ID: 927712224

View in Genome Browser
Species Human (GRCh38)
Location 2:25332970-25332992
Sequence CAGTGGGCAGGGAGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1397
Summary {0: 1, 1: 0, 2: 13, 3: 167, 4: 1216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927712212_927712224 15 Left 927712212 2:25332932-25332954 CCCAGCAAAGGCCACTCTCCGCT 0: 1
1: 0
2: 0
3: 7
4: 122
Right 927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG 0: 1
1: 0
2: 13
3: 167
4: 1216
927712213_927712224 14 Left 927712213 2:25332933-25332955 CCAGCAAAGGCCACTCTCCGCTT 0: 1
1: 0
2: 0
3: 5
4: 108
Right 927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG 0: 1
1: 0
2: 13
3: 167
4: 1216
927712214_927712224 4 Left 927712214 2:25332943-25332965 CCACTCTCCGCTTAGCTCCAAAG 0: 1
1: 0
2: 2
3: 5
4: 96
Right 927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG 0: 1
1: 0
2: 13
3: 167
4: 1216
927712211_927712224 21 Left 927712211 2:25332926-25332948 CCAGAACCCAGCAAAGGCCACTC 0: 1
1: 0
2: 0
3: 25
4: 204
Right 927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG 0: 1
1: 0
2: 13
3: 167
4: 1216
927712215_927712224 -3 Left 927712215 2:25332950-25332972 CCGCTTAGCTCCAAAGAGACCAG 0: 1
1: 0
2: 0
3: 10
4: 186
Right 927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG 0: 1
1: 0
2: 13
3: 167
4: 1216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927712224 Original CRISPR CAGTGGGCAGGGAGGGAAAG AGG Intronic
900103895 1:974130-974152 GAGGGAGCAGGGAGGGAAACAGG + Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900380123 1:2379784-2379806 CTGTGGGCAGGAAGGTAAAAGGG + Intronic
900556483 1:3283381-3283403 CAGGAGGGAGGGAGGGAGAGAGG - Intronic
900585644 1:3431132-3431154 GATGGGGCAGGGAGGGAACGTGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900762554 1:4482755-4482777 CAGTGGGCACGGAGGGGTATGGG + Intergenic
901216751 1:7559379-7559401 AAGGTGGCAGGGAGGGCAAGAGG - Intronic
901266416 1:7914186-7914208 GAGAGGGAAGGGAGGGAAAGCGG - Intergenic
901433320 1:9231652-9231674 AGGTGGGGAGGGAGGGAAACAGG - Intergenic
901493123 1:9606692-9606714 CAGAGGGAAGAGAGGGACAGAGG - Intronic
901671905 1:10861000-10861022 CGGTGGGCTGGGAGAGACAGTGG + Intergenic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
902169254 1:14597840-14597862 CTGTGGTCTGGGAGAGAAAGAGG + Intergenic
902312691 1:15593800-15593822 AATTGGGCAGGAGGGGAAAGAGG - Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902394512 1:16125321-16125343 CTGTGGGCCGGGAGGGAGAGAGG + Intronic
902408593 1:16199866-16199888 GAGCGAGTAGGGAGGGAAAGTGG - Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902513756 1:16979411-16979433 CAGGGAGAGGGGAGGGAAAGGGG + Intronic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902917424 1:19646983-19647005 CAGAGGCCAGGGAGGATAAGAGG + Intronic
903259773 1:22125198-22125220 CATGGGGCAGGGAGGCAGAGAGG - Intronic
903435395 1:23344948-23344970 CGGCAGCCAGGGAGGGAAAGAGG - Intergenic
903583466 1:24390071-24390093 CAGATGGCAGAGAGGGAATGAGG - Intronic
903753831 1:25647150-25647172 GAGTGAGCAGGGAGGGCACGTGG + Intronic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904354076 1:29927088-29927110 CTGGGGGCAGGGAGGTGAAGAGG + Intergenic
904354179 1:29927794-29927816 CAGAGGGTGGGGAGGGGAAGTGG - Intergenic
904393030 1:30198177-30198199 CAGAGGGGAGGGGGGGAGAGAGG + Intergenic
904616104 1:31750767-31750789 CAGGGCGCAGTGGGGGAAAGAGG + Intronic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
905024466 1:34840198-34840220 ACACGGGCAGGGAGGGAAAGAGG + Intronic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905210767 1:36372701-36372723 AGGTGAGCAGGGAGGGAGAGAGG + Intronic
905257319 1:36693237-36693259 CAGAGGGCAGGAAGAGGAAGAGG - Intergenic
905331144 1:37198894-37198916 CAGGGGTTAGGGAGGGGAAGAGG + Intergenic
905481914 1:38267747-38267769 AAGTAGGGAGGGAGGGAGAGAGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905876379 1:41434390-41434412 CAGTGGGCAGTCAAGGAAGGAGG - Intergenic
905986095 1:42283903-42283925 CAGAGGGCAGGCAGGGCAAAAGG - Intronic
906001717 1:42431999-42432021 CAGTTGGCAGGGGGAGAGAGAGG - Intronic
906085895 1:43134521-43134543 AAGTGGGCAGGAGGGGAAAGGGG - Intergenic
906153065 1:43598995-43599017 CTGAGGGCAGGCAGGGGAAGAGG - Intronic
906225276 1:44117032-44117054 GGGTAGGGAGGGAGGGAAAGAGG - Intergenic
906346357 1:45017793-45017815 CAGTGGTGAGTGAGGGACAGAGG - Exonic
906493943 1:46289961-46289983 CAGTGGGCTGGTAGGGGAAGAGG + Intronic
906501294 1:46343138-46343160 CAGTGGGCAGGGATGGGGGGTGG - Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906822160 1:48940982-48941004 GAGTGGGCAGGCAGAGAAAGGGG + Intronic
907017241 1:51028903-51028925 GAGGGGGCAGGGAGGGAGGGAGG - Intergenic
907299234 1:53476216-53476238 CAGAGGGCAGGCAGAGAAGGAGG - Intergenic
907303772 1:53502928-53502950 GAGGGGGCAGGGAGAGAGAGGGG + Intergenic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907580775 1:55570625-55570647 CAGTGAGCTGGAAGGGAAAGAGG + Intergenic
907701037 1:56788608-56788630 AAGTGGGGAGGGAGTGAAAAGGG - Intronic
907974517 1:59418469-59418491 GAGTGAGCAGGAAGGGAAGGAGG + Intronic
908356557 1:63329080-63329102 CAGAGGGCAAGGAGGGGGAGTGG - Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
910053664 1:83006381-83006403 CAGTGGGCATTGCTGGAAAGAGG + Intergenic
910262756 1:85307783-85307805 CAGTAGGCATGGAAGGCAAGGGG - Intergenic
910377400 1:86587527-86587549 CAATGGGAAGGGAAGGAAAATGG - Intergenic
910649294 1:89547798-89547820 TAGTGGGCGGGGAGGGGAGGGGG + Intronic
910758330 1:90713194-90713216 CAGTGGGCAGGGGGCTTAAGGGG + Intronic
910775517 1:90870947-90870969 TTGTGGGCTAGGAGGGAAAGTGG - Intergenic
911086512 1:93982232-93982254 GAGGGGGCAGGGAGGGAAGGGGG - Intergenic
911158747 1:94661497-94661519 AAGTGGGCTGGAGGGGAAAGAGG + Intergenic
911380101 1:97104035-97104057 CACTGGGCAGGGAGGGTAATCGG - Intronic
911500169 1:98676112-98676134 GGATGGGCAGGGAGGGAGAGAGG - Intronic
911591891 1:99758042-99758064 AAGTGGGCTGGAGGGGAAAGAGG + Intronic
911760272 1:101605936-101605958 CAAAGGCCAGGGAGGTAAAGTGG + Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912775458 1:112504021-112504043 CAGGTGGTAGGGAGAGAAAGAGG + Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913248629 1:116892627-116892649 CAGTGGGGAGGAAAGGAGAGAGG - Intergenic
914443193 1:147724802-147724824 GAGTGGGGAGGGAGGAAATGGGG - Intergenic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915161214 1:153922342-153922364 CATGAGGCAGGGAGTGAAAGCGG + Intronic
915216726 1:154345344-154345366 CAGTGGGCAGGAAGGGATCCAGG + Exonic
915327348 1:155087111-155087133 CAGTGGACAAGGATGGCAAGGGG + Exonic
915525711 1:156475120-156475142 CAGTGGGCATGGAAGAGAAGGGG + Exonic
915665541 1:157440917-157440939 CAGTTGGCATTGAGGGAATGTGG - Intergenic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916554987 1:165886771-165886793 AAGAAGGCAGGGAGGGAAGGAGG - Intronic
916657834 1:166893107-166893129 CAGTGGGCAGGAGGAGAGAGAGG - Intergenic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
916949748 1:169767570-169767592 AAGTGGGCAGGGTGGGGGAGAGG + Intronic
917104650 1:171480281-171480303 CAGGAAGAAGGGAGGGAAAGAGG - Intergenic
917512938 1:175683094-175683116 AAGTGGACAGGGAGAGAAAAGGG - Intronic
917713561 1:177711222-177711244 GAGAGAGCAGGGAAGGAAAGAGG + Intergenic
917832514 1:178908078-178908100 GAGTGGGGAGGGTGGGAGAGGGG - Intronic
918133071 1:181646025-181646047 CAGTGAGTGGGGAAGGAAAGAGG - Intronic
918220187 1:182429718-182429740 CAGTGGCCAGGGTGAGGAAGAGG + Intergenic
918375299 1:183902896-183902918 GAGTGGGCAGGGAAGAAATGTGG - Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918733082 1:188022889-188022911 CTGGGGTCAGGGAGGGAGAGTGG + Intergenic
919041380 1:192392609-192392631 AAGTGGGGAGGGAGGGACAGAGG + Intergenic
919086896 1:192931160-192931182 CAGGGGTCAAGCAGGGAAAGAGG - Intergenic
919090856 1:192977757-192977779 AAGTGTGCAGTGTGGGAAAGAGG - Intergenic
919131924 1:193461900-193461922 CAGGTGGCAAGGAGTGAAAGGGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919843162 1:201623617-201623639 GAGCAGGCAGGGAGGGAAGGGGG + Intronic
919991070 1:202709163-202709185 CAGTGGGGAGGGAAGGGCAGAGG - Intronic
920186236 1:204161159-204161181 CAGTGGGCACAGAGGCAGAGAGG + Intronic
920773899 1:208916967-208916989 CAGTGAGGAGTGTGGGAAAGTGG - Intergenic
921266403 1:213424384-213424406 TAGATGGCAGGGAGGGAGAGGGG + Intergenic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921514481 1:216073026-216073048 GGGCTGGCAGGGAGGGAAAGGGG + Intronic
921924869 1:220703207-220703229 GAGAGTGCAGGGAGGGAAACAGG + Intergenic
922145856 1:222943549-222943571 CAGTTTGCAGACAGGGAAAGGGG - Intronic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922683948 1:227624990-227625012 CAGTGGGAAGGGACCCAAAGGGG + Intronic
922801979 1:228368611-228368633 CCGGGGGCAGGGTGGGACAGTGG - Intronic
922803090 1:228372923-228372945 CCGTGGGCAGGAAGCGCAAGTGG + Exonic
922875932 1:228939965-228939987 CAGAGGACAGGGAAGGAAAGAGG + Intergenic
923810616 1:237310562-237310584 AAGTGGGCTGGAGGGGAAAGAGG - Intronic
923843321 1:237698655-237698677 CAGTGAGATGGGAGGGAGAGGGG + Intronic
924099922 1:240592809-240592831 CAGGGAGCAGAGAGGCAAAGTGG - Intronic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924252445 1:242146046-242146068 CAGGGGTCAGAGATGGAAAGTGG + Intronic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924954439 1:248913190-248913212 CACAGGGGAGGGAGGGAAACTGG - Intronic
1063289943 10:4735037-4735059 AAGGAGGCAGGGAGGGAAGGAGG - Intergenic
1064142148 10:12799398-12799420 TAGGAGGGAGGGAGGGAAAGAGG + Intronic
1064254322 10:13731252-13731274 AAGTGGGGAGGAAGGCAAAGAGG + Intronic
1064291956 10:14043430-14043452 CAGTGGGCAGGGAGTGAAATTGG - Intronic
1064297766 10:14093877-14093899 CAGTGAACAGTGAGGGAAAGAGG - Intronic
1064602477 10:17007620-17007642 CAGTGGGGAGGGTGGGGCAGGGG + Intronic
1065465496 10:26016423-26016445 TAGTGGGCAGGGACAGGAAGAGG + Intronic
1065817530 10:29495601-29495623 CTGAGGGGAGGGAGGGACAGTGG + Intronic
1065955331 10:30688797-30688819 CTGAGGGGAGGGAGGGACAGTGG - Intergenic
1066306088 10:34142582-34142604 CGGGGGGCAGGGAGGGAGGGAGG + Intronic
1066402661 10:35090492-35090514 CGGTAGGGAGGGGGGGAAAGGGG + Intronic
1067045277 10:42981876-42981898 CACTGGGCAGGGAAGGGCAGGGG + Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067807890 10:49405841-49405863 GAGTGGGAGGGAAGGGAAAGAGG - Intergenic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068021136 10:51585974-51585996 GAGTGGGGAGGTAGGGCAAGAGG + Intronic
1068064622 10:52113420-52113442 CAGAAGGGAGGGAGGGAAAGAGG + Intronic
1068741459 10:60477135-60477157 AAGTGGGGAGAGAGTGAAAGGGG + Intronic
1069826661 10:71258879-71258901 CACTGGGCGGGGAGGACAAGAGG - Intronic
1069852486 10:71419137-71419159 TAGAGGGCAGGGAGAGGAAGTGG - Intronic
1070340652 10:75495245-75495267 CAGAAGGGAGGGAGGGAGAGAGG - Intronic
1070747632 10:78944268-78944290 CAGAGGGCAGGGATGGGCAGAGG + Intergenic
1070817629 10:79335389-79335411 GAGTGGGCAGAGAGGAAAATGGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071300196 10:84250662-84250684 CAGTGTGAAGGCAGGCAAAGGGG + Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1071867730 10:89755429-89755451 AAGGGGGGAGGGAAGGAAAGGGG - Intronic
1072066873 10:91879913-91879935 CAGTGGGCAGGGGGGGCATGGGG - Intergenic
1072296545 10:94013995-94014017 CGGTGGGCAGGCAGGGGATGAGG + Intronic
1072554070 10:96501366-96501388 GAATGGGAAGGGAGGGAAAGTGG - Intronic
1072559871 10:96562245-96562267 GAGTGGCCAGGGAGGGAGAGAGG - Intronic
1072913252 10:99521868-99521890 GGGTGGGCCTGGAGGGAAAGGGG - Intergenic
1072940810 10:99761981-99762003 GAGTGGGGAGAGAAGGAAAGAGG + Intergenic
1073072470 10:100803378-100803400 GAGAGGGCAGGAAGGGAATGAGG - Intronic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1073689390 10:105790845-105790867 TATTGGACAAGGAGGGAAAGGGG - Intergenic
1073809677 10:107138832-107138854 CAGTCTGCAGTGAGGGACAGCGG - Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074183186 10:111080306-111080328 CAGTGGCCCTGGAGGGAGAGAGG - Exonic
1074204658 10:111272271-111272293 AAGTGGGGAGAGAGGGAGAGGGG + Intergenic
1074628421 10:115220674-115220696 AAGTGTGCAGTGTGGGAAAGAGG + Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075667142 10:124239564-124239586 GAGGGGGAAGGGAGGGAGAGAGG + Intergenic
1075723131 10:124598750-124598772 GAATGGGCAGGGATGGACAGGGG - Intronic
1075823531 10:125334313-125334335 CAGAGGGCATGCAGGGGAAGAGG + Intergenic
1075970725 10:126649977-126649999 GAGTGGGGAGGGAGGAAAACAGG + Intronic
1075995681 10:126874294-126874316 AAGTGGGGAGGGAGGCAAAGAGG - Intergenic
1076059152 10:127400060-127400082 CAGTGTCCAGGGAGGGTAGGAGG - Intronic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076494930 10:130890827-130890849 GAGAGGGGAGAGAGGGAAAGAGG + Intergenic
1076509042 10:130999310-130999332 CATTTGGAAGGGAGGGAGAGAGG + Intergenic
1076577846 10:131482692-131482714 CATGGGGCAGGGAGCAAAAGAGG + Intergenic
1076654175 10:132011293-132011315 CAGTTTGCAGAGAGAGAAAGAGG - Intergenic
1076732065 10:132444098-132444120 GAGTGAGCAGGGAGGGAGTGAGG - Intergenic
1076786950 10:132754643-132754665 CAGAAGACAGGGTGGGAAAGTGG + Intronic
1076856292 10:133116926-133116948 CAGAGGGCGGGGAGGGTAAAGGG + Intronic
1077133474 11:986762-986784 CTGTGTGGAGGGAGGGGAAGTGG - Intronic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077259761 11:1610081-1610103 CGATGGGCAGGAAGGGAAGGCGG - Intergenic
1077272253 11:1686821-1686843 GAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077391833 11:2303878-2303900 TGGAGGGCAGGGAGGAAAAGAGG + Intronic
1077662903 11:4085038-4085060 ATCTGGGCTGGGAGGGAAAGAGG + Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078093852 11:8284353-8284375 CGAAGGGGAGGGAGGGAAAGAGG - Intergenic
1078153790 11:8780912-8780934 CAGTGGCCAGGGTGGCTAAGAGG + Intronic
1078391175 11:10936810-10936832 TGGTGGGCAGGTTGGGAAAGGGG + Intergenic
1078536895 11:12182538-12182560 GAGTTGGGAGGAAGGGAAAGAGG - Intronic
1078605981 11:12776007-12776029 CAGTGGGCAGGGAGGGGTGCAGG + Intronic
1079360146 11:19763869-19763891 CAGTGGGCAGGGCAGTGAAGGGG - Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1079968080 11:27003323-27003345 CTGGAGGCAGAGAGGGAAAGAGG - Intergenic
1080774280 11:35371283-35371305 CACTAGGAAGGGAGGGAATGTGG - Intronic
1081432244 11:42989136-42989158 TGTTGGGCAGGGAAGGAAAGGGG - Intergenic
1081577496 11:44328328-44328350 GAAGGGGCAGGGAGGGAAAGTGG - Intergenic
1081618654 11:44605437-44605459 CAGTGAAGAGGGAGGGAGAGAGG - Intronic
1081666072 11:44917920-44917942 CAGAGGGCAGGCAGGGGATGGGG - Intronic
1081881328 11:46455326-46455348 GACTGGGGAGAGAGGGAAAGAGG - Intronic
1082986016 11:59172089-59172111 GGGTGGGGAGGGAGGGAGAGAGG + Intronic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083464243 11:62834594-62834616 CAGTGTGCAGGGAGGGGGTGAGG - Intronic
1083594857 11:63914340-63914362 CAGGGGCCAGGGAGGGAATGAGG + Intronic
1083602662 11:63958525-63958547 CAGTGGGCAGGCGGAGCAAGAGG + Intergenic
1083609497 11:63998315-63998337 CAGGGGGCGGGGAAGAAAAGAGG - Exonic
1083641521 11:64148265-64148287 GAGAGGGCTGTGAGGGAAAGGGG - Intronic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1083743333 11:64722500-64722522 AAGTGGAGAGGGAAGGAAAGGGG - Intronic
1083766660 11:64844681-64844703 CAGCGGGGAGGGCGGGAGAGGGG - Intergenic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084175074 11:67418733-67418755 CTGTGGGCAGAGAAGGCAAGTGG - Intronic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1084596944 11:70122616-70122638 GAAGGGGGAGGGAGGGAAAGAGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1085524873 11:77158253-77158275 TGGTGGGCAGGGTGGGAGAGTGG - Intronic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1087219749 11:95533447-95533469 CATTGCTCTGGGAGGGAAAGTGG - Intergenic
1087261470 11:96017358-96017380 AGGTGGGGAGGGAGGGAGAGAGG - Intronic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1087873665 11:103329435-103329457 CAGTAGTTTGGGAGGGAAAGTGG + Intronic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089119073 11:116119102-116119124 CAGGGAGAAGGGAAGGAAAGGGG - Intergenic
1089126130 11:116177787-116177809 CAGTGGGCTGGGCTGGACAGTGG + Intergenic
1089457364 11:118633496-118633518 CAGAGGGCAGGCAGGGGAATAGG - Intronic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1089566896 11:119376423-119376445 CACTGGGCAGGGAGGGGTATGGG - Intronic
1089795165 11:120974382-120974404 GAATGGGCAGAGAGGGATAGAGG + Intronic
1089943346 11:122441943-122441965 CAGTGGGAAGGAAAAGAAAGGGG - Intergenic
1090257621 11:125296530-125296552 CAGGAGTCAGGGAGGGAGAGGGG - Intronic
1090276890 11:125426584-125426606 CAGTGTGCAGACAGGCAAAGAGG - Intronic
1090276900 11:125426709-125426731 CAGTGTGCAGACAGGCAAAGAGG - Intronic
1090357069 11:126147232-126147254 CAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1090643625 11:128749795-128749817 TAAAGGGCAGGGAGGGAAAAGGG - Intronic
1090743736 11:129690870-129690892 CAGGGGGCCGGGTGGGAAATGGG + Intergenic
1091090877 11:132770375-132770397 CAGAGGGGAGGAAGGGAGAGAGG + Intronic
1091204503 11:133810418-133810440 GAGTGGGGAGGGAAGGAAATGGG + Intergenic
1091247384 11:134109693-134109715 AAGTGGGCTGGAGGGGAAAGAGG + Intronic
1091331840 11:134736775-134736797 CACAGGGGAGGGAGGGAGAGGGG - Intergenic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1091587016 12:1822282-1822304 CAGTGGGCAGTGTAGGAAGGAGG + Intronic
1091666747 12:2424353-2424375 CAAGGGGGAGGGAGGGAAAACGG + Intronic
1091692338 12:2605653-2605675 CAGTGGGAAGGGACGGGGAGAGG - Intronic
1091738042 12:2939505-2939527 CCTGGGGCAGGGAGGGGAAGGGG - Intronic
1092085346 12:5753244-5753266 TAGTGGGCTGGAGGGGAAAGAGG + Intronic
1092258754 12:6941351-6941373 CTGTGAGCAGGAAGGGCAAGGGG - Intronic
1092280664 12:7095631-7095653 GTGGGGGCTGGGAGGGAAAGCGG + Exonic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1092845936 12:12585331-12585353 CAGTAGGCAGTCAGGGAAATGGG + Intergenic
1093971108 12:25376854-25376876 AAGAGGGAAGGGAGGGAAAGGGG + Intergenic
1094178829 12:27569452-27569474 CAGTGGGCAGGAAAGCAGAGGGG - Intronic
1094555711 12:31497838-31497860 GAGGGGGCAGGGGGGGCAAGGGG + Intronic
1094641908 12:32283990-32284012 GGGAGGGCAGGGAAGGAAAGGGG - Intronic
1094715322 12:33008198-33008220 AAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1095948374 12:47766779-47766801 CAGTGGGCAGGCAGAGGAAATGG + Intronic
1096344806 12:50836438-50836460 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1096357403 12:50952837-50952859 CACTGGGCTTGGAGGGGAAGGGG - Intergenic
1096478518 12:51923179-51923201 CAATGGCCAGGGAGTGAAGGAGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096781775 12:53995993-53996015 GAGGGGGCGGGGAGGGGAAGAGG + Intronic
1096869693 12:54585552-54585574 CAGTGGGGAGGGAAGGCAAATGG + Intronic
1097179391 12:57162685-57162707 CATGGGGCAGGAAGGGAAATGGG - Intronic
1097323694 12:58252511-58252533 AAATAGGCAGGGAGGGAAGGAGG - Intergenic
1097695358 12:62769846-62769868 AAGTGGGCTGGAGGGGAAAGAGG + Intronic
1097698560 12:62798208-62798230 AAGTGGGCCGGAGGGGAAAGAGG + Intronic
1097726393 12:63080026-63080048 TAGTCAGCAGGGAGAGAAAGGGG - Intergenic
1098756789 12:74373982-74374004 CAGTGGACACCGAAGGAAAGCGG - Intergenic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1100932427 12:99625229-99625251 CACTGGGGAGGGAAGGAGAGAGG + Intronic
1101323927 12:103698123-103698145 CAGAGGGCTGGAGGGGAAAGAGG - Intronic
1101331064 12:103758268-103758290 CAGTGGGCTGGGGGAGAATGAGG + Exonic
1101568029 12:105928027-105928049 CAGTGGGAAGAGAGTGGAAGAGG + Intergenic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1101662048 12:106774620-106774642 CAGGACGGAGGGAGGGAAAGAGG + Exonic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1101955718 12:109211094-109211116 CAGAGGGCAGGAAGGCAAACAGG - Intronic
1102099399 12:110266842-110266864 CAGTGGGGAGGGAAGGTAAAGGG - Intergenic
1102535635 12:113578662-113578684 AGGTGGCCAGGGAGGGAGAGAGG - Intergenic
1102539800 12:113610539-113610561 GAGGGGGCAGCGAGGGGAAGAGG - Intergenic
1102552784 12:113703813-113703835 CATTGTGGAGTGAGGGAAAGAGG - Intergenic
1102572619 12:113836235-113836257 CAGTGGGCAGGGGCAGGAAGAGG + Intronic
1102609139 12:114095906-114095928 CAGCTGGCAGGAAGGGGAAGGGG - Intergenic
1102670935 12:114618212-114618234 AAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102935502 12:116893140-116893162 AAGTGGGCTGGAAGGGAAAGAGG - Intergenic
1103216846 12:119208256-119208278 CAGTTTGCAGGGAGAGATAGTGG - Intronic
1103721008 12:122975412-122975434 CAGTGGGCAGAGAGGGGTAGTGG + Intronic
1103999146 12:124849326-124849348 CCGTGGGCAGAGAGGGGATGAGG - Intronic
1104205490 12:126634650-126634672 CAGGAGGCAGGGAGGGGAATAGG - Intergenic
1104313808 12:127678922-127678944 CAGTTGTCTGGGAAGGAAAGAGG + Intergenic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1104854087 12:131894241-131894263 GAGGGGGCAGGGAGGGAGAGAGG + Intergenic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1104931097 12:132339846-132339868 CGTTGGGCAGGGCGGGGAAGAGG + Intergenic
1104950467 12:132437609-132437631 CAGGGAGGAGGGAGGGAGAGAGG + Intergenic
1105202340 13:18191146-18191168 GAGTGGGTGGGGAGGGCAAGAGG + Intergenic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105694091 13:22871393-22871415 CAGAGGCCTGGGAGGGAAAATGG + Intergenic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105846513 13:24298674-24298696 CAGTGGGCAAGGATGGGGAGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1105945040 13:25181835-25181857 CTCTGGGCAGGGAGGCAGAGTGG + Intergenic
1106248855 13:27969068-27969090 CGGGGGGCACGAAGGGAAAGGGG + Exonic
1106588080 13:31074389-31074411 CAGTGGGGAGGGAGGATAAGTGG - Intergenic
1106753211 13:32796090-32796112 CAGAGGCCAGGCAGGGAAGGAGG - Intergenic
1107295093 13:38899567-38899589 CAGACGGCAGGTAGGAAAAGAGG + Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1107986774 13:45782921-45782943 CAGTCGGCAGGTTGGGGAAGGGG - Exonic
1109447005 13:62454087-62454109 TTGTGGGCATTGAGGGAAAGGGG - Intergenic
1110121633 13:71888806-71888828 CAGTTGGCAGAGAGGGAATGTGG + Intergenic
1110574700 13:77042042-77042064 CAGTGGGCAGGGAGATATATTGG + Intergenic
1111105529 13:83641219-83641241 AAGTAGGCTGGAAGGGAAAGAGG - Intergenic
1111585878 13:90284305-90284327 GAGTGGGCAGAGAAGGAAAAAGG + Intergenic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112050029 13:95635935-95635957 AAGGAGGTAGGGAGGGAAAGAGG + Intronic
1112381751 13:98897419-98897441 TAGTGGGGAGGGAGGAACAGGGG - Intronic
1112384089 13:98921856-98921878 CAGAAGACAGTGAGGGAAAGTGG + Intronic
1112629201 13:101141739-101141761 CTGTGGGAAGGGAAAGAAAGCGG + Intronic
1112759118 13:102673030-102673052 AAGTGGGCAGGGAGGCAATGTGG - Intronic
1112923142 13:104640516-104640538 CAATGGGCAAAGAGGGAATGAGG - Intergenic
1112951824 13:105007337-105007359 CAGCGGGCAGGGAAGGAGCGTGG - Intergenic
1113120310 13:106917739-106917761 CAGAGGGCCGGGACGGAAACGGG + Intergenic
1113366050 13:109676786-109676808 CAATGGGCAGGAAGGGATAAGGG + Intergenic
1113401281 13:109995905-109995927 AAGTGTGCAGTGTGGGAAAGAGG - Intergenic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1113575542 13:111392770-111392792 GAGAGGCCAAGGAGGGAAAGGGG + Intergenic
1113600250 13:111563375-111563397 GTGAGGGGAGGGAGGGAAAGAGG - Intergenic
1113796555 13:113061788-113061810 GAGAGGGAAGGGAGGGGAAGGGG - Intronic
1113952088 13:114077655-114077677 CGTTGGGCAGGGAGGGAGGGAGG - Intronic
1114384934 14:22244472-22244494 CAGTAGGCAGGGATGGACTGAGG + Intergenic
1114737873 14:25061630-25061652 GAGTGGGAAGGGTGGGATAGGGG + Intergenic
1115013408 14:28578782-28578804 CACTGGGGAGGGTGGGAAAAGGG - Intergenic
1115434061 14:33353806-33353828 CAGTGGGCAAGAAGGGACAGAGG + Intronic
1115814849 14:37152975-37152997 AAGTGGGGAAGGAGGAAAAGAGG + Intronic
1115854904 14:37621075-37621097 CAGTGTGTAGGAAGGGAATGGGG - Intronic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116546123 14:46167147-46167169 CACTGGGCAGTGCCGGAAAGTGG - Intergenic
1117939242 14:60943571-60943593 CAGTGGGCAGTGAGGGAGTGGGG + Intronic
1118129913 14:62951422-62951444 AAATAGGCAGGGAGGGAAAATGG + Intronic
1118615010 14:67569255-67569277 AGGTGGGCAGGGTGGGCAAGCGG + Intronic
1118760934 14:68879847-68879869 AAGTGAGGAGGGAGAGAAAGGGG - Intronic
1118772463 14:68951369-68951391 GAGTGAGGAGGGAGAGAAAGAGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119153650 14:72388636-72388658 GAGTGGCCAGGTAGGGAATGAGG - Intronic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119314977 14:73686044-73686066 CGGTTGGCAGGGAGGTAAAATGG - Intronic
1119425300 14:74531155-74531177 CAGGCGGCAGGGAGGGAAGGAGG + Intronic
1119519625 14:75276709-75276731 GAGGGGGACGGGAGGGAAAGGGG - Intergenic
1119542724 14:75451273-75451295 CAGTGGTCAAGGAGAGACAGTGG + Intronic
1119576868 14:75731907-75731929 AAGTTGGCAGGGAGGGATTGGGG + Intronic
1120844892 14:89117037-89117059 TTGTGGACAGGGAGGGAAATTGG - Intergenic
1121507387 14:94487117-94487139 GAATGGGCAGGGAGGAAATGGGG + Intergenic
1121586628 14:95067456-95067478 AAGTGAGCAGAGAGGGCAAGTGG - Intergenic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1121784679 14:96648815-96648837 CAGTGGGCAGGGTGGCTGAGTGG + Intergenic
1121832681 14:97065744-97065766 CAGTAGGCAGAGAAGGAAAAGGG + Intergenic
1121928715 14:97952533-97952555 GGGTGGAGAGGGAGGGAAAGGGG - Intronic
1122031248 14:98914233-98914255 GAGGAAGCAGGGAGGGAAAGAGG + Intergenic
1122206906 14:100152204-100152226 CATGGGGCAGGGAGGGCAACAGG + Intronic
1122288403 14:100666492-100666514 CAGTGGGAAGGGCTGGAGAGTGG - Intergenic
1122363878 14:101183131-101183153 GGGTAGGCAGGGAGGGAAAGAGG - Intergenic
1122643736 14:103177647-103177669 CAGTAGGCAGGGTGGGGAAAGGG + Intergenic
1124163647 15:27298414-27298436 AAGTGGGCTGGAGGGGAAAGAGG + Intronic
1124398078 15:29322771-29322793 AAGTGGGCAGGAAGGGAAGGAGG - Intronic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1124949498 15:34303755-34303777 CAGAGGGCAGAGAGGGTAAGAGG - Intronic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1124998965 15:34752313-34752335 CAATGGGAAAGGAGGAAAAGTGG - Exonic
1125141336 15:36411247-36411269 ACCTGGGGAGGGAGGGAAAGGGG - Intergenic
1125378306 15:39058113-39058135 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1125503477 15:40253341-40253363 GAGCAGGCAGGGAGGGACAGTGG + Intronic
1125582114 15:40793520-40793542 CAGTGGTCAGGGTAGGAAGGCGG - Intronic
1125681228 15:41531426-41531448 CAGTGGACTGTGAGGGATAGAGG - Intronic
1125768652 15:42151031-42151053 CAGGGAGCGGGGAGGGAGAGGGG + Intronic
1125772069 15:42175014-42175036 CAGATGACAGGGAGGGGAAGAGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126679614 15:51190506-51190528 CAGTGAGCAGGGAAGGATTGTGG - Intergenic
1126692379 15:51297648-51297670 CATTGAGCAGGGAGGGAGACAGG - Intronic
1127340468 15:58038117-58038139 AAGTAGGGAGGGAGGGGAAGAGG - Intronic
1127579855 15:60328222-60328244 GAGGGGGGAGGGAGGGATAGGGG + Intergenic
1127672238 15:61206242-61206264 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
1127825675 15:62700697-62700719 CAGGGTGCAGGGTGAGAAAGAGG - Intronic
1127859587 15:62982089-62982111 CACTGGGAAGGGGGTGAAAGAGG - Intergenic
1127882399 15:63169933-63169955 CCGTGGGCTGGCAGGGAGAGAGG - Intergenic
1127958242 15:63871512-63871534 CAGTGGGCAGGGTGGGGCTGGGG + Intergenic
1128218108 15:65948131-65948153 CCCTGGGCAGGGAGGGATGGTGG - Intronic
1128803389 15:70512618-70512640 GAGTGGGGAGAGAGGGAGAGGGG + Intergenic
1128806914 15:70538078-70538100 AAGTGGACAAGGAGAGAAAGGGG - Intergenic
1128968653 15:72086662-72086684 CTGTGGGCAGGGAGGGGTTGGGG + Intronic
1129149838 15:73681661-73681683 CAGTGGGAAGTGGGGGGAAGTGG + Intergenic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129178257 15:73855449-73855471 CAGGGGGAAGAGAGAGAAAGAGG + Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129296794 15:74604247-74604269 CAGTGGGCTGGGTGGGGCAGGGG + Intronic
1129384091 15:75185978-75186000 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130235881 15:82132985-82133007 CAGGAGGAAGGGAGGGAAAGTGG + Intronic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130576584 15:85098022-85098044 CATTGGACAGGGAGGGTAAGTGG + Exonic
1130661974 15:85837916-85837938 CAGTGGGGAGGTGGGGAAGGTGG - Intergenic
1130742566 15:86616452-86616474 CAGTGGGCAGGGTGATAAAATGG + Intronic
1130899715 15:88198244-88198266 CAGTGGGTAAGGATGGGAAGGGG - Intronic
1131016397 15:89061082-89061104 AAATGGGGAGGGAGGGAAGGAGG + Intergenic
1131370271 15:91875315-91875337 CAGTGGGAGGGGAGGGTCAGAGG - Intronic
1131631896 15:94186322-94186344 AAGTGTGCAGTGAGGAAAAGAGG + Intergenic
1131650166 15:94389315-94389337 GGGTGGGCATGGAGGGGAAGTGG + Intronic
1132270631 15:100520772-100520794 GAGTGGGCAGGGTGGGGAGGAGG + Intronic
1132316738 15:100895713-100895735 CAGTGTGCAGGCTGGGCAAGGGG - Intronic
1132424908 15:101707688-101707710 CTGGGGGCAGGGCGGGAATGGGG + Intronic
1132461545 16:57755-57777 CGGTGGACAGGGAGGGAGTGTGG + Intergenic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132630406 16:914568-914590 TCATGGGAAGGGAGGGAAAGAGG - Intronic
1132753587 16:1470912-1470934 CAGGGGGCAGTGAGGGGAGGTGG - Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1132860496 16:2069134-2069156 CACTAGGCAGGCAGGAAAAGGGG - Intronic
1132975064 16:2706911-2706933 CAGTGGGCATGGAGGAACAGAGG + Intronic
1133098834 16:3466863-3466885 CAGTGTGCTGGGACAGAAAGTGG + Intronic
1133146612 16:3791739-3791761 CAGGGGGCAGGGAGAGGGAGAGG + Intronic
1133191098 16:4134142-4134164 CAGTGCCCAGGCAGGGACAGTGG + Intergenic
1133531892 16:6663081-6663103 AAGTGGGCAGGGATGGATACAGG + Intronic
1133590417 16:7237284-7237306 CAGCAGACAGGGAGGGAGAGAGG - Intronic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134061723 16:11203201-11203223 AAGGGGCCAGGGAGGGGAAGAGG + Intergenic
1134091219 16:11392565-11392587 CAGTGGGGAGCTACGGAAAGCGG - Intronic
1134276810 16:12783627-12783649 CAGTGTGATGGGTGGGAAAGTGG - Intronic
1134523562 16:14928949-14928971 CAGGGGGAAGGGAGGGGAAGGGG - Intronic
1134799683 16:17071956-17071978 CAGAAGGCAGGGAGGGAGGGAGG - Intergenic
1134825697 16:17282388-17282410 AAGTGAGCAGGGGGAGAAAGAGG + Intronic
1134839846 16:17393034-17393056 AAGTGGGCAGGAGGGGAAGGAGG - Intronic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135048481 16:19173363-19173385 AGGTGGGCAGGGTGGGGAAGAGG - Intronic
1135049993 16:19185074-19185096 AAGCGGGAAGGGAGGGAAGGAGG - Intronic
1135429042 16:22366633-22366655 TATTGGGCAGGGAGGGGAGGGGG + Intronic
1135531074 16:23255153-23255175 GAGTGGGAAGGGAGGGAGTGGGG + Intergenic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1135872796 16:26166304-26166326 GAGGAGGGAGGGAGGGAAAGAGG + Intergenic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136025891 16:27468974-27468996 GAGTGGGCGGGGTGGGGAAGCGG + Intronic
1136074326 16:27806481-27806503 AATTGGGCAGAGAGGAAAAGTGG + Intronic
1136083604 16:27868864-27868886 GAGTGGCCTGGGAGGGAATGTGG - Intronic
1136184219 16:28576245-28576267 CACTGGGCGGGGAGGGTAGGAGG + Intronic
1136289702 16:29264229-29264251 CAGAGGGCAGGGAGGGTGAGTGG - Intergenic
1136289710 16:29264260-29264282 CGGAGGGCAGGGAGGGTGAGTGG - Intergenic
1136500061 16:30665541-30665563 CACTGGGCAGGGAGGGATCATGG - Intronic
1137237032 16:46625044-46625066 CAGAGGGCAGGGAGGCATGGGGG + Intergenic
1137369856 16:47895159-47895181 CAGTGGGGAGGGAAGTACAGGGG + Intergenic
1137390604 16:48078272-48078294 CAGTAGGGAGGGAAGGCAAGGGG + Intergenic
1137404099 16:48176472-48176494 GGGTGGGGAGGGAGGAAAAGGGG + Intronic
1137679967 16:50332981-50333003 AAGGGGGCAGGGAGGGAAGGGGG + Intronic
1137731686 16:50694483-50694505 CAGGGTGCAGCGAGGCAAAGGGG - Intronic
1137745209 16:50815544-50815566 GACAGGGCAGGGAGGGAATGTGG - Intergenic
1137751552 16:50864575-50864597 CAATGGACTGGGAGGGAAAGAGG + Intergenic
1138200072 16:55081916-55081938 CAGAGGGAAGGGAAGGGAAGGGG - Intergenic
1138476145 16:57271716-57271738 CAGAGGGCAGGATGGGAACGGGG - Intronic
1138548886 16:57736260-57736282 CAGGGGGCAGGGAGAAAAGGGGG + Intronic
1138795434 16:59962664-59962686 CAGTTGGAAGGGAGGGACATCGG + Intergenic
1139105845 16:63825508-63825530 GTGTGGGCAGAGATGGAAAGAGG - Intergenic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139725197 16:68891920-68891942 CAGGGAGGAGGGAGGGAGAGAGG + Intronic
1139782592 16:69364254-69364276 CAGGGAGCAGGGAGGGGCAGTGG - Intronic
1140175701 16:72657526-72657548 CAGAGGCCAGGAAGGGAAGGAGG + Intergenic
1140203948 16:72918224-72918246 CAGGGGGCAAGGATGGTAAGGGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140258576 16:73357855-73357877 CAGTGGGTGGGCATGGAAAGTGG - Intergenic
1140598284 16:76442145-76442167 TAGGAGGCAGGGAGGGAGAGAGG + Intronic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1140850401 16:78930090-78930112 CAGACGGCAGGAAGGGAAGGAGG - Intronic
1140899876 16:79357791-79357813 CACTGGGCAGGGAGGAGAATGGG - Intergenic
1141011429 16:80404012-80404034 CAGTGGGGAGGGAGTGAACAAGG - Intergenic
1141051042 16:80763945-80763967 AAGGGGGTAGAGAGGGAAAGAGG + Intronic
1141138984 16:81484902-81484924 AGGAGGGGAGGGAGGGAAAGAGG - Intronic
1141588015 16:85047962-85047984 CAGTGGGCAGGGAAGGGTGGCGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141635382 16:85311497-85311519 CATTGGGGAGGGAGGGAGGGAGG + Intergenic
1141701183 16:85642844-85642866 CAGCGAGCATGGAAGGAAAGGGG - Intronic
1141728998 16:85809453-85809475 CTGTAGCCAGGAAGGGAAAGGGG + Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142095430 16:88237178-88237200 CAGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095438 16:88237209-88237231 CAGAGGGCAGGGAGGGTGACTGG - Intergenic
1142095456 16:88237271-88237293 CGGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095466 16:88237302-88237324 CGGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095475 16:88237333-88237355 CAGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095483 16:88237364-88237386 CAGAGGGCAGGGAGGGTGACTGG - Intergenic
1142095500 16:88237426-88237448 CGGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095509 16:88237457-88237479 CGGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095536 16:88237550-88237572 CGGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095545 16:88237581-88237603 CAGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095562 16:88237643-88237665 CGGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095571 16:88237674-88237696 CAGAGGGCAGGGAGGGTGAGTGG - Intergenic
1142095607 16:88237798-88237820 CAGAGTGCAGGGAGGGTGAGTGG - Intergenic
1142312582 16:89322671-89322693 CACTGGGGAGGGTGGGGAAGGGG + Intronic
1142474978 17:183375-183397 AAGGGAGAAGGGAGGGAAAGTGG - Intergenic
1142715676 17:1745671-1745693 CAGGGGTCAGGGAGGTCAAGGGG - Intronic
1142730186 17:1849120-1849142 CTGTTGGCAGGGAGGTAAACTGG - Intronic
1142775898 17:2138711-2138733 CAGTGGACAGGGAGGGAGAGAGG - Intronic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1143014444 17:3884151-3884173 CAGTGGACAAGGAGGGACTGAGG - Intronic
1143022540 17:3924349-3924371 CAGCAGGGAGGGAGGGAGAGCGG + Intronic
1143150126 17:4802442-4802464 CAGGCGCCAGGGATGGAAAGGGG + Intergenic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1143485766 17:7252659-7252681 AAGTGGGCAGGAAGGGCCAGGGG + Intronic
1143502785 17:7348659-7348681 GCGTGGGCAGGGAGGGTAAGGGG + Intronic
1143612290 17:8025692-8025714 CAGGGGCCAGGGAGGGGAATAGG + Intergenic
1143725803 17:8844814-8844836 GAATGGGGAGGGAGGGAAAGGGG - Intronic
1144059447 17:11569347-11569369 GGGTGGGCTGGTAGGGAAAGAGG + Intergenic
1144387963 17:14767340-14767362 GAGGGGGCAGGGATAGAAAGGGG + Intergenic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144735635 17:17553898-17553920 CAGCGGGGAGGGAGGGCGAGTGG - Intronic
1144945322 17:18966792-18966814 CACTGGGGAGGGAGGCACAGAGG + Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145066032 17:19761998-19762020 CAGAGGGAAGGTAGGCAAAGGGG + Intergenic
1145276616 17:21435214-21435236 CAGTGGGGAGGGAGGCTGAGGGG + Intergenic
1145314457 17:21721102-21721124 CAGTGGGGAGGGAGGCTGAGGGG + Intergenic
1145712912 17:26993079-26993101 CAGTGGGGAGGGAGGCTGAGGGG + Intergenic
1145763250 17:27439988-27440010 CAGGAGGCAGGGAAGAAAAGAGG - Intergenic
1145779290 17:27551768-27551790 CTGGAGGCAGGGAGGGAGAGAGG - Intronic
1145788124 17:27607436-27607458 GAGTGTGCAAGGAGGGAAAGGGG - Intronic
1145861057 17:28210746-28210768 AAGTGGGCAGGGGGAGCAAGGGG - Intergenic
1146086333 17:29833714-29833736 AAGTAGGGAGGGAGGGAAGGAGG - Intronic
1146183865 17:30712497-30712519 CCGTGGGGAGGCAGGGAGAGGGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146575778 17:33989918-33989940 CAGTGGGAAGAAGGGGAAAGAGG + Intronic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1146906538 17:36621747-36621769 CAGGTGGCATGGAGGGCAAGGGG + Intergenic
1147184363 17:38705552-38705574 CAGGGGGGAGGGAGGGAGCGGGG - Exonic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147587398 17:41660290-41660312 CAGTGAGCAGGGAAGGGGAGGGG + Intergenic
1147655488 17:42088404-42088426 CACTGGGCAGGGAGACAAAGGGG - Intergenic
1147728184 17:42579863-42579885 CAGAGGCCAGGGAGTGAAAATGG - Exonic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1147985974 17:44308204-44308226 TAGGGGGCAGGGAGGGGACGGGG + Intergenic
1148231943 17:45941631-45941653 AAGGGGGGAAGGAGGGAAAGAGG - Intronic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1148354728 17:46968267-46968289 CAGTGCGGAGGGAGAGGAAGAGG - Intronic
1148511007 17:48169788-48169810 GAAGGAGCAGGGAGGGAAAGAGG + Intronic
1148603443 17:48910565-48910587 CAGGGGGAGGGGAGGGAGAGAGG - Intronic
1148619267 17:49022391-49022413 CGGGGGGCAGGGAGGCACAGAGG - Intronic
1148721840 17:49759110-49759132 CAGTGGGCTGTGATGGCAAGAGG - Intronic
1148764346 17:50028546-50028568 CAGTGGGCAGGGTGGAGGAGGGG + Intergenic
1148775159 17:50091095-50091117 CAGTGTGCAGGGTCGGGAAGAGG + Intergenic
1148780907 17:50121238-50121260 CAGGAGGCAGGGAGCGAAGGAGG - Intronic
1148789592 17:50165981-50166003 CAGGGGGCAGGGAGGAGAGGAGG - Intronic
1148995712 17:51707642-51707664 AGGTGTGCAGGGAAGGAAAGTGG + Intronic
1149537456 17:57443640-57443662 CAGGGGGCAGGGAGGAGATGGGG - Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149866972 17:60156539-60156561 CACTGAGCAGGGAGAGAAGGTGG - Exonic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150620537 17:66804483-66804505 GAGTGAGCAGGGAGGGATTGGGG + Exonic
1151228458 17:72664365-72664387 CAGAAGGCAGGGAGGGAAAGTGG + Intronic
1151317803 17:73334835-73334857 TGGTGGGCAGGAAGGTAAAGGGG - Exonic
1151412581 17:73941063-73941085 CAATGGGAAGAGGGGGAAAGGGG + Intergenic
1151441502 17:74132305-74132327 TTGTGAGGAGGGAGGGAAAGAGG + Intergenic
1151664161 17:75535907-75535929 CAGTGAGGAGGGAAGGAAACAGG + Intronic
1151698642 17:75731015-75731037 AAGTGGGCAGGGTGGGCAAGAGG + Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152026781 17:77815102-77815124 AAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1152207449 17:78981699-78981721 CAGGGGACAGGCAGGGGAAGGGG + Intergenic
1152241794 17:79164795-79164817 CAGCGGGCTGGGAGGGCCAGGGG + Intronic
1152408267 17:80109553-80109575 CAGAAGGCAGGGATGGAAACAGG - Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152636277 17:81431779-81431801 CAGAGGGCAGGGAGGGGATGAGG - Intronic
1152638354 17:81439378-81439400 TTGGGGGCAGGGAGGGATAGAGG + Intronic
1152740884 17:82017859-82017881 AGGTGGGCAGGGCGGGGAAGGGG + Intergenic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1153030771 18:711421-711443 CAGTAGGGAGGGAAGGAAATGGG - Intronic
1153248423 18:3096119-3096141 CAGTGGGCACGGAGCAAATGTGG + Intronic
1153321091 18:3774925-3774947 CAGTAGGCAGGGAGTGCAGGAGG - Intronic
1153335388 18:3918704-3918726 TCGTGGGCAGGAAGAGAAAGTGG + Intronic
1153504179 18:5779140-5779162 CTGAGGGCTGGGAGGGATAGTGG + Intergenic
1153599114 18:6761636-6761658 CAGTGGTCAGTGAGGGAATTGGG + Intronic
1153605134 18:6825597-6825619 GAGGGGGGAGGTAGGGAAAGAGG - Intronic
1153806973 18:8717455-8717477 TCGTGGGCAGGGAGGGAGTGTGG + Intronic
1154063025 18:11081372-11081394 CAGTGGGCAGCCAGGAGAAGAGG + Intronic
1154299516 18:13180935-13180957 AAGTGGGCTGGAGGGGAAAGAGG - Intergenic
1154383523 18:13873066-13873088 CAGTGTGGAGGGCTGGAAAGGGG + Intergenic
1154508694 18:15069859-15069881 AGGTGGGCTGGGAGGGAAAGGGG - Intergenic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155068062 18:22285659-22285681 GAGTGGGAAGTGAGGGGAAGGGG + Intergenic
1155095336 18:22549856-22549878 ATGTGGGAAGGGAGGGAGAGAGG + Intergenic
1155352139 18:24917402-24917424 AGGGAGGCAGGGAGGGAAAGGGG + Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1156637469 18:39048887-39048909 CAGGAGGCAGGAAGGGAATGAGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157190937 18:45581046-45581068 CATGGGGAAGGGAGGGAATGTGG + Intronic
1157337255 18:46750520-46750542 CAGTGGGCAGGGAGTGAGTGGGG - Intronic
1157464172 18:47930440-47930462 GAGGGGGCTGGGAGGGGAAGAGG + Exonic
1157490535 18:48120703-48120725 CACTGGGGGAGGAGGGAAAGTGG + Intronic
1157593247 18:48848642-48848664 CACCCTGCAGGGAGGGAAAGGGG - Intronic
1157604537 18:48917609-48917631 CAGCGGGCACGGAGGTAACGTGG - Intergenic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1158801466 18:60915351-60915373 AAGTGGGCTGGAGGGGAAAGAGG - Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159623518 18:70667343-70667365 GAGGGGGAAGGGAGGGGAAGGGG - Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160191093 18:76714476-76714498 CACTGAGCAGGGAGGGGAAGCGG + Intergenic
1160465058 18:79069378-79069400 AAGTGGGAGGGGCGGGAAAGGGG + Exonic
1160894065 19:1394657-1394679 CAGTCCGCAGGGAGGGAGGGAGG - Intronic
1160974663 19:1786949-1786971 CAGTGGGCAGGGAGAGGTACTGG + Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161241310 19:3225218-3225240 AGGTGGGGAGGGAGGGAGAGGGG - Intronic
1161251180 19:3281164-3281186 CGGCGAGCAGGGAGGGAAACGGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161323917 19:3653862-3653884 CTGTGGGCAGGCAGGGAGTGTGG - Intronic
1161522226 19:4731017-4731039 GAGAGGGCAGGGAGGGGATGGGG - Intergenic
1161995852 19:7710794-7710816 AAGGAGGCAGGGAGGGAAGGAGG - Intergenic
1162297854 19:9825822-9825844 AAGTGGGCTGGAGGGGAAAGAGG - Intronic
1162310075 19:9900996-9901018 GAGGGGGGAGGGAGGGAAGGAGG + Intronic
1162322875 19:9980078-9980100 GAGTGGGCAGGGAGGCAGGGGGG - Intronic
1162448807 19:10741917-10741939 AAGAAGGGAGGGAGGGAAAGAGG - Intronic
1162671289 19:12259935-12259957 AAGAGGACAGGGAGGGAAGGTGG - Intronic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1162947837 19:14054512-14054534 GAGGTGGCAGGGAGGGAGAGAGG - Exonic
1163677559 19:18662946-18662968 AGGAGGGCAGGGAAGGAAAGGGG - Intronic
1164096244 19:22012320-22012342 CAGTGGGAAGGGTGGGAGAGGGG - Intergenic
1164115749 19:22217146-22217168 CAGTGGGAAGGGTAGGAGAGGGG - Intergenic
1164199465 19:23004641-23004663 CAGTGGGAAGGGTGGGAGAGGGG - Intergenic
1164430818 19:28187187-28187209 GAGTTGATAGGGAGGGAAAGGGG - Intergenic
1164618842 19:29681928-29681950 CAGCAGGCAGGGAAGGAATGGGG + Intergenic
1164827993 19:31298304-31298326 CAGTGGGCTGGGTAGGCAAGGGG + Intronic
1165123941 19:33580931-33580953 GACTGGGCAGGGTGGGGAAGTGG + Intergenic
1165158174 19:33800560-33800582 CACTGGGGAAGAAGGGAAAGAGG - Intronic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1165584804 19:36904869-36904891 AAGTTGGTAGGGAGGAAAAGTGG + Intronic
1165767313 19:38359602-38359624 GGGTGGGCAGAGAGGGAACGGGG - Intronic
1165767742 19:38361558-38361580 AAGTGGGTGGGGTGGGAAAGAGG + Intronic
1166108906 19:40611096-40611118 CAGAGGTCAGGGAGGCAGAGGGG + Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166347022 19:42172847-42172869 CAGGGGGCAGGGAGGAAGTGGGG + Intronic
1166380334 19:42352284-42352306 CAGCGGGCAGGGAGGGCCACGGG - Exonic
1166661314 19:44649116-44649138 GAGAGGGCAGGGCTGGAAAGGGG - Intronic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1167019044 19:46860975-46860997 CGGGGGGCGGGGAGGGGAAGGGG - Intergenic
1167236906 19:48320845-48320867 CAGCGGCCAGGGAGGGACTGAGG + Intronic
1167760386 19:51443481-51443503 CATTATGCAGGGATGGAAAGTGG - Intergenic
1168057747 19:53872865-53872887 CCTTGGGGAGGGAGGGAAAGAGG + Intronic
1168145557 19:54418646-54418668 CAGTGAGCAGGGAGGAGAGGGGG + Intronic
1168183694 19:54682633-54682655 CTGTGAGCAGGGAAGAAAAGAGG + Intronic
1168311855 19:55464613-55464635 CTGTGAGCAGGGAGGGGCAGGGG + Intergenic
925059625 2:880888-880910 CTGAGGCCAGGGAAGGAAAGCGG - Intergenic
925263534 2:2548116-2548138 CAGTGGGCAGGGACAGAGACAGG - Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925421614 2:3717447-3717469 GGGTGGGCAGGGAGGGACTGGGG - Intronic
925507607 2:4585333-4585355 GAGAGGGGAGGGAGGGAGAGAGG - Intergenic
925908971 2:8559166-8559188 CTGTGGGCTAGGAGAGAAAGTGG + Intergenic
925913769 2:8589713-8589735 GAGAGGGGAGGGAAGGAAAGGGG + Intergenic
926060794 2:9803464-9803486 CAGGGGGCAGGTGGGGAGAGAGG - Intergenic
926147244 2:10404303-10404325 CAGTGTGCTGGGAGGCAAAAGGG - Intronic
926736722 2:16079026-16079048 CAGAGGACATGCAGGGAAAGGGG - Intergenic
927415722 2:22878514-22878536 AATTGGGCAGGGAGGGGATGAGG + Intergenic
927496723 2:23556110-23556132 CAGGGAGCAGAGAGGGGAAGTGG - Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927712881 2:25336611-25336633 CAGCAGGGAGGGAGGGGAAGGGG - Intronic
927861949 2:26565550-26565572 CATTTAGCAGGGAGGGAATGGGG + Intronic
928176422 2:29037115-29037137 TGATGGGCAGGGAGGGAAAGTGG + Intronic
928545602 2:32326630-32326652 AACTGGGGAGGGAGGGTAAGGGG + Intergenic
928875899 2:36039109-36039131 CAGTGAGCAGGCAGGAAAAGAGG - Intergenic
929304848 2:40349333-40349355 GAGTGGGCAGGAAGAGAAAGAGG + Intronic
929370227 2:41214476-41214498 CAGGGGGAAGGGTGGGAGAGTGG - Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
930311876 2:49752370-49752392 AAGAGGGGAGAGAGGGAAAGAGG + Intergenic
930547978 2:52793875-52793897 CAGTGGGGAGAGATGGAATGAGG + Intergenic
930596661 2:53398024-53398046 TAGTGGGCAGTAGGGGAAAGAGG - Intergenic
930601748 2:53451818-53451840 AAGGGGGCAGGGAGGGAACGGGG - Intergenic
931243612 2:60474978-60475000 CATTTGGAAGGGAGGGAGAGAGG + Intronic
932011203 2:67979062-67979084 CAATGTGCAGGGTGTGAAAGTGG + Intergenic
932086727 2:68769199-68769221 CAGAGGGGAGGGATGAAAAGAGG - Intronic
932278562 2:70470175-70470197 AAGAGGGGAGGGAGGGAAACAGG + Intronic
932398954 2:71466584-71466606 CGGCGGGCGGGGAGGGACAGGGG - Intronic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932481384 2:72041606-72041628 AAGAGGGCAGAGAGGGAGAGAGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933409495 2:81907502-81907524 AAGTGGGCTGGGTGGGAGAGGGG - Intergenic
933721091 2:85398246-85398268 CAGTGGGCAGCGAGGCACAGTGG - Intronic
933763951 2:85694736-85694758 CAGGGGCTTGGGAGGGAAAGGGG - Intronic
933821379 2:86115339-86115361 CAGTGTGCAGGGAGGTGCAGTGG - Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934046930 2:88180026-88180048 CAGCGGGCTGGCAGGCAAAGAGG + Intronic
934660416 2:96140530-96140552 CAGTGCACAGGGACGGAAAGTGG + Intergenic
934767042 2:96885476-96885498 CTGAGGACAGGGAGGGAATGTGG + Intronic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
935085237 2:99838398-99838420 CAGTGAGGAGGAAGGGAGAGTGG - Intronic
935148682 2:100414220-100414242 GAGTGGGCAAGCAGGGACAGGGG + Intronic
935210861 2:100938554-100938576 AAGGGGGGAGGGAGGGAAGGAGG - Intronic
935591250 2:104847158-104847180 CAGTGGGGAGGCAGGGAGTGTGG + Intergenic
935996763 2:108782508-108782530 CATCTGGCAGGGAGGGAAAGGGG - Exonic
936509928 2:113137179-113137201 CAGAGGGGAAGGAGGGCAAGAGG + Intergenic
936728574 2:115354321-115354343 GAGGGGGTAGGGAGGGAATGTGG - Intronic
936751762 2:115650824-115650846 GAGTGGGGAGGGATGAAAAGAGG + Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937081633 2:119144564-119144586 CAGTGGGCAGGGAAGAAACAAGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937318150 2:120945062-120945084 CACTAGGGAGGGAGGGAAAGAGG + Intronic
937409962 2:121665911-121665933 CAGTGGGGAGGGAAGAAAATGGG - Intergenic
937737284 2:125307256-125307278 GAGAGGGAAGGGAGGGAGAGAGG + Intergenic
937837256 2:126484186-126484208 CAGTGGGGAGGGTGGGACAAAGG - Intergenic
937895571 2:126974661-126974683 TAAGGGGCTGGGAGGGAAAGGGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938698801 2:133858401-133858423 GAGAGGGGAGAGAGGGAAAGAGG + Intergenic
938716574 2:134027360-134027382 GACTGGGCAGGGTGGGGAAGGGG + Intergenic
938730505 2:134143386-134143408 AAGTGGGCAGGGAGTGAAGTGGG + Intronic
939254358 2:139723266-139723288 AAGTGGGCTAGAAGGGAAAGAGG - Intergenic
939500139 2:142974242-142974264 AAGTGGGCTGGAGGGGAAAGAGG + Intronic
940262580 2:151797432-151797454 CAATTGGCAGGGATGGAGAGGGG + Intronic
940384746 2:153057809-153057831 TAGTGGGGAGGGAGGGCATGGGG - Intergenic
940659011 2:156523546-156523568 TAGTGGGGAGTGGGGGAAAGGGG - Intronic
940781783 2:157941001-157941023 TAGTGGCCAGGAAGGGAAATGGG - Intronic
941635645 2:167932393-167932415 CAGTGGACTGGAAGGGAAAGAGG - Intergenic
941961773 2:171261102-171261124 AAGTAGGCAGGAGGGGAAAGGGG - Intergenic
942461475 2:176171496-176171518 TCCTGGGCAGGGAGGGAGAGAGG - Exonic
942635660 2:178002059-178002081 GAGGGGGAAGGGAGGGAGAGGGG - Intronic
943281035 2:185933154-185933176 CAGGGGGAAGGGAGGGAGTGGGG + Intergenic
943654783 2:190496905-190496927 CAGGGGAAAGGGTGGGAAAGGGG + Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944260130 2:197667948-197667970 CAGTGGGCTGGGTGGGTAGGAGG + Intronic
944636363 2:201679426-201679448 CAGAGAGCAGGGTGGGGAAGGGG - Intronic
944731713 2:202524034-202524056 GAGTGGGGAGAGAGGGAGAGGGG + Intronic
944778981 2:202998224-202998246 GAGTGGGGAGGGTGGGATAGGGG - Intronic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945239401 2:207662377-207662399 CAGAGGGCAGAAAGGGAAAAGGG - Intergenic
945958061 2:216104890-216104912 GAGTGGGGAGAGAGGGAGAGAGG + Intergenic
945984064 2:216340259-216340281 GAGTGGGCTGGGAGGGAGTGGGG + Intronic
946332169 2:219016620-219016642 TAGAGGGCTGGAAGGGAAAGGGG - Intronic
946382023 2:219355244-219355266 GGGTGGCCAGGGAGGGAGAGAGG - Intergenic
946408327 2:219504416-219504438 GAGTGGGCAGGCAGTGACAGAGG - Intronic
946419902 2:219558815-219558837 CAGAGGCAAGGCAGGGAAAGGGG - Intronic
946519081 2:220446615-220446637 AAGGGGGCAGGGAGGGAGGGGGG - Intergenic
946519131 2:220446721-220446743 AAGGGGGAAGGGAGTGAAAGGGG - Intergenic
946918618 2:224553700-224553722 CACAGGGCAGGGAGGGAGAGAGG - Intronic
946973657 2:225123238-225123260 CAGGAGGGAGGGAGGGAGAGAGG - Intergenic
947291468 2:228580057-228580079 CAGTGAGAAGGGATGGAATGTGG + Intergenic
947817093 2:233044884-233044906 CATTTGGCAGGAATGGAAAGGGG + Intergenic
947843744 2:233227013-233227035 CAATGGACAGGGAGGAAGAGGGG + Intronic
947873408 2:233452452-233452474 CAGAGGGAAGGGATGGCAAGAGG - Intronic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948087737 2:235265558-235265580 CAAAGGGCAGGAAGGGAGAGGGG + Intergenic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948431786 2:237923379-237923401 CAGGGGGCTGGGAGGAAAGGAGG - Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948707739 2:239805526-239805548 AAGGGGGCAGCGAGGGAAATTGG + Intergenic
948761888 2:240197414-240197436 CAGCTGGCAGGGAGGGACAGAGG - Intergenic
948773436 2:240265426-240265448 GAGTGGGGAGAGAGGGAAAGAGG - Intergenic
948800178 2:240429923-240429945 GAGTGTCCAGGGAGGGAAGGAGG - Intergenic
948864030 2:240766402-240766424 CACTGGGCAGGCAGGGGAAACGG + Intronic
948871948 2:240805098-240805120 GAGAGGGGAGGGAGGGAGAGGGG + Intronic
949033825 2:241807601-241807623 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
949033941 2:241807882-241807904 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
1168771132 20:417687-417709 GAGTGGGAAGGGAGGGCCAGAGG - Intronic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1169624854 20:7554212-7554234 CAGAGGGAAGGGATGGGAAGGGG - Intergenic
1169755948 20:9043392-9043414 AAGTGGGCTGGAAGGGAAAGAGG + Intergenic
1170019978 20:11826590-11826612 AAGCGGGGAGGGAGGGAGAGAGG + Intergenic
1170096337 20:12649655-12649677 CGGGGGGAAGGGAGAGAAAGAGG + Intergenic
1170268606 20:14498957-14498979 CAGTCAGCAGGGAGGGACTGAGG + Intronic
1170299931 20:14872244-14872266 TAGTTGGCAGAAAGGGAAAGAGG + Intronic
1171038773 20:21740321-21740343 CAGTTAGCATTGAGGGAAAGTGG - Intergenic
1171406783 20:24917149-24917171 AGGTGGGCAGGGATGGAAGGTGG - Intergenic
1171435586 20:25120585-25120607 CAGGGGGCAGGGGTGGAATGGGG + Intergenic
1171448095 20:25218724-25218746 CAGTGGGGTGGGAGGGGCAGAGG - Intronic
1171798105 20:29582134-29582156 CAGTGGTCAGGCAGGGAGTGGGG - Intergenic
1172021734 20:31919661-31919683 GAGAGGGAAGGGAGGGGAAGGGG - Intronic
1172088019 20:32404156-32404178 AAGGGGGCAGGGAGATAAAGAGG - Intronic
1172094046 20:32452121-32452143 CAGAGGCCAGTGATGGAAAGGGG - Intronic
1172317812 20:33969987-33970009 AAATTGTCAGGGAGGGAAAGTGG + Intergenic
1172520017 20:35560249-35560271 CCGTGGGCAGGTAGTCAAAGCGG + Intergenic
1172777350 20:37415312-37415334 ACGTGGGCGGGGAGGGGAAGCGG - Intergenic
1172992761 20:39048425-39048447 CACAGGGAAGGGAGGGGAAGTGG - Intergenic
1173219038 20:41116140-41116162 AAGTGGGAAGTTAGGGAAAGAGG - Intronic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173583664 20:44165672-44165694 TAGAGTGCAGTGAGGGAAAGGGG - Intronic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1173870877 20:46341473-46341495 GAGTGGGCAGGGAGGGACGGGGG - Intergenic
1174088321 20:48026374-48026396 CAAAGGGAAGGGAAGGAAAGGGG - Intergenic
1174178441 20:48659333-48659355 AAGGAGGAAGGGAGGGAAAGAGG + Intronic
1174296695 20:49550366-49550388 AAGTGGGCTGGAGGGGAAAGAGG - Intronic
1174350954 20:49967615-49967637 GGGGAGGCAGGGAGGGAAAGGGG - Intergenic
1174704847 20:52644793-52644815 CAGGGGGCTGGGAATGAAAGAGG + Intergenic
1175283493 20:57820987-57821009 CAGAGGGCAGGGGTGGAAGGGGG + Intergenic
1175960760 20:62635177-62635199 CAGTGGGGAGGGAGGGACACAGG - Intergenic
1176075071 20:63244644-63244666 CAGGGGTCAGGCAGGGAGAGGGG + Intronic
1176118559 20:63444007-63444029 CAGCGTCCAGGGAGGGAGAGGGG + Intronic
1176148967 20:63579201-63579223 CAGAGGCCAGGCAGGGAGAGAGG - Intergenic
1176212783 20:63933190-63933212 CAGCAGGCAGGCAGGGAAGGGGG - Exonic
1176419266 21:6500754-6500776 AAGTGGGCTGGAGGGGAAAGCGG + Intergenic
1176661264 21:9637224-9637246 GGGAGGGAAGGGAGGGAAAGGGG - Intergenic
1176715612 21:10346862-10346884 GAGTGGGTGGGGAGGGCAAGAGG - Intergenic
1176902860 21:14464524-14464546 CAGTGGGGAGGAAGGGGAAGGGG + Intergenic
1177988540 21:28010053-28010075 AGGTGGGCTGGGAGGGAAAGGGG + Intergenic
1178104604 21:29303924-29303946 CAGTGGGCATGCAGTGAAATTGG + Intronic
1178981294 21:37267382-37267404 CTGCCGGCAGAGAGGGAAAGGGG - Exonic
1179049799 21:37879439-37879461 CAGTGGGCAGAGTGGTAAGGGGG + Intronic
1179181134 21:39046259-39046281 CCAGGGGCTGGGAGGGAAAGGGG - Intergenic
1179455210 21:41494500-41494522 CAGTGGGCTGTGCGGGATAGGGG + Exonic
1179471383 21:41612995-41613017 CAGAGGGCAGGGAAGGAATCTGG - Intergenic
1179694759 21:43109076-43109098 AAGTGGGCTGGAGGGGAAAGCGG + Intergenic
1180073344 21:45449585-45449607 CACTGAGCAGCGGGGGAAAGAGG + Intronic
1181033712 22:20160093-20160115 CTGGGGGCAGGCAGGGCAAGTGG + Intergenic
1181341164 22:22181415-22181437 CAGAGGGCAGGGCAGGTAAGGGG - Intergenic
1181509598 22:23383152-23383174 CTGGGGGCAGGCAGGGCAAGTGG - Intergenic
1181680678 22:24494405-24494427 CAGAGGGCAGGGCTGAAAAGGGG + Intronic
1181736085 22:24882664-24882686 CAGAGGGTAGGAAGGGAAGGAGG - Intronic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1182000369 22:26914909-26914931 CAGTGGGCACGCATGGAGAGGGG + Intergenic
1182031594 22:27163289-27163311 AAAAGGGAAGGGAGGGAAAGGGG + Intergenic
1182050698 22:27310593-27310615 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182050708 22:27310612-27310634 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182356215 22:29723293-29723315 CAGTTGGCAGGGTAGGAATGTGG + Intronic
1182676239 22:32042130-32042152 CAGTGGGCAGGGAGGGCCTGAGG + Intergenic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183064181 22:35352421-35352443 CAGGGGGCAGGGAGTGGAGGCGG - Intergenic
1183101427 22:35586387-35586409 CAGGGGCCAGGCAGTGAAAGAGG - Intergenic
1183174843 22:36215607-36215629 CAGTGGGCAGGAGGAGAAAGAGG - Intergenic
1183259058 22:36782543-36782565 AAGGGGGCAGTGAGGGAAGGCGG - Intergenic
1183305956 22:37083354-37083376 GAGTGGGGAGGGTGGGCAAGGGG - Intronic
1183354363 22:37350533-37350555 CGGTGGGGAGGCAGGGAAAGAGG - Intergenic
1183375654 22:37463413-37463435 ACGTGGGGAGGGAGGGAGAGAGG + Intergenic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1184000175 22:41667527-41667549 TAGTCGGCAGGGAGAGGAAGTGG - Intergenic
1184096162 22:42317641-42317663 CTGGGGGCTGGGGGGGAAAGGGG + Intronic
1184105088 22:42362798-42362820 CAGAGCACAGGGAGGGAGAGGGG + Intergenic
1184212477 22:43044045-43044067 AAGTGGGCTGGGAGGAGAAGGGG - Intronic
1184248535 22:43247753-43247775 CAGCGGGCAGGGTGGCAGAGGGG + Intronic
1184273770 22:43399098-43399120 GAGTGGACAGGGAGAGATAGAGG - Intergenic
1184281668 22:43440933-43440955 CAGTGGGCAGGAGGGGAATGAGG - Intronic
1184331289 22:43829545-43829567 CAGGCAGCAGGAAGGGAAAGAGG - Intronic
1184340145 22:43881525-43881547 CAGAGGGCAGGGATGGAGAGGGG - Intronic
1184889086 22:47368615-47368637 TGGCGGGCATGGAGGGAAAGGGG - Intergenic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
1185011734 22:48318389-48318411 CAGTCCACAGGGATGGAAAGTGG - Intergenic
1185031126 22:48443557-48443579 AAGGGGGCAGGGAGGGAGGGAGG + Intergenic
1185073382 22:48669385-48669407 CAGTGGGCTGGGCTTGAAAGGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185242103 22:49752147-49752169 CAGGGGGCAGGGTTGGAAAGAGG + Intergenic
1185279444 22:49963693-49963715 CAGTGGGGAGGCAGGGGAGGGGG + Exonic
949501563 3:4684977-4684999 TGGCGGGCAGGGAGGCAAAGGGG - Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950128683 3:10527201-10527223 CCATGTTCAGGGAGGGAAAGGGG + Intronic
950522678 3:13505918-13505940 CAGGGGCTGGGGAGGGAAAGTGG + Exonic
950569160 3:13789350-13789372 AAGGAGGCAGGGAGGGGAAGGGG - Intergenic
950698930 3:14726744-14726766 CACTGGGCTGAGAGGGAGAGAGG + Intronic
950758583 3:15199758-15199780 AAGTGGGTAGCGTGGGAAAGAGG + Intergenic
951426582 3:22553076-22553098 CTGTGGGAAGGGAAGGCAAGGGG + Intergenic
951615825 3:24542533-24542555 AAGTAGGAAGGGAGGGAGAGAGG + Intergenic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
951955610 3:28249932-28249954 CAGTGAGCGGGGAGGGATGGGGG + Intronic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952869564 3:37886314-37886336 AAGTGGGTCGGGAGGGAAATGGG - Intronic
952907619 3:38152748-38152770 CAGTGGACATGGAGGGACTGGGG - Intergenic
952946255 3:38479509-38479531 CAGGAGGCAGGGAGGGCTAGGGG - Intronic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
953284695 3:41595276-41595298 CAGTGGGCAGGAAGAGGAAGAGG - Intronic
953387122 3:42512997-42513019 CAGGGTACAGGGAGGGGAAGAGG + Intronic
953405824 3:42659321-42659343 CAGTGAGCAGGAAGAGGAAGAGG + Exonic
953533345 3:43757677-43757699 CAGTGGGCTGGTGGCGAAAGAGG - Intergenic
953806852 3:46077927-46077949 GAGTGGGGAGAGAAGGAAAGGGG + Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954619137 3:51985829-51985851 CTGGGGGCAGGGATGGGAAGAGG - Intronic
955045417 3:55354938-55354960 CAGCAGGCAGGAAGGGGAAGGGG - Intergenic
955162294 3:56476117-56476139 CTGTGGCCAAGGAGGAAAAGTGG - Intergenic
955598671 3:60620639-60620661 CAGAGGAGGGGGAGGGAAAGAGG + Intronic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
955740662 3:62088094-62088116 AAGTGGGGAGGGAGGGAATGGGG + Intronic
955832640 3:63020593-63020615 AAATGGGAAGAGAGGGAAAGAGG + Intergenic
956293273 3:67684273-67684295 CATTTGCCAGGGAGGGAAATAGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956756532 3:72393406-72393428 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
956963053 3:74425229-74425251 CAGTGGGGAGGAAGGGAGAGGGG - Intronic
957021715 3:75135577-75135599 CAGTGGGCATGGAAAGAACGTGG - Intergenic
957442610 3:80269728-80269750 CAGTGGGGAGGGCAAGAAAGAGG + Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
958602499 3:96315392-96315414 CAGTGGGCAACTAGGGGAAGGGG - Intergenic
958904984 3:99932172-99932194 GAGTGGGAAGGGAGGAGAAGGGG - Intronic
958993362 3:100873419-100873441 TCCAGGGCAGGGAGGGAAAGGGG + Intronic
959097954 3:101976169-101976191 TAGTGGGGAGAGAGGGAATGGGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959537641 3:107504740-107504762 CATGGGGCAGAGAGGGAAAATGG + Intergenic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
960149038 3:114232385-114232407 CAGTGGCTAGGGTGGGCAAGAGG - Intergenic
960231674 3:115235273-115235295 CAGTGGCCAAGGAGAGAAAGGGG + Intergenic
960923665 3:122774637-122774659 GTGTGGGAAGGGAGGGCAAGGGG + Intronic
960994360 3:123331189-123331211 CATTGGGGAGGGAGGGATTGTGG + Intronic
961032610 3:123619522-123619544 CACCAGGCAGGGAGGGACAGAGG + Intronic
961083027 3:124042699-124042721 CTGTGGGGAGGCAGGGGAAGAGG + Intergenic
961549770 3:127662356-127662378 CAGTGGACAGGGTGGGGCAGAGG + Intronic
961635224 3:128329026-128329048 CAGTGAGCAAGGAGGGTGAGAGG - Intronic
961750150 3:129089741-129089763 CAGAGGGCAGGGAGGCATGGGGG + Exonic
962120771 3:132557685-132557707 CAGATGGCAGGGAGGGAGCGGGG - Intergenic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962231829 3:133672725-133672747 AAGAGGGAAGGGAGGGGAAGGGG + Intergenic
962311144 3:134327619-134327641 CAGTGGGAAGGAAGAGGAAGAGG + Intergenic
962991057 3:140577895-140577917 CAGTGGGCTTTGGGGGAAAGGGG - Intergenic
963065879 3:141264169-141264191 CAGTGGGAAAAGAGGAAAAGAGG + Intronic
963892966 3:150656515-150656537 GAGTGGGTAGTAAGGGAAAGAGG + Intergenic
964413699 3:156425919-156425941 AAGTGGAGAGGGAGGGCAAGAGG + Intronic
964527620 3:157631844-157631866 CAGCTGGAAGGGAGGAAAAGAGG - Intronic
964731576 3:159872388-159872410 CAAAGGGCAGGCATGGAAAGGGG - Intronic
964852351 3:161108441-161108463 CATTTGGCAGGTAGGGAAACTGG + Intronic
964914647 3:161825709-161825731 GAGAGGGAAGGGAGGGAAAGAGG - Intergenic
965186901 3:165476518-165476540 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965186953 3:165476684-165476706 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965421023 3:168458371-168458393 GGGAGGGAAGGGAGGGAAAGAGG - Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
966076249 3:175938687-175938709 CAGTAGGAAGAGAGAGAAAGAGG - Intergenic
966488068 3:180493244-180493266 CAGAAGGCAGTGAGGGAATGAGG - Intergenic
967183873 3:186929645-186929667 CTGTGTGCTGGGTGGGAAAGGGG - Intergenic
967210622 3:187165036-187165058 GAGCGGGGAGGGAGGGACAGCGG + Intronic
967248398 3:187512522-187512544 CAGAGGGCAGAGAGGGAAAGAGG + Intergenic
967314322 3:188136785-188136807 CAGAGGGCAGGAAGGGGAACAGG + Intergenic
967839657 3:193995105-193995127 CAGTGGGCAGTGAGAGGGAGAGG - Intergenic
967966161 3:194961572-194961594 CAGTTGGCAAAAAGGGAAAGAGG + Intergenic
968298145 3:197593055-197593077 CAGAGGGCAGGGAAGGAGAAGGG + Intergenic
968478199 4:822410-822432 CAGAGGGGAGAGAGAGAAAGAGG - Intronic
968612268 4:1562708-1562730 CAGTGGTCAGGAAGGGAACCTGG + Intergenic
968659609 4:1793633-1793655 CAGCAGCCAGGGAGGGAAGGGGG + Intronic
968662210 4:1803345-1803367 CAGCGGGCAGGGGTGGAGAGAGG - Intronic
968717972 4:2175852-2175874 CAGAGGCCAGGGAGGGCAAAGGG - Intronic
968719598 4:2191319-2191341 CAGAGGTCAGGAAGGGTAAGGGG + Intronic
968920419 4:3519434-3519456 AAGGGGGCAGAGAGGGAGAGAGG - Intronic
968978436 4:3834040-3834062 CAGGGGGCAGGGAGAGCATGAGG - Intergenic
968981664 4:3853475-3853497 CAGGGCTCAGGCAGGGAAAGTGG + Intergenic
969419267 4:7082112-7082134 CAGAAGGGAGGGAGGGCAAGGGG - Intergenic
969483667 4:7459889-7459911 CAATTGGTAGGGAGGGAGAGAGG + Intronic
969496834 4:7531030-7531052 CAGAGTCCAGAGAGGGAAAGAGG + Intronic
969620698 4:8277377-8277399 CAGTGGGCAGGAAGCAAATGAGG - Intronic
969690209 4:8699989-8700011 CAGTGAGGAGGGAGGGAGACGGG - Intergenic
969703204 4:8779025-8779047 CAGAGGTCAGGGAGGGCACGGGG - Intergenic
969816715 4:9692520-9692542 GAGTGAGCAGGGTGGGCAAGAGG + Intergenic
969970273 4:11039878-11039900 CAGTGGGCAGGGTGAGGAAGTGG - Intergenic
970001119 4:11367075-11367097 AAGGAGGCAGGGAGGGAAGGAGG + Intergenic
970298752 4:14659719-14659741 CAGTGAGTAGGGGGCGAAAGTGG - Intergenic
970918641 4:21366804-21366826 GAGAGGGGAGGGAGGGAGAGAGG + Intronic
970993220 4:22236744-22236766 CAGTGAGCAAGAAGGGGAAGAGG - Intergenic
971260202 4:25050059-25050081 GAGTGGGCAGGGAGGCCGAGGGG + Intergenic
971351961 4:25863053-25863075 CAGAGGGGAGGGAGGGGACGGGG - Intronic
971503183 4:27338519-27338541 CATAGGGCAGGGAGGGAGGGAGG + Intergenic
972269181 4:37493500-37493522 CAGTGGAGTGGCAGGGAAAGGGG - Intronic
972578670 4:40375609-40375631 AAGTGGGCTGGAGGGGAAAGAGG - Intergenic
973740742 4:53917072-53917094 CAGTGGGCAGAGAGGCAGTGGGG - Intronic
974370535 4:61011767-61011789 CACTGGGCAGTGTCGGAAAGTGG + Intergenic
974855869 4:67459774-67459796 CATTGTGCAGTCAGGGAAAGGGG - Intergenic
975068021 4:70094237-70094259 CATTGGGGAGGGAGGGATATGGG - Intergenic
975363829 4:73504761-73504783 CAGAGGGGTGGGAGGGAGAGGGG - Intergenic
975436116 4:74353803-74353825 AAGTGGGCAGGAAGGGAAAGGGG + Intergenic
975642686 4:76516081-76516103 CAGTAGACCGAGAGGGAAAGTGG + Intronic
975789267 4:77930822-77930844 AAGTGCGCAGTGCGGGAAAGAGG - Intronic
975839509 4:78458544-78458566 CACTGGGGAGGGAGGGAGTGGGG + Intronic
975973763 4:80072709-80072731 CAGCTGACAGGGAGGGAGAGAGG + Intronic
976703816 4:88000968-88000990 GAGGAGGGAGGGAGGGAAAGGGG + Intergenic
978072789 4:104492236-104492258 CTGTGGGGAGGGAGGGAGCGGGG - Intronic
978231771 4:106408459-106408481 CACTGGGCAGTGTCGGAAAGTGG - Intergenic
978490186 4:109303338-109303360 CAGTGGGAAGAGAAGGGAAGTGG - Intergenic
978534269 4:109744485-109744507 CAGGAGGGAGGGAAGGAAAGAGG + Intronic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
980370594 4:131864469-131864491 CTTGGGGCATGGAGGGAAAGGGG + Intergenic
980561782 4:134486793-134486815 GAGTGGGCTGGATGGGAAAGAGG - Intergenic
980568891 4:134584132-134584154 AAGAGGGGAGGGAAGGAAAGAGG - Intergenic
980794471 4:137663164-137663186 CAGTGGGTGGGGAGAGAGAGTGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981086482 4:140689496-140689518 AAGGGGGAAGGGAAGGAAAGGGG - Intronic
981551677 4:145947704-145947726 CAGGGGGCAGGGCAGGGAAGGGG + Intergenic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
982475865 4:155849847-155849869 CAGTAGGCAGGTATGAAAAGTGG - Intronic
982499106 4:156131261-156131283 CAGTGGGAAGGAAGGGGATGAGG - Intergenic
983172308 4:164549806-164549828 AAGTGGGCTGGAGGGGAAAGAGG - Intergenic
983649004 4:170020285-170020307 CTCAGGGCAGGGAAGGAAAGGGG - Intronic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
984853672 4:184175102-184175124 CACTGGGCAAGGAGGGAGAGCGG - Intronic
985414131 4:189719303-189719325 GGGAGGGAAGGGAGGGAAAGGGG + Intergenic
985529033 5:423013-423035 CAGAGGACAGGGAGGGACATGGG - Intronic
985613946 5:908182-908204 CACAGTGCAGGGAGGGATAGAGG - Intronic
985618451 5:938517-938539 CAGGGGGAAGGCAGGGACAGAGG + Intergenic
986106800 5:4667494-4667516 AGGTGGGTAGGGTGGGAAAGGGG + Intergenic
986120382 5:4830215-4830237 AAGAGGGGAGGGAGGGAGAGAGG - Intergenic
986251483 5:6062186-6062208 AGGTGGGCATGGAAGGAAAGGGG - Intergenic
986495076 5:8333213-8333235 GAGTGGGTAGGGAGGGAGTGAGG + Intergenic
987373956 5:17217563-17217585 CACTGGGCAGGAAGGGGAGGGGG + Exonic
987862601 5:23506732-23506754 CACTGGGCAGCGAGGGAGCGAGG + Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988394172 5:30675781-30675803 AAATGGGAAGGGAGGGAAAGTGG + Intergenic
988622347 5:32835976-32835998 AAGTGGGGAGGGAAGGACAGAGG - Intergenic
989415014 5:41164113-41164135 AAGGGGGGAGGGAGGGAGAGAGG + Intronic
989603963 5:43226314-43226336 CAGGAGGCAGGGAAGGACAGAGG + Intronic
990123348 5:52483611-52483633 GAGTGGGCAGTAGGGGAAAGGGG + Intergenic
990413920 5:55567894-55567916 TAGGGGGAAGGGTGGGAAAGGGG - Intergenic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
991091020 5:62694256-62694278 CAGGGGACAGGGTGGGAAAATGG - Intergenic
991126475 5:63075436-63075458 CAGTGGGAAGGGAAGTAGAGGGG - Intergenic
991329754 5:65481625-65481647 GGGTGGGGAGGGAGAGAAAGGGG - Exonic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991958445 5:72018625-72018647 CAATGGGCAGAAGGGGAAAGAGG - Intergenic
992252398 5:74888446-74888468 TAGTGAGCAGGAAGGGAAGGAGG - Intergenic
992617106 5:78555524-78555546 ATGTGGGCAGAGGGGGAAAGAGG + Intronic
993223355 5:85132861-85132883 GAGGGGGAAGGGAGGGAGAGGGG - Intergenic
993521830 5:88912197-88912219 CAGGGGTTAGGGAGGGGAAGGGG + Intergenic
993744607 5:91581461-91581483 CAAAGGGCAAGGAAGGAAAGGGG - Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994122479 5:96132175-96132197 CAGAAGGGAGGGAGGGAAAGAGG + Intergenic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994353820 5:98773818-98773840 GAGGCGGCAGGCAGGGAAAGGGG - Intronic
994815104 5:104576163-104576185 GAGGGGGCAGGGAGAGAGAGAGG - Intergenic
996084173 5:119287034-119287056 CAATGGGCAGTGCAGGAAAGGGG - Intronic
996173488 5:120325335-120325357 GACTGGGAAGGGAAGGAAAGAGG + Intergenic
996583412 5:125057121-125057143 CAGAGGCCAGGGAAGGCAAGTGG - Intergenic
996971016 5:129367799-129367821 CAGGGAGGAGAGAGGGAAAGGGG + Intergenic
997455600 5:134015209-134015231 GAGAGGGGAGGGAGGGAGAGAGG + Intergenic
997746893 5:136307281-136307303 AGGTGGGGAGGGAGGGAATGGGG - Intronic
998601097 5:143586022-143586044 AAGTGAACAGGGAGGGAAGGAGG - Intergenic
999126392 5:149249460-149249482 CAGTGGTCAGGCAGGAAAACAGG - Intronic
999197445 5:149792075-149792097 GAGTGGCCTGGGAGGGAAGGTGG + Intronic
999247207 5:150161548-150161570 CAGAGGCCAGGGAAGGAAAAAGG - Intergenic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999762018 5:154709678-154709700 GAGTGTGCAGTGTGGGAAAGAGG + Intergenic
999916417 5:156267543-156267565 CTGTGCTCAGGGAGGGAAATTGG - Intronic
1000573102 5:162939336-162939358 CAGAGGGCAGGAAGGGAATGGGG + Intergenic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001110813 5:168894654-168894676 CAGTGGGAAGGTAGGCTAAGTGG + Intronic
1001256131 5:170184780-170184802 CTGTGGTCAGTGAGGGACAGGGG - Intergenic
1001281416 5:170389072-170389094 CAGTGGGGAGGGTGGCACAGTGG - Intronic
1001295505 5:170496086-170496108 AAGTGAGCAGGGAGGGGAGGAGG - Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001881336 5:175246790-175246812 AAGCGGGCAGGGAGGGAGAAAGG - Intergenic
1002157973 5:177297790-177297812 CAGGAGGGAGTGAGGGAAAGGGG + Exonic
1002404077 5:179015338-179015360 AAGTGGGCTGGAGGGGAAAGAGG + Intergenic
1002774955 6:320704-320726 CAGTGGGGAGGGAGGGTGAGGGG + Intronic
1003137020 6:3441586-3441608 CAGTGGGCAGGGAAGCCCAGGGG - Intronic
1003173217 6:3736366-3736388 TGGTGGACAGGGAGGGAAGGGGG - Intronic
1003563251 6:7201508-7201530 CAGTGGGGAGGGTGGGATGGGGG - Intronic
1003673479 6:8181413-8181435 GGGAGGGGAGGGAGGGAAAGAGG - Intergenic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1003872214 6:10412452-10412474 GAGGAGGAAGGGAGGGAAAGAGG + Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004074036 6:12329111-12329133 CAGGGGGTAGGGAGTGAGAGTGG - Intergenic
1004280731 6:14277515-14277537 CAGACTGCAGGGAGGCAAAGTGG - Intergenic
1004394966 6:15239632-15239654 CTGTGAGTAGGCAGGGAAAGGGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1005104175 6:22205502-22205524 CAGTGCACAGGAAGGAAAAGAGG - Intergenic
1005264532 6:24097851-24097873 GAGAGGGCAGGGAGGTAAAAGGG + Intergenic
1005310675 6:24556152-24556174 GGGAGGGAAGGGAGGGAAAGAGG - Intronic
1005766129 6:29014079-29014101 CAGTGGGCTGGAAGGGGTAGTGG - Intergenic
1005871112 6:29974998-29975020 CAGGGAGCAGGGAGGGCAACAGG + Intergenic
1005944482 6:30585462-30585484 ACGGGGGCTGGGAGGGAAAGGGG - Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006173750 6:32109713-32109735 CATGGGGGAGGGAGGGGAAGGGG - Intronic
1006176260 6:32123775-32123797 CAGCAGGGAGGGATGGAAAGTGG - Intronic
1006218017 6:32462319-32462341 GAGAGGGAAGGGAGGGACAGAGG + Intergenic
1006340710 6:33445049-33445071 CAGTGGGCAGGGAATGCATGTGG + Intronic
1006372446 6:33653775-33653797 CAGTGGGCAGGGAGTGATTTGGG - Intronic
1006401667 6:33821409-33821431 CATGGGGAAGAGAGGGAAAGCGG - Intergenic
1006744293 6:36330567-36330589 CAGTGGGCAGGGAGAGCCAATGG + Exonic
1006818970 6:36875144-36875166 AATTGGGCAGGGACGGGAAGGGG + Intronic
1006840635 6:37026068-37026090 CTGTGGGCAGAGAGAGGAAGAGG - Intronic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007273774 6:40658603-40658625 CAGAGGGGAGGGAAGGACAGGGG - Intergenic
1007315675 6:40986729-40986751 TGGTAGGCAGGGAGGGACAGAGG + Intergenic
1007343521 6:41209256-41209278 CAGGGAGAAGGGAGGGAAAGAGG - Intergenic
1007702847 6:43774473-43774495 CTGTGGGGAGGAAGGGGAAGGGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1009357147 6:62764839-62764861 AAGTGGGCCGGGCGGGGAAGGGG + Intergenic
1009840987 6:69073830-69073852 CAGTGGCCAGGGTGGTAGAGGGG - Intronic
1009874825 6:69492980-69493002 AAGTGGGCTGGAAGGGAAAAAGG - Intergenic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010221246 6:73451059-73451081 GAGGGGGCAGGGAGGAAGAGGGG + Intronic
1010560712 6:77345493-77345515 TAGTGGGGAGGGGAGGAAAGGGG + Intergenic
1010597180 6:77778152-77778174 GGGTGGGAAGGAAGGGAAAGGGG + Intronic
1010676124 6:78745587-78745609 CAGTGGGCTGGGTGGGTAAATGG + Intergenic
1010771867 6:79841069-79841091 CAATGAGGAGGGAAGGAAAGTGG + Intergenic
1011101572 6:83728169-83728191 CCCTGGGAAGGGAAGGAAAGAGG + Intergenic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011416917 6:87131550-87131572 CACATGGCAGGGAGAGAAAGAGG + Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1012438001 6:99235392-99235414 CTGAGGGCAGGGCGGCAAAGTGG - Intergenic
1013105981 6:107027182-107027204 TAGTTGGTTGGGAGGGAAAGGGG + Intergenic
1013178813 6:107700785-107700807 CACTGGGGAGAGAGGGGAAGGGG - Intergenic
1013308948 6:108875373-108875395 CAGTGTGCAAGGAGGCAAAGAGG - Intronic
1013418498 6:109945709-109945731 TAATGGACAGGGAGGGAGAGGGG + Intergenic
1013880963 6:114900138-114900160 AAGTGTGCAGTGAAGGAAAGAGG - Intergenic
1014436589 6:121427466-121427488 CAGAGGCTTGGGAGGGAAAGAGG + Intergenic
1015765669 6:136713340-136713362 CAGTGGGCAAGGAGTGAGGGTGG + Intronic
1016317735 6:142808618-142808640 AAGTAGGGAGGGAGGGATAGAGG + Intronic
1016390447 6:143569178-143569200 GTGTGGGCTGTGAGGGAAAGAGG + Intronic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016403012 6:143700561-143700583 CAGTGGGGAGGGGGGGCGAGAGG + Intronic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016725092 6:147354930-147354952 CATTGGTCAGGGAGGCAATGGGG + Intronic
1016839464 6:148511834-148511856 CAGTGGGCAGTAAGAGAAATGGG - Intronic
1017785274 6:157751789-157751811 AAGTCTGCAGGGAGGGGAAGTGG + Intronic
1017963922 6:159247219-159247241 GGGTGGGGAGGGAGGGAACGGGG - Intronic
1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG + Intergenic
1018274574 6:162117161-162117183 AAGTGGGAAGGGAGAGAAAGTGG + Intronic
1018531350 6:164766911-164766933 AAGGGTGCAGGGAGAGAAAGGGG - Intergenic
1018801292 6:167224344-167224366 AAGTGAGCAGGAAGGGAAAGAGG - Intergenic
1019009018 6:168826285-168826307 CAGAGCGCAGGGAGGGAGACGGG + Intergenic
1019281874 7:204697-204719 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019281890 7:204768-204790 CTGTGCTCAGGGAGGGAATGTGG + Intronic
1019281902 7:204839-204861 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019290309 7:247021-247043 AAGGAGGCAGGGAGGGAAGGGGG + Intronic
1019313399 7:373710-373732 CAGCTGACAGCGAGGGAAAGTGG + Intergenic
1019351741 7:557183-557205 CAGCAGCCAAGGAGGGAAAGAGG + Intronic
1019368853 7:650374-650396 GAGTGAGCAGGGAGGGAGGGAGG - Intronic
1019419796 7:945723-945745 CTGGGAGGAGGGAGGGAAAGAGG - Intronic
1019704228 7:2489933-2489955 GAGTGGGCAGTGAGGAAACGGGG + Intergenic
1019730587 7:2627413-2627435 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020129813 7:5553427-5553449 CAGTGGGCAGGTGGGGGCAGAGG - Intronic
1020641164 7:10755377-10755399 CAGGGGGCAGGTAGTGAAAAGGG + Intergenic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021540613 7:21753222-21753244 CAGGGGGAAGGAAGGGGAAGAGG + Intronic
1021620746 7:22549480-22549502 CAGTGGGCAAGGAGTGAGACTGG + Intronic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1021888552 7:25164773-25164795 CAGGGGGAAGGTTGGGAAAGGGG - Intronic
1021972370 7:25978084-25978106 AAGTGGGCAGGGAAAGAAAAAGG + Intergenic
1022090002 7:27102004-27102026 GAGTGGGCTGGGAGAGAAGGAGG - Intronic
1022153857 7:27639437-27639459 GAGGGGGGAGGGAGGGACAGAGG + Intronic
1023027297 7:36062238-36062260 CTGGGGACAGGCAGGGAAAGCGG + Intergenic
1023295872 7:38714729-38714751 GAGGGAGCAGGCAGGGAAAGAGG - Intergenic
1023355027 7:39357794-39357816 CAGGTGGCACGGAGGGGAAGGGG + Intronic
1023393608 7:39732892-39732914 CAGTGTGCATGGCGGGAAGGAGG - Intergenic
1023483761 7:40662493-40662515 CAGTGAACAAGGAGGGAGAGAGG - Intronic
1023560457 7:41467979-41468001 GAGTGTGCAGGATGGGAAAGGGG + Intergenic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023898569 7:44455506-44455528 GATTGGGCTTGGAGGGAAAGAGG - Intronic
1024248843 7:47491125-47491147 CAGTGGGCAGAGAGGCAGAGGGG + Intronic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1024476863 7:49821132-49821154 AAGGAAGCAGGGAGGGAAAGAGG + Intronic
1024564938 7:50673210-50673232 CAGAGGCCAGTGAGGGCAAGGGG + Intronic
1024574494 7:50753043-50753065 CAGTGAGCAGCGAAGGACAGTGG + Intronic
1026094064 7:67327489-67327511 CAGGGGTTAGGGAGGGGAAGGGG - Intergenic
1026255651 7:68708981-68709003 GATGGGGCAGGGAGGGAAAGAGG + Intergenic
1026271541 7:68841418-68841440 AAGTGGGCAGGGAGAGAGAGTGG - Intergenic
1026461769 7:70620857-70620879 CAAGGGGCAGGGAGGGAAACTGG + Intronic
1026902129 7:74043198-74043220 CAGAGGGCAGGGAGGGGCAGAGG + Intronic
1026919388 7:74144185-74144207 GAGTGGGCAGGAGGGGAAGGAGG - Intergenic
1027449269 7:78311275-78311297 CAGTGGGGAGGGTGGAAAAGAGG + Intronic
1028210563 7:88069170-88069192 CAGGGAGAAGAGAGGGAAAGAGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029126205 7:98296775-98296797 CAGTGGAGAGGGAGGCAGAGAGG - Intronic
1029197892 7:98819167-98819189 AAGTGGACAGGAAGGGGAAGAGG + Intergenic
1029237298 7:99131727-99131749 CAGTGAAGAGGGAGGAAAAGAGG + Intronic
1029261416 7:99305292-99305314 AAGGTGACAGGGAGGGAAAGAGG - Intergenic
1029557550 7:101280802-101280824 CAGTGAACAGGGAGGAAAGGGGG + Intergenic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030023186 7:105295606-105295628 CAGGGGCCAGGAAGGGAAAATGG + Intronic
1030139908 7:106293738-106293760 CAGTGGGCAGGGTGGGGCGGGGG - Intergenic
1030194626 7:106841458-106841480 CAGAGAGCAGGGAGGCAGAGGGG + Intergenic
1030371724 7:108707632-108707654 CAGAGGGCAGTGAGAGAGAGAGG - Intergenic
1030524586 7:110637680-110637702 CAGTAGGCAGGGAAGGAAAAGGG + Intergenic
1032127489 7:129205470-129205492 CAGAGGGAAGGGGGGCAAAGAGG + Intronic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1032854924 7:135826039-135826061 CAGTGGTATGGGAGGGAGAGAGG - Intergenic
1033053694 7:138030302-138030324 AAGTGGGCTGGAGGGGAAAGAGG - Intronic
1033137722 7:138798624-138798646 CAAGGGGCAGGGAGGGATGGAGG - Intronic
1033306525 7:140230018-140230040 CAGAGGGCAGAGAGGAAGAGAGG - Intergenic
1033357725 7:140614010-140614032 CAGTGAGCAGGAGGGGAAGGAGG - Intronic
1033654335 7:143362734-143362756 CCGTGGGGAGGGATGGAGAGGGG - Exonic
1033911819 7:146273010-146273032 CATTGGGCTGGGAGGGAGTGAGG + Intronic
1033988861 7:147259962-147259984 TTGTGGGGAGGGAGGGATAGTGG - Intronic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034491123 7:151393635-151393657 CAGGGGGTTGGGAGGGGAAGGGG - Intronic
1034520720 7:151617265-151617287 AAGGAGGGAGGGAGGGAAAGAGG + Intronic
1034757388 7:153635523-153635545 GAGGGGGGAGGGAGGGACAGAGG - Intergenic
1034829344 7:154295664-154295686 CTGAGGGTAGGGAGGGGAAGGGG - Intronic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035333639 7:158112358-158112380 CAGTGAGCAGAGAAGGCAAGGGG + Intronic
1035582120 8:747009-747031 CAGTGGCTAGGAAGGGAAATGGG + Intergenic
1035739345 8:1914405-1914427 CAGGGGCCAGGGAGAGAAATCGG - Intronic
1035784958 8:2253042-2253064 TAATGGGCAGGATGGGAAAGGGG - Intergenic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1035807854 8:2468679-2468701 TAATGGGCAGGATGGGAAAGGGG + Intergenic
1036432153 8:8701838-8701860 CGGTGGGCGGGGAGGGAAAGAGG - Intergenic
1036495117 8:9263252-9263274 GAGAGGGGAGGGAGGGAGAGAGG + Intergenic
1036611152 8:10350870-10350892 CAGCTGTCAGGGAGGGGAAGTGG + Intronic
1036693409 8:10959193-10959215 GAGTGGGGAGGGAGGGACACTGG - Intronic
1036733142 8:11284052-11284074 CAGGGGTCAGGGAGGGACACAGG - Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037334683 8:17780564-17780586 TACTGGGGAGAGAGGGAAAGAGG - Intronic
1037497053 8:19450229-19450251 GAGGGGGCAGGGAGGAAGAGGGG + Intronic
1037564463 8:20105852-20105874 ATGTGGGGAGGGAGGGACAGTGG + Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037751272 8:21683914-21683936 TGGTGGGCAGGGAAGGAGAGGGG + Intergenic
1037913933 8:22760627-22760649 CAGAGGCCTGGGAAGGAAAGTGG + Intronic
1038017630 8:23528947-23528969 AGGTGGGCAGGGAGGGGGAGGGG - Exonic
1038156667 8:24998052-24998074 CAGTGGGCAGGCCAGGAAAATGG - Intergenic
1038267169 8:26046180-26046202 TAGTGGGCGGGGAGGGACGGGGG + Intergenic
1038411259 8:27361559-27361581 GACTGGGCAGGGTGGGAAAATGG + Intronic
1038914390 8:32004245-32004267 CAGTGGATGGGGAGGGAAATGGG + Intronic
1039360693 8:36873622-36873644 CAGAGAGCAGGGAGAGAAAAGGG - Intronic
1039419072 8:37420463-37420485 CAGTGGGCAGGCGGGGGAGGGGG - Intergenic
1039473099 8:37826120-37826142 AAGTGAGCGGGGAGGGAAGGGGG + Intronic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040341953 8:46445557-46445579 CAGCAGGCAGAGAGGGAAAGCGG - Intergenic
1040506956 8:48057640-48057662 TTCTGGGGAGGGAGGGAAAGGGG + Intronic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1040899644 8:52404627-52404649 CAGGGGGCAGTGAGGGAAAGAGG - Intronic
1040980128 8:53238489-53238511 CAAGGGGCAGGCCGGGAAAGAGG + Intronic
1041537161 8:58939468-58939490 GAGTGGTCTGGGAGGGAAGGAGG + Exonic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041698675 8:60763894-60763916 CTGTGGTCAGAGAGGAAAAGAGG + Intronic
1041775140 8:61514961-61514983 GGGTGGACAGGGAGGGAAGGAGG + Intronic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042234604 8:66598050-66598072 CATAGGGCAGTGAGGTAAAGTGG - Intronic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043270387 8:78326049-78326071 CACAGTGCAGGGAGGGACAGGGG - Intergenic
1044249662 8:89990995-89991017 AAGTGGTCAGGAAGGGAAAGAGG + Intronic
1044434470 8:92145947-92145969 TTTAGGGCAGGGAGGGAAAGTGG + Intergenic
1044561550 8:93617460-93617482 AAGTGAGAAGGGTGGGAAAGAGG - Intergenic
1044988308 8:97774298-97774320 CAGTGGGCGGGGACCCAAAGGGG + Intergenic
1045060599 8:98407397-98407419 CACTGGACAGGGAGGGAGTGAGG + Intronic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1045557396 8:103227762-103227784 GAGTGGGCAGTAAGGGAAAGAGG - Intronic
1045718278 8:105074482-105074504 CAGTGGACAGAGCAGGAAAGGGG + Intronic
1045812953 8:106245222-106245244 AAGTGTGCAGTGTGGGAAAGAGG - Intergenic
1045831665 8:106469194-106469216 AAGAAGGGAGGGAGGGAAAGAGG - Intronic
1046527534 8:115399646-115399668 AAGAGGGCAGGGAAGGGAAGAGG - Intergenic
1046616028 8:116478287-116478309 CACAGGGCAGAGAGGAAAAGAGG + Intergenic
1046776487 8:118169046-118169068 TAGTGGGGAGGGAAAGAAAGGGG + Intergenic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1047212980 8:122854545-122854567 CAGGGTGGAAGGAGGGAAAGAGG - Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1047750729 8:127878554-127878576 CAGTGGCAGGGAAGGGAAAGAGG - Intergenic
1047879015 8:129171835-129171857 GAGGGAGGAGGGAGGGAAAGAGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1047942139 8:129836523-129836545 GGGAGGGCCGGGAGGGAAAGGGG + Intergenic
1048798407 8:138172865-138172887 GAGTGGGCAGGGAGGGGAATGGG - Intronic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049172383 8:141169604-141169626 CTCTGGGGAGGGAGGGAGAGAGG - Intronic
1049231712 8:141488235-141488257 GAGGGAGCAGGGAGGGAAGGAGG - Intergenic
1049271488 8:141698537-141698559 CTGTGGGCCGGGAGGGTCAGAGG - Intergenic
1049311798 8:141937426-141937448 GGGAGGGCAGGGAAGGAAAGAGG - Intergenic
1049370369 8:142261383-142261405 GAGGGGGGAGGGAGGGATAGTGG + Intronic
1049470825 8:142774353-142774375 TTCTGGGCAGGGAGGGAAAGGGG - Intronic
1049569578 8:143362859-143362881 GAGTGGCCAGGGAGGGGAAGCGG - Intergenic
1049720763 8:144114496-144114518 CGGTGGGCGGGGAGGAAAACTGG - Intronic
1049764891 8:144350580-144350602 CAGGGAGGAGGGAGGGAGAGAGG - Intergenic
1049937818 9:516543-516565 CAGTGGGGAGGGAAGGGGAGCGG + Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052316731 9:27123179-27123201 AAGTGGGAAGGGAGGGAGATGGG + Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052591642 9:30503858-30503880 CAGTGAGCAGTGAGGGCAACAGG - Intergenic
1052760137 9:32581822-32581844 CAGTGGGCAGGGAAGAGATGGGG + Intergenic
1052851555 9:33381376-33381398 AAGTGCTCAGGGAGGGACAGAGG + Intergenic
1052990164 9:34514373-34514395 CACTGGTCGGGGAGGGAACGGGG - Exonic
1053674313 9:40407809-40407831 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054385421 9:64547876-64547898 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054510308 9:65968481-65968503 CAGTGGGAGGAGAGGAAAAGGGG - Intergenic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055335000 9:75224460-75224482 CAGGGGGAAAGGAGGGGAAGGGG - Intergenic
1055343336 9:75308702-75308724 CAGTGGGGAGGGATGGAACAGGG + Intergenic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1055519867 9:77070192-77070214 CACTTGGCAGGGCGGGGAAGGGG - Intergenic
1055743057 9:79411081-79411103 TACTGGGGAGGAAGGGAAAGTGG + Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1055965217 9:81859332-81859354 AAGTGGGGAGGGAGGGGAGGGGG + Intergenic
1056580667 9:87886509-87886531 CAGAAGGCTGGGAGGGCAAGAGG - Exonic
1056615249 9:88160057-88160079 CAGAGGGCAGGGAGGGCCTGTGG + Intergenic
1057212001 9:93205510-93205532 CAGGGTGCAGGGACGGACAGGGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057310096 9:93937354-93937376 AAGTGTGCAGGGAGGGAGGGTGG + Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058457064 9:105147572-105147594 CAGAGGGCAGGGAAGGTCAGGGG - Intergenic
1058927779 9:109684477-109684499 CAGGGGGCAGGCAAGGAAATAGG + Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059358195 9:113717810-113717832 CAGTGGGGAGAGAGTGGAAGGGG + Intergenic
1059456361 9:114402610-114402632 CAGTGGGCTGGGATGGAGGGGGG + Exonic
1059660485 9:116395280-116395302 AGGTTGGGAGGGAGGGAAAGAGG + Intronic
1059975814 9:119715762-119715784 AGGTGGGGAGGGAGGGAAAGGGG + Intergenic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060820399 9:126658415-126658437 CAGGCGGCAGGGAGGGCAGGGGG - Intronic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1060870953 9:127039768-127039790 CAGTGAAATGGGAGGGAAAGGGG + Intronic
1061179173 9:129013883-129013905 CAGTGAGCTGGGAGTGAAGGGGG + Intronic
1061499585 9:130994173-130994195 GAGTGGGGAGGGTGGAAAAGGGG - Intergenic
1061682524 9:132250095-132250117 CTGTGGGCAGGAGGGGAAAGGGG - Intergenic
1061711449 9:132490636-132490658 GAGTAGCCAGGGAGGGTAAGAGG - Intronic
1061895500 9:133644755-133644777 CAGAGTGCAGGGACGGGAAGGGG + Intronic
1062194242 9:135264142-135264164 GAGAGGACAGGGAGGGAGAGAGG - Intergenic
1062216229 9:135391138-135391160 CAGTCGGGAGGGTGGGAATGTGG + Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062428117 9:136515428-136515450 CAGTGGGCAGGGCGGGCCTGAGG - Intronic
1062634021 9:137480583-137480605 TGCTGGGCAGGGAGGGGAAGGGG - Intronic
1203771323 EBV:51344-51366 CTGTGGGCTGGGAGGGCCAGAGG + Intergenic
1203638831 Un_KI270750v1:139068-139090 GGGAGGGAAGGGAGGGAAAGGGG - Intergenic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1186020103 X:5245341-5245363 AAGAGGGGAGGGAGGGAGAGAGG - Intergenic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186469343 X:9809040-9809062 TTGGGGGAAGGGAGGGAAAGGGG - Intronic
1186669759 X:11757546-11757568 CAGTGGGCAGCGAGGCAGATGGG - Intergenic
1186718037 X:12274591-12274613 GAGGGAGCAAGGAGGGAAAGGGG + Intronic
1187133373 X:16524526-16524548 CATGGGGAAGGGAGGGGAAGTGG - Intergenic
1187157876 X:16738031-16738053 CAGTGTTTAGGGAGGGGAAGAGG + Intronic
1187295771 X:17999198-17999220 CACAGGGCAGGGTGAGAAAGGGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187421106 X:19134496-19134518 CAGGGGGAAGGGAGAGGAAGAGG - Intergenic
1187467668 X:19541383-19541405 CAGTGGGCGGGGCGGGGCAGTGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187942603 X:24396485-24396507 GAGTGGGCTAGGATGGAAAGCGG + Intergenic
1187945616 X:24423796-24423818 CAGCAGGCAGGTTGGGAAAGAGG + Intergenic
1188245829 X:27834847-27834869 CAGTTGGAAGGGAGGGACTGAGG + Intergenic
1188815702 X:34711374-34711396 CATTTGGCAGGAAGGGGAAGTGG - Intergenic
1188877829 X:35453442-35453464 GAGGGGGAAGGGAGAGAAAGGGG - Intergenic
1189104353 X:38220920-38220942 CAGGAAGGAGGGAGGGAAAGAGG - Intronic
1189372380 X:40439031-40439053 AAGTGGAGAGGGAGGGAAAGGGG + Intergenic
1189780208 X:44506763-44506785 CGCTGGGGAAGGAGGGAAAGGGG + Intergenic
1189907359 X:45775138-45775160 GAGTGGGCAGGGTGGGAGAAAGG + Intergenic
1190020230 X:46867637-46867659 CAGTGGGGTGGGGGGGAATGTGG - Intronic
1190054712 X:47174906-47174928 CGGGGGGCAGAGAGGGAAAGGGG - Intronic
1190107037 X:47568435-47568457 CTGTAGGCAGGGAGGGGGAGGGG + Intronic
1190253947 X:48748440-48748462 CAGTGGGCAGCCAGGCACAGTGG + Intergenic
1190332589 X:49245038-49245060 AAGTGGACAGAGAGGAAAAGGGG - Intronic
1190335428 X:49258868-49258890 CAGGGTGCAGGGAGGGCTAGAGG - Intronic
1190371643 X:49748339-49748361 GAGTTGGCAGAGAGGGACAGAGG - Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192057069 X:67783920-67783942 CAGAGAGCAAGGAGGGAGAGTGG - Intergenic
1192429820 X:71104241-71104263 CAGTCGGCTGGTAGGGAGAGGGG + Intronic
1192860946 X:75069707-75069729 TAATGGGCAGGGGAGGAAAGGGG + Intronic
1193010941 X:76674524-76674546 CACTGGGCAGTGTTGGAAAGTGG + Intergenic
1193047751 X:77070277-77070299 CAGAGGACAGAGAGAGAAAGAGG + Intergenic
1193154419 X:78157894-78157916 CACTGGGGAGTGTGGGAAAGCGG - Intergenic
1193360155 X:80571824-80571846 CAGGGAGGAGGGAGAGAAAGAGG + Intergenic
1193365786 X:80630968-80630990 TAGTGGGGTGGGAGGGAATGAGG - Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1194649831 X:96501304-96501326 GAGTGGGGAGAGAGGGAATGAGG - Intergenic
1195263809 X:103160746-103160768 GAGTGTGCAGGGAGGGACACTGG + Intergenic
1195299045 X:103509388-103509410 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195299055 X:103509413-103509435 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195299078 X:103509479-103509501 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195299088 X:103509504-103509526 GAGAGGGGAGGGAGGGAGAGGGG - Intronic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1195804080 X:108743111-108743133 AAGTGGGGAGGGAAGGGAAGAGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1195966611 X:110435017-110435039 CAGAAGGAAGGGAGGGACAGAGG + Intronic
1195970019 X:110462884-110462906 AAGAGGGAAGAGAGGGAAAGTGG + Intergenic
1196214573 X:113035589-113035611 CAGTGGACTGGGGGTGAAAGCGG - Intergenic
1196297927 X:114020418-114020440 GAGTGGGCAGGAAGGAAAAGAGG - Intergenic
1196302800 X:114065721-114065743 CAAGGGGCAGGGAAGGAATGTGG + Intergenic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1197215188 X:123860326-123860348 GAGAGGGGAAGGAGGGAAAGCGG - Intronic
1197241965 X:124129642-124129664 AAGATGGCAGAGAGGGAAAGAGG - Intronic
1197802417 X:130365489-130365511 AAGTGGGCAGGGAGTGAAAGTGG + Intronic
1197824998 X:130579942-130579964 AAGTGGGGAGGTAGGGAATGAGG - Intergenic
1197926061 X:131647696-131647718 CACTGTGCAGAGAGGGAAAAGGG - Intergenic
1198019484 X:132644213-132644235 AAGGGGGGAGGGAGGGAAGGAGG + Intronic
1198683344 X:139204280-139204302 GAGTGGGGAGGAAAGGAAAGGGG + Intronic
1198787967 X:140312072-140312094 GAAGGGGGAGGGAGGGAAAGGGG + Intergenic
1199510337 X:148614581-148614603 GAGAAGGGAGGGAGGGAAAGAGG - Intronic
1199896961 X:152135807-152135829 CAGGGGACAGGGAGAGCAAGAGG - Exonic
1200082597 X:153585890-153585912 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1200115108 X:153766483-153766505 GAGGGGGCAGGGATGGAGAGAGG - Intronic
1200655692 Y:5899450-5899472 CAGGGGGAAGGGTTGGAAAGAGG + Intergenic
1200716865 Y:6556739-6556761 CAGTGTGCAGAGAAGAAAAGGGG - Intergenic
1201514135 Y:14799018-14799040 CTGGGGGCATGGAGGGGAAGGGG + Intronic
1201697820 Y:16846027-16846049 CAGGGGGAAGGGAGGGAGAGGGG - Intergenic