ID: 927708712

View in Genome Browser
Species Human (GRCh38)
Location 2:25312418-25312440
Sequence TGCACCCAGTCAGCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 209}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927708712_927708727 30 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708727 2:25312471-25312493 GGCTGGGAAGGCAGGTCCCTGGG 0: 1
1: 0
2: 10
3: 57
4: 515
927708712_927708720 8 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708720 2:25312449-25312471 CACGGTGCTCTACAGGGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 107
927708712_927708722 13 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708722 2:25312454-25312476 TGCTCTACAGGGTGCTGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 234
927708712_927708726 29 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708726 2:25312470-25312492 GGGCTGGGAAGGCAGGTCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 675
927708712_927708721 9 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708721 2:25312450-25312472 ACGGTGCTCTACAGGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 90
927708712_927708715 2 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708715 2:25312443-25312465 CACCCCCACGGTGCTCTACAGGG 0: 1
1: 0
2: 3
3: 8
4: 71
927708712_927708723 14 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708723 2:25312455-25312477 GCTCTACAGGGTGCTGGGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 333
927708712_927708714 1 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708714 2:25312442-25312464 ACACCCCCACGGTGCTCTACAGG 0: 1
1: 0
2: 0
3: 9
4: 44
927708712_927708713 -10 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708713 2:25312431-25312453 ACTGGGTGCACACACCCCCACGG 0: 1
1: 0
2: 1
3: 32
4: 173
927708712_927708724 18 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708724 2:25312459-25312481 TACAGGGTGCTGGGCTGGGAAGG 0: 1
1: 0
2: 3
3: 42
4: 533
927708712_927708725 22 Left 927708712 2:25312418-25312440 CCTGCTCTGGCTGACTGGGTGCA 0: 1
1: 0
2: 2
3: 28
4: 209
Right 927708725 2:25312463-25312485 GGGTGCTGGGCTGGGAAGGCAGG 0: 1
1: 0
2: 9
3: 122
4: 1007

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927708712 Original CRISPR TGCACCCAGTCAGCCAGAGC AGG (reversed) Intronic