCAGGGCAGGGAAGGTGAGGGGG + Intergenic
1030763259 7:113377629-113377651 CCAAGGCAGGGAAGGTGGGAGGG - Intergenic
1033137425 7:138797027-138797049 CCAAGGCATGTGAGGTGGGGAGG - Intronic
1035251113 7:157597798-157597820 CCACAGGACGGCAGGTGGGCGGG - Intronic
1041576034 8:59396311-59396333 CTATGACACAGAAGGTGGGGAGG - Intergenic
1045288153 8:100809892-100809914 ACAGGGCTCCGAAGGTGGGGGGG - Intergenic
1047205559 8:122800388-122800410 CCCCGGCAAGGAAGCTGGTGCGG + Intronic
1047616003 8:126563041-126563063 CCACTGTAAGGAAGGTGTGGAGG - Intergenic
1048336176 8:133504095-133504117 GCCCAGCATGGAAGGTGGGGAGG + Intronic
1049162555 8:141106460-141106482 CCACGGCAGGGGAGGTTGGGTGG + Intergenic
1049406486 8:142453843-142453865 CCACGGAAGGGCAGGTGGGTGGG + Intronic
1049598587 8:143496613-143496635 TCACAGCATGGAAGGAGGGGTGG + Intronic
1049797131 8:144501954-144501976 CCAGGGCACGCACCGTGGGGAGG - Exonic
1053562173 9:39208071-39208093 CCACAGCACTGACTGTGGGGAGG - Intronic
1053827979 9:42046072-42046094 CCACAGCACTGACTGTGGGGAGG - Intronic
1054134945 9:61410887-61410909 CCACAGCACTGACTGTGGGGAGG + Intergenic
1056583666 9:87914342-87914364 CCCCGGCTTGGAGGGTGGGGAGG + Intergenic
1056584158 9:87917811-87917833 CCCCGGCTTGGAGGGTGGGGAGG + Intergenic
1056612711 9:88135114-88135136 CCCCGGCTTGGAGGGTGGGGAGG - Intergenic
1056613208 9:88138604-88138626 CCCCGGCTTGGAGGGTGGGGAGG - Intergenic
1057793975 9:98142823-98142845 GCAGGGCAGGGGAGGTGGGGCGG - Intronic
1058068133 9:100572085-100572107 CCATGGCCCGGGAGTTGGGGGGG + Intronic
1058504726 9:105656129-105656151 CCAGGGCGCGGAGAGTGGGGAGG + Intergenic
1061404539 9:130386078-130386100 CCACTCCACGGAAGGAGGGAGGG - Intronic
1062378383 9:136275198-136275220 CCACTGCAAGGAAGCAGGGGTGG + Intergenic
1189303192 X:39967657-39967679 CCATGACACGGGAGGTTGGGTGG - Intergenic