ID: 927713311

View in Genome Browser
Species Human (GRCh38)
Location 2:25339047-25339069
Sequence AAGGAGAGGCAGTGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1056
Summary {0: 1, 1: 0, 2: 5, 3: 100, 4: 950}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927713311_927713318 -2 Left 927713311 2:25339047-25339069 CCCTCCTCACACTGCCTCTCCTT 0: 1
1: 0
2: 5
3: 100
4: 950
Right 927713318 2:25339068-25339090 TTCCCAAGGCCCAACTCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 78
927713311_927713317 -3 Left 927713311 2:25339047-25339069 CCCTCCTCACACTGCCTCTCCTT 0: 1
1: 0
2: 5
3: 100
4: 950
Right 927713317 2:25339067-25339089 CTTCCCAAGGCCCAACTCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927713311 Original CRISPR AAGGAGAGGCAGTGTGAGGA GGG (reversed) Intronic
900018480 1:170734-170756 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900048738 1:529329-529351 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900070969 1:771153-771175 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
900387617 1:2417728-2417750 TAGGGGAGGCTGTGTGGGGAAGG - Intergenic
900814907 1:4836343-4836365 AGGGAGAGGGAGTGTGGAGAGGG - Intergenic
900847075 1:5112502-5112524 AGGGAGAGGGAGGGAGAGGAAGG + Intergenic
901284367 1:8065297-8065319 AAGGAAAGGTAATGTCAGGAGGG + Intergenic
901291150 1:8125573-8125595 AGGGCCAGGCAGGGTGAGGAGGG - Intergenic
901336411 1:8453072-8453094 AAAGAGAGGGAGAGAGAGGAAGG + Intronic
901530868 1:9851773-9851795 CAGGACAGGCAGTGGCAGGAGGG + Intronic
901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG + Intergenic
901860525 1:12071585-12071607 AGAGAGAGGAAATGTGAGGATGG - Intronic
902185231 1:14719983-14720005 AGGGAGAGGCAGGGACAGGAGGG + Intronic
902220033 1:14958823-14958845 AGGGGAAGGCAGTGTGGGGAGGG + Intronic
902220173 1:14959515-14959537 AGGGGAAGGCAGTGTGCGGAGGG + Intronic
902595839 1:17508933-17508955 ATGGAGAGGTAGGGGGAGGAAGG - Intergenic
903153798 1:21430714-21430736 AAGGAGAGCCAGGGTGGGGAGGG - Intergenic
903360772 1:22775723-22775745 AAGGAGAGGGGGTGTGGGTACGG + Intronic
903456702 1:23492428-23492450 GAGGAGAGGGAGAGTGAGAAGGG - Intergenic
903510796 1:23873628-23873650 AAGCAGAGCAAGTGGGAGGAGGG - Exonic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904095303 1:27972324-27972346 AGGGAGATGTAGTGTGAGGTAGG - Exonic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904329602 1:29749590-29749612 AAGGAAAGGGAGAGTGAGCAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
905454996 1:38082528-38082550 AGGGAAATGCAGTGTGGGGACGG + Intergenic
905640257 1:39584492-39584514 AAGGTGAGGGAGTGTGTGGTGGG - Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
906035685 1:42749008-42749030 AGGAAGTGGCAGTGGGAGGAGGG - Intronic
906063653 1:42964393-42964415 TAGGAGACCCAGTGTGAGGCAGG - Intergenic
906536086 1:46551682-46551704 AATGAGAGGCAGGGTGAGGGGGG + Intergenic
906566801 1:46806718-46806740 AAGGAGTGCCAATGTGAGGGTGG + Intronic
906757611 1:48333636-48333658 AAGCTGAGGCAGTGTTAAGAGGG + Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
906992113 1:50750525-50750547 AAGGAGGATCAGTGTGAGTAGGG - Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907517584 1:55002381-55002403 AAGGAGTGGCAGGGAGAGCAGGG + Intronic
907535456 1:55151467-55151489 AAGGGGAGGAAGTAAGAGGAAGG + Intronic
907643643 1:56218473-56218495 AAGGTGAGGCAATGTGGGGAGGG + Intergenic
908131087 1:61076345-61076367 AAGGTGAGTCAGTGAGATGAAGG + Intronic
908359351 1:63353026-63353048 AAGTTGAGTCAATGTGAGGATGG + Intergenic
908909342 1:69055046-69055068 AAATAGAGGCAGGGTGAGGAGGG - Intergenic
908982822 1:69979026-69979048 AAGGAGAGCCTGTCTAAGGATGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911631880 1:100192730-100192752 CAGGAAAGGAAGTCTGAGGATGG - Exonic
912953096 1:114134107-114134129 AAGGAAAGGCACCGTGAGAAAGG - Intronic
913186095 1:116372540-116372562 AAAGAGAGGTGGTGGGAGGAGGG + Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914704881 1:150162446-150162468 GAGGAGAAGCACTGGGAGGAAGG - Intronic
915580653 1:156811081-156811103 AAGGAGATGCTGAGAGAGGAGGG - Intronic
915602969 1:156933870-156933892 AGGCAGAGGCAGTGGGATGAGGG - Intergenic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
915940619 1:160116184-160116206 CGGGAGATGCAGTGAGAGGAGGG - Intronic
916127671 1:161585806-161585828 AAGGATAGGCAGTGGTAAGATGG + Intronic
916137589 1:161667610-161667632 AAGGATAGGCAGTGGTAAGATGG + Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916332093 1:163628379-163628401 AAGGAGGGGAAGGGGGAGGAGGG - Intergenic
916599941 1:166282999-166283021 CAGAAGAGGCATTTTGAGGAAGG - Intergenic
916875287 1:168962257-168962279 TAGAAGATGCAGTTTGAGGATGG + Intergenic
917191862 1:172426517-172426539 AATGAGAGGCAGGGTGAGGGTGG - Intronic
917304081 1:173608942-173608964 AGGGAGAGGAAGGGAGAGGAAGG + Intergenic
917503220 1:175604633-175604655 AAGGAGAGGAGGAGAGAGGATGG - Intronic
917680172 1:177357792-177357814 AAGGGGAGGCTGTGTGAAGGCGG + Intergenic
917701568 1:177587085-177587107 ATGAAGAGGAATTGTGAGGATGG - Intergenic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
919791821 1:201296146-201296168 CAGGAGAGGCTGTGGGAAGAGGG + Intronic
920041456 1:203100366-203100388 AAGTAGAGGCATTGGGAGGTGGG + Intronic
920053167 1:203175521-203175543 AAGGTGGGGCAGGGGGAGGAGGG - Intronic
920183320 1:204145995-204146017 AGGGAAAGGCAATGTCAGGATGG + Intronic
920367359 1:205455214-205455236 ATGGGGAGGCAGTGGGAGGCAGG + Intronic
920916900 1:210265067-210265089 AAGGTGAGGGAGAGTCAGGAAGG + Intergenic
921066956 1:211630311-211630333 TGAGAGAGGCAGTGTGGGGAGGG - Intergenic
921331433 1:214042219-214042241 AAGAAGAGACAGTGGAAGGAGGG - Intergenic
921608291 1:217180338-217180360 AATCAGGGGCAGTGTGAAGATGG - Intergenic
921667239 1:217887721-217887743 AAGGAGAGGTATTGGGAGAAGGG + Intergenic
922243731 1:223774822-223774844 AAACAGAGCCACTGTGAGGAAGG - Exonic
922254920 1:223885464-223885486 AAGGAAATTCAGTGTGAGGGGGG + Intergenic
922465068 1:225841007-225841029 AAGGAGAGGGGATGTGGGGAGGG - Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922698112 1:227741801-227741823 ACGGAGATGCAGTGCAAGGACGG - Intronic
922892513 1:229072718-229072740 AAGGAGAGGGAGTGAGACCAAGG - Intergenic
922932796 1:229403391-229403413 GAGGAGAGGCTGTGTGGAGAAGG - Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923509808 1:234640695-234640717 AAAGAGAGGGAGAGTGAGGGAGG + Intergenic
923552747 1:234977202-234977224 AAGGAGAGGCTGAGTAGGGAGGG + Intergenic
923763026 1:236864451-236864473 ACAGAGAAGCAGTGTCAGGAAGG + Intronic
923907023 1:238395947-238395969 ATGGAGAGGTAGTGTGTGCAAGG - Intergenic
923940288 1:238816142-238816164 AAGGGGAGGCAGTGAGTAGATGG + Intergenic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924348513 1:243094168-243094190 GAGGAGAGGCAGGGGCAGGAGGG + Intergenic
924423949 1:243933842-243933864 AAGGAGGGGAAGGGAGAGGAAGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1064086058 10:12347805-12347827 AAGGAAACACAGTGGGAGGAAGG + Intergenic
1064114784 10:12568364-12568386 AAGGAGAGGAGGGGAGAGGAGGG - Intronic
1064314954 10:14246854-14246876 AAGGGGAGGGAGTGTGAGACAGG + Intronic
1064934914 10:20668881-20668903 CAGGAGAGGGAGTGTGAAGCGGG - Intergenic
1064970847 10:21065374-21065396 AAGGAAAGTAAGTGTGAGGGAGG + Intronic
1065182080 10:23136329-23136351 GACGAGGGGGAGTGTGAGGAAGG + Intergenic
1065427254 10:25618648-25618670 AAGGAGGGGTAGTTTGAGGAAGG + Intergenic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1065840024 10:29694911-29694933 AAGGAAAGGCAGCTAGAGGAAGG + Intronic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066727846 10:38410733-38410755 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1067438111 10:46292908-46292930 AAGGAGGGTCAGGGAGAGGAAGG + Intronic
1067481149 10:46598324-46598346 AGGGAGAGGTAGTGTTTGGAAGG - Intergenic
1067530681 10:47069395-47069417 AAGGAGAGGCAGAGGGAGACAGG - Intergenic
1067576682 10:47413516-47413538 AAGGAGAGGCACAGAGAGAAAGG - Intergenic
1067613603 10:47743498-47743520 AGGGAGAGGTAGTGTTTGGAAGG + Intergenic
1067677270 10:48392655-48392677 AAAGAGAGGAAGAGTGAGAATGG - Intronic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068426160 10:56867125-56867147 ACGGACATGCAGTGTGAGCAAGG + Intergenic
1068706334 10:60079996-60080018 GAGGAGAGGAAGTGAGAGGGAGG + Intronic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069796135 10:71053135-71053157 TAGGAGAGGCCCTGGGAGGAAGG + Intergenic
1069812378 10:71171875-71171897 AAGGAAAGGCAGTATCAGAAGGG + Intergenic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070282461 10:75059662-75059684 TGGGAGGTGCAGTGTGAGGAGGG + Intergenic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070664637 10:78334357-78334379 ATGGAGAGGCCATGTGAAGATGG + Intergenic
1070696983 10:78570823-78570845 AGGGCCAGGCAGAGTGAGGATGG - Intergenic
1071481148 10:86065942-86065964 AGGGAAAGGCATTGTTAGGAAGG - Intronic
1071554898 10:86594376-86594398 AAGGAGAGGGAGGGGGAGGGAGG + Intergenic
1071629013 10:87203470-87203492 AGGGAGAGGTAGTGTTTGGAAGG + Intergenic
1071931027 10:90470465-90470487 AAGAAAAGGCAGTGTGACCACGG - Intergenic
1072263206 10:93702361-93702383 AGGGAAAGGGTGTGTGAGGAGGG - Exonic
1072997013 10:100254342-100254364 AGGAAGTGGCAGTTTGAGGAAGG + Intronic
1073026308 10:100489576-100489598 AAGAAGAGTAAGTGGGAGGAGGG + Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073077562 10:100834014-100834036 AAGGAGAGACAGTGGGTGCAGGG + Intergenic
1074247739 10:111712153-111712175 AAAGAGAGGCAAGGTGAGGGAGG + Intergenic
1074413249 10:113245623-113245645 GAGGAGAGGCTGACTGAGGAGGG + Intergenic
1074728944 10:116347846-116347868 AAGGAGATGTAGTGGGAGGGAGG - Intronic
1075122877 10:119676991-119677013 CAGGAGAGACGGTGTCAGGAAGG + Exonic
1075154188 10:119960484-119960506 AAGGAGGGGAGGGGTGAGGAGGG + Intergenic
1075301703 10:121330589-121330611 AGGGAGAGGAAGTGAGGGGAGGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075482720 10:122796316-122796338 AAGGAGAGTGAGGGAGAGGAAGG + Intergenic
1075482725 10:122796339-122796361 AAGGAGAGTGAGGGAGAGGAAGG + Intergenic
1075482730 10:122796362-122796384 AAGGAGAGAGAGGGAGAGGAAGG + Intergenic
1075534990 10:123263328-123263350 AGGGAGAGGGAGTGGGAGAAGGG + Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076618242 10:131770896-131770918 AGGGAGGGGCAGTGTGGGGGAGG + Intergenic
1076738296 10:132468411-132468433 AAGGAGAGGGAGTTCGGGGAGGG + Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1077252681 11:1567524-1567546 AAGGAGAGTGAGTGCGAGGCTGG - Intronic
1077499265 11:2901954-2901976 GAGGAGGGGCAGTGTGGGCAGGG - Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077785789 11:5382265-5382287 AAGGAGGGGTAGTGTAAGCAAGG - Intronic
1078355939 11:10631410-10631432 GAGGAGAGGAAGTTTTAGGAAGG - Intronic
1078657026 11:13250977-13250999 AAGTGGAGACAGTGTGTGGAAGG - Intergenic
1078850714 11:15160463-15160485 AAGAGGAGGGAGTGGGAGGAGGG + Intronic
1079666632 11:23113919-23113941 AAGTAGAGGCAGAGTGGAGAGGG + Intergenic
1080312786 11:30913573-30913595 AAAGAGAGGCAGTTAGTGGAAGG - Intronic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080646868 11:34193900-34193922 GAGAAGAGACAGTGGGAGGAGGG - Intronic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081673186 11:44953128-44953150 AGGGTGAGGCACTGTCAGGATGG - Intergenic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1082931499 11:58611796-58611818 AAAGAGTGGGAGTGTGAGGAAGG + Intronic
1083266360 11:61548632-61548654 AAGGTGGGGCAGTGTGGGGAAGG + Intronic
1083597363 11:63924596-63924618 CAGGAGGGGCAGTGGGAGAAGGG - Intergenic
1083771865 11:64872041-64872063 AAGCAGAGGGAGTGGGAGGTGGG + Intronic
1083841870 11:65309199-65309221 AAGGAGAGGCTGGGAGGGGAAGG + Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084521016 11:69662910-69662932 TAGGAGAGGCAGTGCCTGGATGG - Intronic
1084683081 11:70678470-70678492 AGGGAGAGGCAGGGAGAGGCAGG - Intronic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1084742831 11:71150260-71150282 AGGGAGAGGGAGGGAGAGGAAGG + Intronic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1085217253 11:74843692-74843714 AAGGAGAGCCAGCGTGAGGCAGG - Intronic
1085272888 11:75280813-75280835 AATGAGAGGCAGGGAGATGAGGG + Intronic
1085296016 11:75432177-75432199 AAGGAGAGGCAGGGCGCAGAGGG - Intergenic
1085389282 11:76174326-76174348 AAGGAGGGGAAGTGAGGGGATGG + Intergenic
1085485708 11:76861127-76861149 GAGGAGACGCCGTGTGAGGAAGG + Intronic
1086336850 11:85809770-85809792 AAGGAGAAGAGGTGTGGGGACGG - Intronic
1087264389 11:96044437-96044459 AAGGAGAGGAAGGGAGAGAATGG - Intronic
1087294678 11:96357126-96357148 AGGGACAGACAGAGTGAGGATGG + Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088073947 11:105823990-105824012 AAGGAGAGACCATGTGAGGATGG + Intronic
1088520043 11:110687459-110687481 ATAGGGAGGCAGTGTGGGGAAGG + Intronic
1088800671 11:113303980-113304002 AAGGATATGCAATTTGAGGAAGG + Intergenic
1089004126 11:115076650-115076672 AGGGTGAGACAGTTTGAGGAAGG - Intergenic
1089291300 11:117439246-117439268 AAGGTGAGGCTCTGTGAGGCAGG - Exonic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089612535 11:119677485-119677507 AAGGAGAGGAGGAGGGAGGAGGG + Intronic
1089707705 11:120292482-120292504 AAGGAGAGGGTGTGGGAGGCGGG - Intronic
1090056657 11:123430297-123430319 AGGAAGAGGCAGTGGTAGGAGGG - Intergenic
1090297194 11:125599125-125599147 TAGGAGAGGCAGAGTGAGAGAGG - Intronic
1090648370 11:128784715-128784737 CAGGAGAGCCAGTGAGAGGTGGG - Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091172657 11:133532185-133532207 CAGGAGAGGCAGTGGGGAGATGG - Intronic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091399972 12:175647-175669 AAGCAGAGGCCCTGGGAGGAGGG - Exonic
1091745854 12:2992459-2992481 ACAGAGAGGCACTGTGAGGGAGG - Intronic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092232553 12:6784350-6784372 GAGGAGAGGCAGTGCAATGAGGG + Intergenic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092659350 12:10722487-10722509 AAGGAGAGGCAGTCTGGGAGAGG - Intronic
1093921266 12:24862372-24862394 AGGGAGGGGCAGTGTCAGGCAGG - Intronic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095898298 12:47302563-47302585 AAGGAGAGGTTGTGTGGGAAAGG + Intergenic
1095938572 12:47710953-47710975 AGGGAGAGGCAGCGTGAAGTGGG - Intronic
1095944998 12:47748777-47748799 AAGGAGGGACAGTGTGGAGAGGG + Intronic
1095984137 12:47988529-47988551 AAGGAGACCCATTGTGAAGAGGG - Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097542263 12:60955965-60955987 AAGCCGACCCAGTGTGAGGAGGG + Intergenic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098316383 12:69197848-69197870 AAGGAGAACCAGTGTGATGTGGG - Intergenic
1098573717 12:72016934-72016956 ATGCAGAGGGAGTGAGAGGAGGG + Intronic
1098817111 12:75181548-75181570 AATGAGAGGCTGTTGGAGGAAGG - Intronic
1098876540 12:75871861-75871883 AAGCAGTGGGAGTGGGAGGAGGG - Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099455534 12:82858301-82858323 AAGGAGAGGCATTGAGCGGACGG + Intronic
1100269881 12:93014543-93014565 AAGAGGAGACAGTGTCAGGAGGG + Intergenic
1100503011 12:95192647-95192669 AAGAAGAGGCAGTGTTAGAAAGG + Intronic
1101215846 12:102581667-102581689 AAGGCGAGAGAGTGGGAGGAGGG - Intergenic
1101255551 12:102973594-102973616 AGAGGGAGGCAGTGGGAGGAAGG - Intergenic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102559795 12:113754139-113754161 AAGGAGAGGAGGGGAGAGGAGGG + Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103267935 12:119646676-119646698 AAAGAGATGCAGTGTGAAAAAGG - Intergenic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1103741851 12:123096501-123096523 AGGAAGAGGCAGTGGGAAGATGG + Intronic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1104976782 12:132555721-132555743 CAGGAGGGGCCATGTGAGGACGG - Intronic
1105790141 13:23790589-23790611 AGGGGGAGGCAATGTGATGAGGG + Intronic
1105874022 13:24537994-24538016 TAGGTGAGGCGGTGTGGGGAAGG - Intergenic
1106816118 13:33408995-33409017 AAAGAGAGGCAGAGAGAGAATGG - Intergenic
1107213060 13:37881428-37881450 AAGGAGAGAGAGAGAGAGGACGG + Intergenic
1107744813 13:43493150-43493172 CAGGAGAGGGAGTGGGAGGGGGG - Intronic
1108428943 13:50334515-50334537 GAGGAGAGGCAGTTTGAGTAAGG + Intronic
1108485635 13:50921352-50921374 AGAAAGAGGGAGTGTGAGGAAGG - Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108711354 13:53035602-53035624 AAAGAGATGGAGGGTGAGGATGG - Intronic
1108712700 13:53049430-53049452 AAGGAAGGGGAGAGTGAGGAAGG + Intronic
1108984141 13:56561664-56561686 CAGGGGCGGGAGTGTGAGGAAGG + Intergenic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109571957 13:64204579-64204601 AAGAGGAGGCAATGGGAGGAAGG - Intergenic
1109953256 13:69530491-69530513 AAGGAGAGGGAGAGAGATGAGGG - Intergenic
1110300005 13:73915153-73915175 AAGAGAAGACAGTGTGAGGATGG - Intronic
1111419869 13:87998558-87998580 GAGGAGGGGAAGTGTGAGGTTGG + Intergenic
1111640434 13:90962922-90962944 AAGGATATACAGTGTGAGGCTGG - Intergenic
1112397757 13:99048710-99048732 AAATAGTGGCACTGTGAGGATGG - Intronic
1113235499 13:108268511-108268533 AAGGAGAGCGAGGGTGAGGCAGG + Intronic
1113425151 13:110201393-110201415 AAGGAGGGGGAGTAGGAGGAGGG + Intronic
1113699260 13:112372028-112372050 AAAGAAAGGAAGTGAGAGGAAGG + Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113914538 13:113862919-113862941 CAGGAGCCGCCGTGTGAGGACGG - Intronic
1113942916 13:114027938-114027960 AAGCAGAGGCGGCGTCAGGAGGG + Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114452499 14:22836530-22836552 GAGGAGAGGCTGTGGGAGAAGGG + Intergenic
1114548290 14:23518553-23518575 AACCAGAGTCTGTGTGAGGATGG - Intergenic
1114550931 14:23532547-23532569 AAGGTGAGGCTGGGTCAGGAAGG - Exonic
1114814923 14:25945769-25945791 AAGGAGAGACAGTGGAAGAAGGG + Intergenic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1116055531 14:39859679-39859701 GTGGAGAGGCTGTGTGAGAATGG + Intergenic
1116828787 14:49697280-49697302 AAGGAGAGGGAGAGAGAGGGGGG + Intronic
1118073404 14:62271146-62271168 AAGGAGAGAGGGTGAGAGGATGG - Intergenic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119320386 14:73726820-73726842 AAGCAGAGGCAAGGTGAGGAGGG - Exonic
1120346239 14:83294059-83294081 GAGGAGAGGCAGGGAGAGGAGGG - Intergenic
1120495882 14:85234686-85234708 AGGGAAAGGCAATGTGTGGATGG - Intergenic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1120916478 14:89715049-89715071 AAGGAGGGGCTGTTGGAGGAAGG - Intergenic
1120937922 14:89916730-89916752 AAGGAGAGGAAGGGGCAGGAGGG - Intronic
1120997976 14:90431097-90431119 AATGTGAAACAGTGTGAGGAAGG - Intergenic
1121216384 14:92251582-92251604 AAGGAGAGCCAGAGAGAGAAGGG - Intergenic
1121265112 14:92596769-92596791 AAGGACAGCCATGGTGAGGAAGG + Intronic
1121319919 14:92986334-92986356 CAGGAGACTCAGTGTGAGTAGGG + Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121432033 14:93894322-93894344 AAGGAGGGGAAGGGAGAGGAGGG - Intergenic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121586576 14:95067126-95067148 AAGAAGAGGTGGTGTGAGGGTGG - Intergenic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121604300 14:95229275-95229297 GAGGAGAGGCAGTGATGGGAAGG - Intronic
1121843496 14:97154147-97154169 AAGGAGGGAGAGAGTGAGGAAGG - Intergenic
1121855627 14:97266903-97266925 AAGGAGGGGGAGGGGGAGGAGGG + Intergenic
1121996739 14:98608577-98608599 AAGGAGAGGAGTTGCGAGGATGG - Intergenic
1122323230 14:100867846-100867868 AGGGAGAGCCGGTGAGAGGACGG - Intergenic
1122500245 14:102193239-102193261 ACGGACAGGCTGTCTGAGGAAGG - Intronic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1123178755 14:106447161-106447183 CAAGTGAGGCAGTGTGGGGAGGG + Intergenic
1123450865 15:20358161-20358183 GAGGAGAGGAAGGGAGAGGAAGG - Intergenic
1123481405 15:20635447-20635469 GAAGTGAGGCAGTGTGGGGAGGG + Intergenic
1123636607 15:22364918-22364940 GAAGTGAGGCAGTGTGGGGAGGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1124057477 15:26255354-26255376 AAGAAGAGGCAGGCTGAGGCAGG - Intergenic
1124104534 15:26725090-26725112 AAGGAGGGGCACTGTGATGGGGG - Intronic
1124367190 15:29080465-29080487 CAGCAGAGGCATTGTGAGGAAGG + Intronic
1124866682 15:33499193-33499215 GAGGAGAGGCAGGGAGAGGAAGG - Intronic
1124902277 15:33835485-33835507 AAGGAGAGGCAGAGACAGGGAGG - Intronic
1124986396 15:34620349-34620371 AAGTAGAGGAAGTGGGAGGGAGG - Intergenic
1126151424 15:45526604-45526626 AAGGAGAGGGAGAGTGAAGGGGG + Intergenic
1126273580 15:46849394-46849416 AAAGAGAGGAAGTATGAAGATGG - Intergenic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127344924 15:58084765-58084787 AAGGAGAGGCTGTGTAACTAGGG + Intronic
1127946138 15:63755796-63755818 AAAGAGAGGAAGAGAGAGGAGGG + Intronic
1127968610 15:63942188-63942210 GAGGTGAGCCTGTGTGAGGAAGG - Intronic
1128073583 15:64812420-64812442 AAGGAGAGGCAGAGAGAAGGAGG + Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128512817 15:68324135-68324157 AAAGAGGGGAGGTGTGAGGACGG + Intronic
1128702442 15:69814091-69814113 GGGGAAAGGCAGTGTGGGGAAGG + Intergenic
1129114083 15:73355292-73355314 AGGAAGAGACAGTGAGAGGAAGG - Intronic
1129816751 15:78561965-78561987 AAGGAGACCCAGTGAGAGGCTGG + Intergenic
1130890372 15:88128420-88128442 AAAGAGGGGCTGTGTGAGGATGG - Intronic
1130917938 15:88320695-88320717 AAGGAGAGACAGTGTAGGCATGG - Intergenic
1130973040 15:88749578-88749600 TAGGAGGGAAAGTGTGAGGAAGG - Intergenic
1131010843 15:89017360-89017382 AAGGGGAGGCAAAGAGAGGAAGG - Intergenic
1131822408 15:96286173-96286195 AAGGAGAGGAAGTGCTGGGAAGG + Intergenic
1132520199 16:383763-383785 GAGGAGAGGCGGGGTGGGGATGG + Intronic
1132567948 16:631734-631756 AAGGAGAGGCAGTGAAGGGGTGG - Intronic
1132567972 16:631822-631844 AAGGAGAGGCAGTGACGGGGTGG - Intronic
1132567989 16:631894-631916 AAGGAGAGGCAGTGATGGGGTGG - Intronic
1132568042 16:632103-632125 AAGGAGAGGCAGTGACGGGGTGG - Intronic
1132606213 16:794795-794817 AAGGAGGGGCTGAGTGAGGCTGG + Intronic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1133377389 16:5298637-5298659 AGGGAGGGGCAGTGGGAGGGAGG - Intergenic
1133392848 16:5423076-5423098 AAGGAGAGGGAGGAAGAGGAAGG + Intergenic
1133588304 16:7217048-7217070 AAGGAGAGGGAGAGAGAGGGAGG - Intronic
1134510757 16:14845131-14845153 AAGGAGCGGGAGGGTGAGGCAGG - Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134698397 16:16243618-16243640 AAGGAGCGGGAGGGTGAGGCAGG - Intronic
1134779536 16:16883220-16883242 GAGGAAAGGCTGTGTGAGGATGG + Intergenic
1134973438 16:18551060-18551082 AAGGAGCGGGAGGGTGAGGCAGG + Intronic
1135517214 16:23146220-23146242 AAAGAGGGGCAGTGTGGGGTGGG + Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135789963 16:25384776-25384798 CAGGAGAGAAAGTGTGAGGGAGG - Intergenic
1135848943 16:25944724-25944746 AAGAGGAGGCAGTTAGAGGACGG - Intronic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1137541708 16:49367399-49367421 AAGGAGAGGCAGAGTGGGTCTGG - Intergenic
1137605220 16:49782673-49782695 AGGGAGAGGCAGTAGGAGAAGGG - Intronic
1137822161 16:51456487-51456509 AAGGAGGGACAGAGTGAGGGAGG - Intergenic
1137929780 16:52576012-52576034 AAAGAGAGGAAGAGAGAGGAAGG + Intergenic
1137947727 16:52750937-52750959 AGGGAGAGGAAGGGAGAGGAGGG + Intergenic
1137947768 16:52751042-52751064 AAGGAGAGGAGGGGAGAGGAGGG + Intergenic
1138217163 16:55214493-55214515 AAGGGGAGGAGGGGTGAGGAGGG + Intergenic
1138444412 16:57054663-57054685 AAGGAAAGGGAGGGTGGGGAGGG - Intronic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1138628944 16:58278217-58278239 AAGGAGAGGAAGAGGAAGGAGGG + Intronic
1138828560 16:60351369-60351391 CAGCAGTGGCAGGGTGAGGATGG + Intergenic
1139141488 16:64268149-64268171 AAGAAAAGTCGGTGTGAGGAAGG + Intergenic
1139391434 16:66608358-66608380 CAGCAGAGGCGCTGTGAGGAAGG - Exonic
1140965986 16:79966515-79966537 AAGGAAAGGAAGGTTGAGGAAGG - Intergenic
1141205917 16:81933069-81933091 CAGGAGAGGAGGTGTGAGGCAGG - Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141606682 16:85158086-85158108 AGAGAGAGGGAGTGAGAGGAGGG + Intergenic
1141700154 16:85638743-85638765 AAGGGGTGGCAGTGGGTGGAGGG - Intronic
1141766655 16:86063660-86063682 AAGGAGAGGGAGGGAGAGGGAGG + Intergenic
1141773024 16:86102331-86102353 AAGGAGAGGGAGAGGAAGGAAGG - Intergenic
1141879644 16:86849310-86849332 AAGGTGAGGCAGGGTGTGAAAGG - Intergenic
1142001552 16:87667153-87667175 AAGGAGAGGCCACGTGACGAGGG - Intronic
1142296912 16:89230211-89230233 AAGGAGGGGCAGAGTGGAGAGGG + Exonic
1142317465 16:89357107-89357129 TAGGAGGGACAGTGTAAGGAAGG + Intronic
1142445178 16:90131729-90131751 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1142462331 17:103737-103759 GAGGAGAGGCAGGGGTAGGAGGG + Intergenic
1143264343 17:5624570-5624592 AAGGAGAGGGAGTAAGACGAGGG + Intergenic
1143805724 17:9424519-9424541 AACCAGAGGCAGGGGGAGGAAGG - Intronic
1143836884 17:9699957-9699979 GAGGGGAGGCACTGTGAGGTTGG + Intronic
1144045724 17:11452931-11452953 AAGGAGAGGGAGGAAGAGGAGGG - Intronic
1144131476 17:12251044-12251066 CAGGTGAGGCAGGGTGAGCAGGG + Intergenic
1144247807 17:13384709-13384731 AAGGAGAGGAAGCTTGAGCATGG + Intergenic
1146469254 17:33111091-33111113 AAGAGAAGGCAGTGTGATGACGG - Intronic
1147134151 17:38425603-38425625 AAAGAGGGGGAGTATGAGGAGGG + Intergenic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148177503 17:45580018-45580040 AAGGACAGGCAGATTGAGGGAGG - Intergenic
1148220557 17:45858745-45858767 CTGGAGAGGGAGGGTGAGGAAGG + Intergenic
1148347311 17:46912122-46912144 CAGGAGAGGAGGTGTGAGGAAGG - Intergenic
1148493509 17:48037926-48037948 AAGGAGAGGTGGGGTGAGGGCGG - Intronic
1148562694 17:48614840-48614862 AAGGAGAGGGAAAGAGAGGAGGG + Exonic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148774425 17:50087674-50087696 TAGGATAGGAAGGGTGAGGATGG + Intronic
1149968718 17:61194131-61194153 AAGGAAAGGCAGGGAGGGGAGGG + Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150269062 17:63850670-63850692 AGGGGTAGGCAGTGAGAGGAGGG - Intergenic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150709014 17:67514109-67514131 AGGGAGAGACTGTGTGGGGAGGG + Intronic
1150747827 17:67830606-67830628 AAGGAAAGGCAGATTGAGGGAGG + Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150929767 17:69572092-69572114 AAGGTGTGGCAGTGTGTGGGTGG + Intergenic
1151435762 17:74096118-74096140 AAGGCAAGAGAGTGTGAGGAAGG - Intergenic
1151536259 17:74740597-74740619 GAGGAGAGACAGGGTGAAGATGG + Intronic
1152441372 17:80312273-80312295 AAGGAGAGGGAGGAAGAGGAAGG + Intronic
1152456044 17:80416739-80416761 AAAGAGAGACAGAGAGAGGAAGG - Intronic
1152850286 17:82629933-82629955 AAGGAGAGGCTCAGTGAGGGAGG - Intronic
1153360074 18:4184648-4184670 AAGGAAAGGCAGGGTGATGTTGG - Intronic
1153453324 18:5253809-5253831 AAGGAGAGGTAGCTTGAGGTGGG + Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1155064266 18:22255108-22255130 AGGGAGAGGCAGTCTGGGAAGGG - Intergenic
1155381509 18:25227157-25227179 AAGTGCAGTCAGTGTGAGGAAGG - Exonic
1155437206 18:25826087-25826109 AATGACAGGCAGTGGGTGGAGGG - Intergenic
1156551405 18:38022745-38022767 AAAGAGAGGCAGTGGAGGGAGGG - Intergenic
1156611772 18:38733464-38733486 AGGAAGAGACAGTGTGAGAATGG - Intergenic
1156688283 18:39675924-39675946 AATGAGAGGCAATGCGAGGTAGG + Intergenic
1156701305 18:39828766-39828788 AAGGAGTGGCAGTGTGGGGTGGG + Intergenic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157462053 18:47906833-47906855 AAGAGAAGGCAGTGTGACGATGG - Intronic
1157531676 18:48426478-48426500 GGGGAGAGGCAATTTGAGGATGG - Intergenic
1157930958 18:51822825-51822847 AAGAAGAGGCAGGGACAGGAAGG - Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1158961458 18:62591150-62591172 AAGGTCAGGCAATGTGATGAGGG - Intergenic
1159051680 18:63426302-63426324 AAGCAGAGGCACTGTGGGGTTGG + Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1159248937 18:65848503-65848525 AAGGAGTGGTAGTGTAAGTAGGG + Intronic
1159556412 18:69950498-69950520 AAGCAGAGGCTGTGTCAGGTTGG + Intronic
1160047924 18:75405202-75405224 AATGATAGGTAGTGTGAGGTAGG + Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160389274 18:78518068-78518090 GGGGAGCCGCAGTGTGAGGATGG + Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161569405 19:5022316-5022338 CAAGAGAGGTGGTGTGAGGAAGG - Intronic
1161657172 19:5523421-5523443 AAGGGGAGGCAGGGAGGGGACGG - Intergenic
1161726649 19:5933246-5933268 AAAGAGAGGCTGTCTGAGCAGGG - Intronic
1161797435 19:6395192-6395214 AAGGAGATGCCGTGTGTGAAGGG + Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1161904031 19:7141821-7141843 AAGGAGAGGAAGTGAGAGGCAGG + Intronic
1162065182 19:8121182-8121204 GAGGAGAGGGAGGGTGGGGACGG - Intronic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1162100883 19:8337970-8337992 AAGGAGAGGCCATGTGTGGAGGG - Intronic
1162188121 19:8922861-8922883 TGGGCGAGGCAGTGTGAGGTGGG + Intronic
1162198705 19:9006002-9006024 GAAGAGAGGAAGTGTCAGGAAGG + Intergenic
1162473799 19:10887964-10887986 AATGAGAGCCAGGGTGTGGAGGG + Intronic
1163036050 19:14569610-14569632 TATGTGAGGCAGTGGGAGGAAGG + Intronic
1163549151 19:17955793-17955815 AAGTAGAGGCTGTGTGTGGGGGG - Intronic
1163612704 19:18309473-18309495 CAGGAGGCGCAGTGAGAGGAGGG + Intronic
1163953653 19:20613959-20613981 AAGGAGAAAGAGTGTGAGAAGGG + Intronic
1164399306 19:27891785-27891807 AAGGAAAGGCTGGGAGAGGAAGG + Intergenic
1164526304 19:29015967-29015989 AAGGAGAGGGAGAGAGAGAAAGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1165282524 19:34809429-34809451 AAAGAGAGGAAGTGTGAGTCTGG - Intergenic
1165426802 19:35750357-35750379 GAGGAGAGACAGAGTGAGGGTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166145127 19:40828949-40828971 AGAGAGAGACAATGTGAGGATGG - Intronic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166473951 19:43104456-43104478 AAGGAGAGAGAGAGAGAGGAAGG + Intronic
1166550728 19:43664397-43664419 CAGGAGAGGAAGGGTGGGGAAGG - Intronic
1166562072 19:43739518-43739540 GAGGATAGGCAGTCTGAGGGAGG + Intronic
1167497366 19:49827500-49827522 AGGGAGAGGCCATGTGAGGACGG - Intronic
1167600377 19:50451387-50451409 GAGGATAGGCAGGGCGAGGAAGG + Intronic
1168290262 19:55354124-55354146 TAGGAGGAGCAGTGTGAGGGAGG - Exonic
1168350739 19:55674375-55674397 AAGGAGAGGCTGTTTTGGGAGGG - Intronic
1168565687 19:57420421-57420443 AAGGTGAGCCTGTGTAAGGAAGG - Exonic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
925750693 2:7088781-7088803 AACGAGGGGCAGTGTGATGGAGG + Intergenic
925859809 2:8163412-8163434 AAAGAAAAGCACTGTGAGGAAGG - Intergenic
925922841 2:8648625-8648647 AAAGTGAGGCAGTGGGATGACGG + Intergenic
926043052 2:9690235-9690257 GTGGGGAGGCAGTGTGAGAAGGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926561561 2:14423384-14423406 AAGGAGAGTTAGTTTCAGGAAGG - Intergenic
927250037 2:20989143-20989165 GAGGAAAGGCAGGGTGAGGCGGG - Intergenic
927292666 2:21420075-21420097 CAGGAGAGGCTGTGTGTGTAGGG - Intergenic
927332781 2:21885651-21885673 AAGGAGATGCAGTGACAGGAAGG - Intergenic
927524353 2:23723397-23723419 GAGGAGAGGCAAGGAGAGGAGGG + Intergenic
927550014 2:23990073-23990095 AAGCCCAAGCAGTGTGAGGAAGG - Intronic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
927667896 2:25044811-25044833 GGGCAGAGGCAGGGTGAGGAGGG - Intronic
927683310 2:25154363-25154385 AAGGAGATGGGGTCTGAGGAGGG + Exonic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928115065 2:28540314-28540336 GAGGGGAGGCAGTGTGGGCAGGG - Intronic
928656536 2:33457800-33457822 TAGGAGAGGTAGTGTGGTGAGGG - Intronic
928921483 2:36532715-36532737 AGGAAGTGGCAGGGTGAGGAGGG - Intronic
929011508 2:37449839-37449861 AAGGGGAGGCAGGGCGTGGATGG - Intergenic
929051672 2:37842279-37842301 AAGGAGAGGCAGACTGAGTGTGG + Intergenic
929437434 2:41939247-41939269 AGGGAGGGGCTGTGGGAGGAGGG + Intronic
929454239 2:42054959-42054981 AAGGCGGGGCACTGTGAGGCAGG - Exonic
929914765 2:46125510-46125532 AAGAAGAGGCTGGGGGAGGATGG + Intronic
930323928 2:49889153-49889175 AAGGAAAGGAAGTTTGAGGTGGG - Intergenic
932060620 2:68494455-68494477 AGGGAGAGGGAGTGAGGGGAAGG + Intronic
932320504 2:70819039-70819061 GAGGAGAGGAAGGGAGAGGAAGG + Intronic
932508136 2:72256670-72256692 GAGTAGGGGCAGTGTGATGAGGG - Intronic
932894174 2:75622636-75622658 AAGAAGAGACAGAGTGAGGGAGG + Intergenic
933105206 2:78316075-78316097 AAAGAGAGGCAGTAAGAGGTAGG + Intergenic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933391432 2:81673829-81673851 CAGGAGAGACAGTCTGAAGAGGG - Intergenic
933632732 2:84675092-84675114 AAGGAAAGGCCCTGTGAGCAAGG - Intronic
933869865 2:86555732-86555754 AAGAGAAGGCAATGTGAGGATGG - Intronic
934654446 2:96109962-96109984 AGGGAGTGGCAGTGGGGGGAAGG + Intergenic
934729410 2:96647153-96647175 AAGGTGAGGCAGAGAGAGGCAGG + Intergenic
935028618 2:99301422-99301444 AAGGAGAGAGAGAGTGAGAAGGG + Intronic
935029369 2:99307083-99307105 AAGGAGAGAGAGAGTGAGAAGGG - Intronic
935066363 2:99652016-99652038 AAGGCAGGGCAGTGTCAGGAAGG + Intronic
935147439 2:100405465-100405487 AAGGTGGGGCAGAGAGAGGATGG + Intronic
935618677 2:105110502-105110524 AACGAGAGTCAGTCTGAGCAAGG - Intergenic
935720548 2:105975298-105975320 AAGGAAAGGCAGAGTGAGAGAGG - Intergenic
936274883 2:111086759-111086781 AAGCAGAGGTAGTGAGAGAAGGG - Intronic
936706398 2:115079924-115079946 AAGGAGAGGCTTTGTGATGATGG + Intronic
936879483 2:117232742-117232764 AAGCAGGGGCAGTGTCAGAAAGG + Intergenic
937093327 2:119221058-119221080 GAGGCAAGGAAGTGTGAGGACGG + Intergenic
937100592 2:119265124-119265146 AATGAGAGGCAGGGAGAGCATGG + Exonic
937556049 2:123157445-123157467 CAGGAGACGCAGTGTGTGAATGG + Intergenic
937985899 2:127637978-127638000 AAGGACAGAAGGTGTGAGGAGGG - Intergenic
938063023 2:128266961-128266983 AAGGAGAGCCAGGGTGGGGAGGG + Exonic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938155124 2:128930105-128930127 AAGCAGAGACTGTGGGAGGAAGG - Intergenic
938314428 2:130316122-130316144 AAGGAAAGGCAGTCTGAGGCCGG + Intergenic
938367509 2:130746348-130746370 TAGGAGAGGCAGTGCCAGGGAGG + Intergenic
938758552 2:134402593-134402615 TAGGAGAGGAAGTTTGGGGAAGG - Intronic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939024680 2:136997942-136997964 AAGGTAAGGCAGAGTGAGCAAGG + Intronic
939389849 2:141552986-141553008 ATGGAGAGGTAGTGGGAGAAGGG + Intronic
939779782 2:146431636-146431658 AGGGAGAGGCAGGGAGAGAAGGG + Intergenic
940043451 2:149385084-149385106 AAGGAGAGGAAATGAAAGGATGG - Intronic
940579193 2:155555219-155555241 AAAGAAAGGCATTGTTAGGAAGG + Intergenic
940766500 2:157795811-157795833 AAGGAGAGGTAGAGAGAGAATGG - Intronic
941178622 2:162232075-162232097 AAGGACAGGAAGTATTAGGATGG + Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
942629388 2:177939354-177939376 AAGGAGGGAGAGAGTGAGGAAGG + Intronic
942771542 2:179526711-179526733 TAGGAGAAGCAGTGTCAGCAAGG - Intronic
943248271 2:185483989-185484011 CAGGAGAGACAGTGAGAGCAGGG - Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944248395 2:197556684-197556706 AAGGAAAAGCAATGTGATGATGG - Intergenic
944471963 2:200063406-200063428 AAAGAGAGGGAGTTTGAGGTCGG - Intergenic
944648669 2:201806606-201806628 TAGGAGAGGCAGTGGGGGAAAGG + Exonic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945058101 2:205885638-205885660 AAGGAGAGGCTCTGCAAGGAAGG + Intergenic
945190304 2:207180760-207180782 AAGGAGGGGCAGTGGAAGGAAGG - Intergenic
945452659 2:210011472-210011494 AAGGAAAGGCACTGACAGGAAGG - Intronic
945633982 2:212323413-212323435 TAGGAAAGGTAGTGTGGGGAAGG + Intronic
946046572 2:216826342-216826364 AAGGAGAGCCCTTGTGAGGCAGG - Intergenic
946169852 2:217888421-217888443 AAGCAGAGGCAGTGTCAGACAGG + Intronic
946472584 2:219975925-219975947 TAGGAGAGGCTGTGTCAGGTGGG + Intergenic
946752766 2:222909254-222909276 AAGGAGAAGCAGTGTAGGAAGGG + Intronic
947907231 2:233774243-233774265 GAGGAGTGGCAGAGTGAGAAGGG + Intergenic
947916347 2:233834257-233834279 AGAGAGGGGCAGTGTGGGGAAGG + Intronic
948487142 2:238288329-238288351 AAGGTGAGGCAGCGTGTGTAGGG - Exonic
948761742 2:240196690-240196712 GAGGAGAGGCCATGTGAAGACGG + Intergenic
948902311 2:240962940-240962962 ATGGGGGGGCAGTGGGAGGAGGG - Intronic
948949091 2:241237206-241237228 CAGGAGAGGCAGTGGGAAGGGGG + Intronic
948982950 2:241504103-241504125 AAGGAAAGGCAGTTAGGGGAGGG + Intronic
949038414 2:241832068-241832090 GAGGGGAGGCAGTGAGGGGAGGG + Intergenic
1169087065 20:2833565-2833587 AAGGAAAGGCAGAGTGACAAGGG + Intergenic
1169151846 20:3295613-3295635 ACTGAGAGGGAGCGTGAGGATGG + Intronic
1169396429 20:5234862-5234884 AAGAAGAGGCAGTGATAGAAAGG + Intergenic
1169730038 20:8776882-8776904 AAGGAGGGGCGGTTTGGGGAAGG + Intronic
1170041708 20:12045491-12045513 AAGGAGAGGAGGGGAGAGGACGG - Intergenic
1170296545 20:14832436-14832458 ATGGAATGGCAGTTTGAGGAAGG + Intronic
1170406156 20:16039721-16039743 TAGAATAGGCAGTGTGAGAAAGG + Intronic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170702284 20:18714119-18714141 AAGGAAAGGCAGGATGAGAAAGG + Intronic
1172201026 20:33126004-33126026 GAGGAAAGGCAGTGTTGGGATGG + Intergenic
1172247846 20:33458175-33458197 AAAGAGAACCAGTGTGAGGGTGG + Intergenic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1172887664 20:38241904-38241926 AAGAAGAGGCAGTGTGAGTAGGG + Exonic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173458897 20:43225962-43225984 GGGGTGAGGCAGTGGGAGGAGGG - Intergenic
1173733193 20:45342480-45342502 AAGGGGAGGCAGGGAGAGGCTGG - Intronic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174420025 20:50393496-50393518 CAGGACAGGCAGTGTATGGAGGG - Intergenic
1174478098 20:50811531-50811553 ATGGAGTGGCAGGGAGAGGAGGG - Intronic
1174736656 20:52972050-52972072 AAAAGGAGGCAGTGTGATGATGG - Intergenic
1174856529 20:54050705-54050727 AAGGGGAGGCAGAGCGTGGACGG - Intronic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175682572 20:61001360-61001382 AAGGAGGGGTAGTGTGACCATGG + Intergenic
1175825866 20:61936353-61936375 AAGGGGAGGGGGTGTGGGGAAGG - Intronic
1175871241 20:62210427-62210449 AAGGAGAGGGGGTGGGGGGAAGG + Intergenic
1176031684 20:63015971-63015993 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031687 20:63015981-63016003 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031690 20:63015991-63016013 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031693 20:63016001-63016023 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031696 20:63016011-63016033 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176049015 20:63106846-63106868 AGCGAGCTGCAGTGTGAGGATGG + Intergenic
1176511308 21:7750661-7750683 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1177199640 21:17939627-17939649 AAGGAAAGGAATTGAGAGGATGG - Intronic
1177294452 21:19156609-19156631 AAGGAGAGACAGAGAGAGAATGG + Intergenic
1177328885 21:19629946-19629968 AGAGAGAGACAGTGTGAGGGAGG - Intergenic
1177440150 21:21112230-21112252 TAGGAGAGAAAGTGTGAGGGAGG - Intronic
1177580193 21:23011951-23011973 AAAGAGAGACAGAGAGAGGAGGG + Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1178293301 21:31387524-31387546 AAGGAGAGGCTGTATATGGATGG + Intronic
1178390884 21:32197217-32197239 AAGGACAGACATTGTGAAGAAGG - Intergenic
1178645422 21:34381190-34381212 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1178787631 21:35668221-35668243 GAGAAGAGGCCATGTGAGGATGG - Intronic
1178824667 21:36005031-36005053 AGGGAGAGGCAGGGGGAGGGGGG + Intergenic
1179119441 21:38529272-38529294 GAGGAGAGGCAGGGAGATGAGGG + Intronic
1179311366 21:40198742-40198764 CTGGAGAGGCAGTGGGAGGTGGG + Intronic
1179468747 21:41596641-41596663 AGGGAGAGGCCGTTTGAAGATGG + Intergenic
1179598825 21:42461906-42461928 CATCAGAGGCAGGGTGAGGAGGG + Intergenic
1179646967 21:42782046-42782068 AAGGAGAGGCAGGGGAGGGAAGG - Intergenic
1179680855 21:43020373-43020395 AGGGAGACGCTGTGTGAGGGAGG + Intronic
1179839246 21:44060052-44060074 AGGGAGATGAAGTGTGGGGACGG + Intronic
1180087870 21:45516145-45516167 AAAGAGAGGCCGGGTGAGGCGGG + Intronic
1180123224 21:45767897-45767919 AGGGGCAGGCAGTGTGAGCAAGG + Intronic
1180167296 21:46036727-46036749 GGGGAGAGGCAGTGGGAGGGAGG + Intergenic
1180832470 22:18913079-18913101 AAGGTGAATCTGTGTGAGGATGG + Exonic
1181018160 22:20083187-20083209 AAGGGGAGGCAGTTTTAGGAAGG - Intronic
1181067372 22:20313263-20313285 AAGGTGAATCTGTGTGAGGATGG - Intergenic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181885262 22:26017068-26017090 AGGGAGAGGCACAGAGAGGAAGG - Intronic
1182299513 22:29329839-29329861 CAGGAGGGGCAGTGTCTGGAGGG + Intronic
1182681254 22:32081834-32081856 GAGGAGAGGCGGAGTTAGGAGGG - Intronic
1182916576 22:34038372-34038394 AGGGAGAGGCAGTGAGAAGGAGG - Intergenic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184486944 22:44785480-44785502 AAGGGGAGGGTGTGTGAGGACGG - Intronic
1184821793 22:46915057-46915079 AAGTAGTGGCATTGGGAGGAAGG + Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185169035 22:49281500-49281522 AAGGAAGGGCACTGTAAGGATGG + Intergenic
1185394485 22:50579698-50579720 AAGGAGGGGCAGGGTGGGGTAGG - Intronic
1203282556 22_KI270734v1_random:138384-138406 AAGGTGAATCTGTGTGAGGATGG + Intergenic
949787449 3:7757586-7757608 AAGAGGAGGCAGTGTGACCATGG + Intergenic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
949892972 3:8746775-8746797 AGAGAGAGAGAGTGTGAGGAGGG - Intronic
950108304 3:10402293-10402315 AAGGAGAGGCAGAGGCAGGTTGG - Exonic
950388091 3:12675552-12675574 AAGAAGAGGCATTCTGGGGATGG - Intergenic
950487333 3:13281491-13281513 GAGGAGGAGCATTGTGAGGATGG - Intergenic
950551742 3:13670203-13670225 AAGGCGAGACAGTGTGTGAATGG + Intergenic
950894234 3:16433771-16433793 GAGGAGGGGAAGTGAGAGGATGG - Intronic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
951353799 3:21639676-21639698 ATGCATAGGCAGTGTTAGGATGG - Intronic
951532625 3:23711995-23712017 AAGTAGCGGCAGTTGGAGGAGGG - Intergenic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
953133914 3:40166678-40166700 CATGGGAGGCAGTGTGAGGCAGG + Intronic
953180208 3:40587988-40588010 AAGAAGAGGCCATGTGAGGAAGG - Intergenic
953341261 3:42135915-42135937 AAGAACAGCTAGTGTGAGGATGG - Intronic
953397138 3:42582130-42582152 ACGGAGAGGGAGTGTGACGGGGG + Intronic
954110778 3:48431612-48431634 ATGGAGAGGCAGTGATAGGGAGG - Intergenic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954861160 3:53691587-53691609 AAGGAGATACAGTGAAAGGAAGG + Intronic
954876533 3:53806211-53806233 AGGGAGAGGAAGGGGGAGGAGGG - Intronic
955050889 3:55409812-55409834 AAGGAGAGGGGATGTGGGGAGGG + Intergenic
955392336 3:58530798-58530820 CAGGAGAGGCACTGTGAAGCAGG - Intronic
955665612 3:61346298-61346320 GAGAAGAGGCAATGTGAAGATGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956121230 3:65967833-65967855 AAGGGAAGGAAGAGTGAGGAAGG + Intronic
956172986 3:66447336-66447358 ATGGGGAGGCAGTGTGGGGCTGG - Intronic
956530246 3:70211206-70211228 AAGGAAAGGAAGTGAAAGGAAGG - Intergenic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956961184 3:74402998-74403020 AATGAGAGGCATTGTGAGGTAGG + Intronic
957117534 3:76045816-76045838 AAGAAGAGGAAGAGAGAGGAAGG - Intronic
957792777 3:84960566-84960588 AAGAAGCGGCAGAGAGAGGATGG - Intronic
957883415 3:86251632-86251654 AAAGAGAGGCAGTGTTAAGTGGG + Intergenic
958971447 3:100615079-100615101 AAAGGCAGGCACTGTGAGGAAGG + Intronic
958990598 3:100839652-100839674 AAGAAGTGGCATCGTGAGGAGGG + Intronic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
960898672 3:122532386-122532408 TGGGAGAGGCATTGTGGGGAGGG - Intronic
961519755 3:127460153-127460175 GAGGAGAGGGAGTGTGAGAAAGG + Intergenic
961580716 3:127879724-127879746 AAGGGAAGGCTGTGTGAGGGAGG - Intergenic
962049399 3:131796828-131796850 AAGCAATGGCAGTGAGAGGAAGG - Intronic
962298868 3:134219170-134219192 AAGGGGAAGCAGTGTTAGCATGG - Intronic
962461389 3:135616764-135616786 AAGGAGAGGGAGAGAGAGAAAGG + Intergenic
962464914 3:135649188-135649210 AGGAAGCTGCAGTGTGAGGAAGG + Intergenic
962663327 3:137627412-137627434 CAGAGGAGGCAGTGTGAAGACGG - Intergenic
963071612 3:141309627-141309649 TAGGAGTTGGAGTGTGAGGAAGG - Intergenic
963320771 3:143807012-143807034 TCGGAGAGCCAGTATGAGGAAGG - Intronic
963520965 3:146359541-146359563 ATGGAGAGGCAGTGTGAGACTGG + Intergenic
963623999 3:147647900-147647922 AATGACAGGCAGTGTGAGTATGG - Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
964430028 3:156595613-156595635 AAAGAGAGGCAGTGGAAGGAGGG - Intergenic
964562800 3:158016812-158016834 AAGGAGAGTCAGTGTCAGAGTGG - Intergenic
965672978 3:171165794-171165816 AGTGAAAGGCAGTGTGAGGCTGG - Intronic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966474584 3:180329178-180329200 ATGTAGAGGCAGTGTGGAGAGGG - Intergenic
966555901 3:181259876-181259898 AAGGAAAGGCTGTGGAAGGACGG + Intergenic
966580274 3:181553755-181553777 AAGGAAAGGCAGAGAGAGAAGGG + Intergenic
967068057 3:185938091-185938113 GAGGAAAGGCAGAGCGAGGAGGG - Exonic
967274771 3:187763505-187763527 AAAGAGAGGAAGTATGGGGAGGG + Intergenic
967812917 3:193775542-193775564 AGGGAGTGGCAGTTGGAGGATGG - Intergenic
968000028 3:195199159-195199181 CAGGAGAGGCCGTGTGGGCAGGG + Intronic
968365794 3:198183859-198183881 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
968571756 4:1346006-1346028 AGCAAGAGGCAGGGTGAGGAAGG + Intergenic
968586038 4:1416489-1416511 AAGGAGAGGAAGGGTGGGCAGGG - Intergenic
968653007 4:1767424-1767446 AGGGAGAGGGAGGGGGAGGAGGG - Intergenic
968938367 4:3625131-3625153 AAGGAGAAGCAGTGTGGGATGGG + Intergenic
969119510 4:4897589-4897611 AAAGGGAGGCAGTGTGATAAGGG + Intergenic
969173043 4:5379248-5379270 AAAGAAAGGCAATGTGGGGAAGG - Intronic
969206663 4:5652277-5652299 GAGGAGAGGCTGCGTCAGGATGG + Intronic
969283894 4:6190563-6190585 AAGGAGAGGCCTGGGGAGGAAGG + Intronic
969465093 4:7351649-7351671 AGGGAGAGGAAGGGAGAGGAAGG - Intronic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
970349836 4:15191378-15191400 AAGGAGAGGAGGTTGGAGGAAGG - Intergenic
970478163 4:16445729-16445751 AAGGATAGGCCATATGAGGATGG - Intergenic
970837102 4:20422601-20422623 AATGAGAGGCAGTGGGCAGAAGG + Intronic
971262737 4:25071670-25071692 AAGGAGATGAAGTTGGAGGAAGG - Intergenic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
971557127 4:28027323-28027345 AAATAGAGGCAGTGTGATGTTGG + Intergenic
972012602 4:34203652-34203674 AGGAAGAGGCAGTGTGTTGAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972544894 4:40071153-40071175 AAGGAGAGGCAGAGTAGAGAAGG - Intronic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
973290923 4:48469661-48469683 AAGTAGATGCACTGTGAAGAGGG + Intergenic
973858658 4:55039034-55039056 AAAGAGAGGCTATATGAGGAAGG - Intergenic
974099576 4:57402021-57402043 AAGGAGAGAAAGAGTGAGGGAGG + Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975185523 4:71397792-71397814 AAGGAGAAGCAGTGTGTGAAGGG + Intronic
976097486 4:81524717-81524739 GAGAAGAGGCAGTGTCATGAAGG + Intronic
976230982 4:82842688-82842710 AACCAGAGGCAGTTTGGGGATGG - Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977600724 4:98931330-98931352 AGGGAGAGGAAGGGTGGGGAAGG - Intergenic
977795903 4:101164212-101164234 AGGGAGTGGCAGGGTGAGGGTGG - Intronic
978064621 4:104381126-104381148 GAGGACAGGCAGTTTAAGGAGGG + Intergenic
978280899 4:107012611-107012633 AAGGTGGGGAAGTGTGAGAATGG + Intronic
978348054 4:107792588-107792610 AAGGAGAGGCTCTGTTAGGGTGG + Intergenic
978971172 4:114807836-114807858 AGGAAGAGGCGGTGTGAGGGTGG - Intergenic
979033793 4:115685713-115685735 GAGGATAGAGAGTGTGAGGAAGG - Intergenic
979254829 4:118599013-118599035 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
979334132 4:119447005-119447027 GAGGAGAGGCAGGGGAAGGAGGG + Intergenic
979459837 4:120969573-120969595 AAGAGGAGGCAGTGTCAGTAAGG + Intergenic
979835343 4:125360050-125360072 AAGGAAAGGCAATGGCAGGAGGG - Intronic
980305938 4:131061516-131061538 AAGGACAGGGAGTGTGCAGACGG + Intergenic
981191394 4:141868981-141869003 AAGGAGAGGGAGAGAGATGAGGG + Intergenic
981232122 4:142369017-142369039 AAGAAGAGGAACTGGGAGGAAGG + Intronic
981459988 4:145002059-145002081 AAGGAGAAGTAGTGAGAGTAGGG - Intronic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
981702388 4:147620680-147620702 GAGGAGAAGCAGTGAGAGAAAGG + Intronic
981756241 4:148144164-148144186 TAGCAGAGGAAGTGAGAGGAGGG - Intronic
981924494 4:150123360-150123382 AAGGAGAGGGAGAGAGATGAGGG + Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982297016 4:153839549-153839571 AAGGAAAGGAAATGTGAGGAGGG - Intergenic
982452835 4:155572997-155573019 AAGGAAGAGCAGTGTGGGGAAGG + Intergenic
983635789 4:169896630-169896652 AAGGAAAGGCAGTCTGGGCATGG + Intergenic
983965318 4:173802258-173802280 AAGGAGAGGGATTGTGAAGGTGG + Intergenic
984261868 4:177452323-177452345 AAGGAGAGGCGGGGAGAGGAGGG - Intergenic
984612324 4:181855812-181855834 AAGGAGAGAAAGGGAGAGGATGG + Intergenic
984797461 4:183676635-183676657 AAGGAGAAGCATGGTGAGAAAGG - Intronic
984882342 4:184421100-184421122 AAGGAGAGGAAATGTCAGCAGGG + Intronic
985275257 4:188232236-188232258 AAGAAGAGGCAGGGTGTGGGTGG - Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985668284 5:1193059-1193081 AAGGAGAGGCAGTGAGTAGGGGG + Intergenic
985671020 5:1206728-1206750 AGGGACACGCAGCGTGAGGAGGG + Intronic
985802249 5:2012354-2012376 GAGGAAAGGCAGTGTGAAGATGG - Intergenic
985926924 5:3026265-3026287 AGGGAGAGGCAGGGTGGGCAGGG - Intergenic
986253672 5:6083678-6083700 GAAGAGGGGCAGTGAGAGGAGGG - Intergenic
986355104 5:6916079-6916101 AATGAGAGGAAGTGGCAGGAGGG + Intergenic
986648466 5:9941162-9941184 TGGGAGAGGCTGTGTGTGGAGGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
988424850 5:31052018-31052040 AAGGAGAAAAAGTGTGAGGTGGG - Intergenic
988493586 5:31726105-31726127 AAGGAAAGGCAGGCTCAGGACGG - Intronic
988610886 5:32723861-32723883 GAGGAGAGGAGGTGAGAGGAGGG - Intronic
988979656 5:36553941-36553963 AAGGAGAGGCAGACTCAGGGTGG + Intergenic
989135050 5:38145422-38145444 AGAGAGAGGCAGGGTGAAGATGG - Intergenic
990885930 5:60593486-60593508 AAGGAGAGGGAGAGTGATGGGGG - Intergenic
991261379 5:64671905-64671927 AACCAGAGGCAGTGGGAGGCAGG + Intergenic
991531558 5:67620646-67620668 CAGGTGAGGCAGTGTGAACAGGG + Intergenic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
992645276 5:78805901-78805923 AGGGAGAGGCACTGTGAGCTTGG + Intronic
992902801 5:81315835-81315857 CAGGAGTGCCAGTGTTAGGATGG - Intergenic
992997867 5:82350058-82350080 CAAGTGAGGCAGCGTGAGGATGG - Intronic
994056711 5:95424736-95424758 TGAGAGAGGCAGTGAGAGGAAGG + Intronic
994106874 5:95959416-95959438 AAGGAATGGCAGTGGGAAGAAGG - Intronic
995067486 5:107878779-107878801 CACGAGAGGCTCTGTGAGGATGG - Intronic
995183750 5:109251425-109251447 GAGAAGACGCAGTGTGAGGCGGG + Intergenic
995461181 5:112404908-112404930 AAAGTGAGGCCTTGTGAGGATGG - Intronic
996425388 5:123308097-123308119 GAGGAGAGGTAATATGAGGAAGG - Intergenic
997378610 5:133418677-133418699 AAGGAGAGTGACTGAGAGGATGG + Intronic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
998619993 5:143783110-143783132 AAGGTGATGCAATTTGAGGAGGG + Intergenic
998682846 5:144489121-144489143 AATGTGAGAGAGTGTGAGGAGGG + Intergenic
999812339 5:155139643-155139665 AAGCAGAGGAAGGGTGAGCAGGG + Intergenic
999895923 5:156033380-156033402 AAGGAGAGAGGGTGGGAGGAGGG - Intronic
1000100058 5:158007734-158007756 AAGGAGATGCTGTGGGAAGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000362988 5:160465541-160465563 AAAGAGAGGAATTGTGTGGAAGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000563127 5:162814880-162814902 AAGGAGAGGAAGGGAGAGGGAGG - Intergenic
1000627243 5:163553350-163553372 TAGGGGAGGCTGTGTGTGGATGG - Intergenic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1001744648 5:174082992-174083014 AAGCAGAGGAAGCCTGAGGAAGG - Intronic
1001744959 5:174085393-174085415 AAAGAGAACCAGTGTGAGGTGGG - Intronic
1001798318 5:174520507-174520529 AGGGAGAGGCGGGGAGAGGAGGG - Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002051437 5:176573871-176573893 GTGGAGAGGCTGTGTGGGGAGGG + Intronic
1002130925 5:177081230-177081252 AAGAAGAGGAAGAGTAAGGAAGG + Intergenic
1002461331 5:179375440-179375462 AAGGAGGGGGAGTGTGGGGAAGG - Intergenic
1002725019 5:181289079-181289101 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1003474344 6:6467705-6467727 AGTGATAGGCAGTGTGAGGCTGG - Intergenic
1003631873 6:7794730-7794752 AAGGTGAGGAAATGTGAGGCAGG + Intronic
1003667531 6:8125658-8125680 AAGGGGGTGAAGTGTGAGGATGG - Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004243851 6:13953441-13953463 TAGGAGAGACTGGGTGAGGATGG + Intronic
1004270127 6:14187620-14187642 AAGTCCAGGCAGTGAGAGGAAGG + Intergenic
1004952977 6:20694935-20694957 AAGGGGAGTCAGTGTGTGCAGGG - Intronic
1005141701 6:22639306-22639328 AAGCAGAAGCAATGTGATGAGGG - Intergenic
1005406902 6:25498996-25499018 AAGGTCAGGGAGTGGGAGGAGGG + Intronic
1006133359 6:31881665-31881687 AGGGACAGGCAGTGAGTGGATGG + Intronic
1006205934 6:32342896-32342918 AAGGAGAAGCAGTTAAAGGAAGG + Intronic
1006256347 6:32835564-32835586 GAGGAGAGGCTGTGGGTGGAAGG + Intronic
1006258667 6:32850980-32851002 AAGCAGAGGCAGGGTGATCAGGG + Exonic
1006362526 6:33594791-33594813 AGGCAGATGCAGTGAGAGGATGG - Intergenic
1006707940 6:36038120-36038142 AAGGAGAGTGAGTGCTAGGATGG + Intronic
1007389376 6:41541457-41541479 AAGGAGAGGCACAGTGGGGAGGG + Intergenic
1007520101 6:42445398-42445420 AAGAACAGGCAGTGTGAAGGAGG - Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007936531 6:45737469-45737491 GAGCAGAGCCAGTCTGAGGAGGG - Intergenic
1008379042 6:50822198-50822220 ACAGAGAGACAGTGAGAGGAGGG - Intronic
1008729444 6:54462956-54462978 AGGGAGAGGAAGTGAGAGGAAGG - Intergenic
1008787702 6:55189401-55189423 CATGAGAGGCAGTCTGAAGATGG + Intronic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1010332112 6:74635350-74635372 AAGGTGAGAAAGAGTGAGGAAGG - Intergenic
1011069933 6:83369638-83369660 AAAGAGAGACAGAGAGAGGAAGG + Intronic
1011259105 6:85453377-85453399 GAGGAGGGGAATTGTGAGGAAGG + Intronic
1011360337 6:86517356-86517378 AAGGGGATGCATTATGAGGAGGG - Intergenic
1013057951 6:106603462-106603484 AAGAACATGCAGTATGAGGATGG - Intronic
1013305248 6:108841689-108841711 CAGATGAGGCAGTTTGAGGAAGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1014638438 6:123878790-123878812 AAGGAGAGGCAGTGGAGAGATGG - Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015771204 6:136769927-136769949 AAAAAGAGACAGTGGGAGGAAGG + Intronic
1016373389 6:143396686-143396708 ACGGAGAGGCAGTGTAAACATGG + Intergenic
1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG + Intronic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016718743 6:147267574-147267596 AAGGAGAGGTAAGGTAAGGAAGG - Intronic
1016922859 6:149313457-149313479 AAGGAGAGGAAGGGTGACGAGGG - Intronic
1017625609 6:156345391-156345413 AAGGAGAGGGAGAGATAGGAAGG - Intergenic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1018146746 6:160898695-160898717 GAGGAGGGGGAGTGAGAGGAGGG - Intergenic
1018245253 6:161816351-161816373 AAGGGGAGGCAGAGTGGGGTGGG + Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018417948 6:163617626-163617648 AAGCAGAGGCCTTGTGATGATGG + Intergenic
1018844739 6:167547618-167547640 AAGGAGTGACAAGGTGAGGAGGG - Intergenic
1018961480 6:168452363-168452385 AAGCAGGGGGAGTGTGAGGCGGG + Intronic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019437098 7:1028009-1028031 CAGGAGAGTAAGTGGGAGGAGGG + Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019888262 7:3924258-3924280 AAGGAGAGGATGAGTTAGGATGG + Intronic
1020126247 7:5533957-5533979 AGGGAGGGGCAGTGTGAGGCAGG - Intronic
1020514133 7:9094764-9094786 AGGTAGAGGAAGTGGGAGGAGGG + Intergenic
1020603616 7:10307353-10307375 AAGGGGAGGGAGTGTGCGAATGG - Intergenic
1020739087 7:11990510-11990532 AAGGAGAGGCAGTGGGACATGGG - Intergenic
1021108841 7:16671191-16671213 AAGGACAGGAAGTATGGGGATGG - Intronic
1021622023 7:22557987-22558009 AAAGTGAGAAAGTGTGAGGAAGG - Intronic
1022341189 7:29469707-29469729 AAGGATAGGAAGTGAGAGGGAGG - Intronic
1022446287 7:30473267-30473289 AAGGAGAGGGAGGATGAGTAAGG + Intronic
1022843832 7:34190608-34190630 AAGGTCAGGCAGCCTGAGGATGG - Intergenic
1023036526 7:36135948-36135970 CAGGAGAGGCAGTGGGTGGCAGG + Intergenic
1023135462 7:37047292-37047314 AAGGAAAGGCAGAGACAGGAAGG - Intronic
1023241390 7:38151402-38151424 ATGGGGAGGAAATGTGAGGACGG - Intergenic
1023677254 7:42643367-42643389 GTGGAGAGGTAATGTGAGGATGG - Intergenic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023935082 7:44734158-44734180 AGGGAGAGGGAGTGGAAGGAAGG - Intergenic
1024069920 7:45776692-45776714 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1024843168 7:53611165-53611187 GAGGAGAGGAAGTGTGAGTGGGG - Intergenic
1025035597 7:55591029-55591051 GCTGAGAGGCAGTGTCAGGATGG + Intergenic
1025259855 7:57411613-57411635 AAGGAGAGGGTGAGAGAGGAGGG + Intergenic
1026103104 7:67398847-67398869 AGGGAGAGGGAGTGAGATGAGGG + Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026906026 7:74063239-74063261 CAGGAGGGGCAGGGTGGGGAGGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028096216 7:86764217-86764239 AGGGAGAGGTAGTGGGAGGATGG + Intronic
1028528186 7:91808724-91808746 AATGAGAGGTAGTGGGGGGAGGG + Intronic
1029361226 7:100089734-100089756 AAGGAGGAGCAGTGTGAGAGTGG + Exonic
1029477723 7:100794910-100794932 GAGGAGAGGAAGGGAGAGGAGGG + Intronic
1030929344 7:115503168-115503190 AAGGAGAGAGGGTGTAAGGAGGG - Intergenic
1030996684 7:116367967-116367989 AGGGAGAGGAAGTGTGGTGAAGG - Intronic
1031070359 7:117154911-117154933 AAGGGGAGGGAGTGTAAGAAGGG + Intronic
1031151682 7:118061313-118061335 GGGGAGAGGAGGTGTGAGGAGGG - Intergenic
1031490714 7:122384253-122384275 AAGGGAATGCATTGTGAGGAAGG + Intronic
1032047318 7:128620978-128621000 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1032192255 7:129771832-129771854 AAGGAGAGGCTTGGTGGGGAAGG + Intergenic
1032211208 7:129915759-129915781 AAAGACAGGCAGAGTTAGGAGGG - Intronic
1033349714 7:140552356-140552378 AAGGAGAGGGAGAGGGAGGGAGG - Intronic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034433661 7:151053081-151053103 AAGAAGAGGCAGGGAGAAGACGG + Intergenic
1034511208 7:151536248-151536270 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034511212 7:151536315-151536337 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034670600 7:152854766-152854788 AGGGAGAGCGAGGGTGAGGAGGG - Exonic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1035737790 8:1901299-1901321 CAGGAGAGTCACTGGGAGGAAGG - Intronic
1036728579 8:11242014-11242036 AAGGAAAGGCCATGTGAGGATGG + Intergenic
1036812882 8:11879844-11879866 AAGGACAGGCAGAGTGGGGCAGG - Intergenic
1037503174 8:19505210-19505232 AATCAGAGGCCGTGTAAGGACGG + Exonic
1037648576 8:20816245-20816267 AGGCAGAGGGAGTGTGAGGGAGG - Intergenic
1038060349 8:23905444-23905466 AAGAAGAGGAAATGTGGGGAGGG - Intergenic
1038239790 8:25797859-25797881 AAGGAGAGGCTGGGTTACGAGGG + Intergenic
1038328840 8:26591830-26591852 AGGGGGAGGCAGTGCCAGGATGG - Intronic
1038701830 8:29856147-29856169 AAGAAAAGGCTGTGTGAAGAAGG + Intergenic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039337175 8:36603893-36603915 AAGAAGTAGCAGTGTTAGGAAGG - Intergenic
1039569442 8:38575395-38575417 AATGAGAGGCAGAGCCAGGAGGG - Intergenic
1039896575 8:41720706-41720728 AAGGAGGGGCACTGGGAGGGAGG + Intronic
1039950189 8:42164948-42164970 AAGGGGAGGGAGAGAGAGGAAGG + Intronic
1040300850 8:46187287-46187309 ACGGGGAGGCAGTGTGACGTGGG - Intergenic
1040334434 8:46408879-46408901 ACGGAGAGGCAGAGTGAAGTGGG + Intergenic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1040794136 8:51271221-51271243 AAGGAGAGGCGAGGTGTGGAGGG + Intergenic
1040904893 8:52457798-52457820 AGGGAGAGGAAGTGAGAGGGAGG - Intronic
1041167190 8:55102054-55102076 GAGGAGAGGAAGCGGGAGGAGGG + Intergenic
1041423330 8:57693498-57693520 AAGGAGGTGGAGTGTGAGGGGGG + Intergenic
1043602062 8:81952594-81952616 GAGGAGAGGGAGGGAGAGGAGGG - Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1044644228 8:94421066-94421088 AAGCAGAGGCAGTGTGGGGGTGG - Intronic
1045025228 8:98080702-98080724 AAGGAGAGGGAGGGGGAGGGGGG - Intronic
1045756613 8:105550702-105550724 AAGGAGAGGCTGTGTGAATCAGG + Intronic
1045996256 8:108365447-108365469 AAGGAAAGGAAGAGTGAGGCCGG - Intronic
1046388830 8:113541008-113541030 AAGGATAGGGAGTGGGAGGTTGG - Intergenic
1046494779 8:114999025-114999047 AAAGAGAGGTAGAGTGAAGAAGG - Intergenic
1046538985 8:115554846-115554868 AAGGCGTGCCAGTGTGAAGAGGG + Intronic
1047213722 8:122860140-122860162 AAGGAGACGCAGTGAGCGAAGGG + Intronic
1047214297 8:122864203-122864225 AGGGACAGGCAGTGGGAGGAGGG + Intronic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1048200621 8:132371169-132371191 AAGGAGAGTCAGATTGAAGATGG - Intronic
1048562694 8:135558986-135559008 AAGAGAAGGCAGTGTGAGGACGG - Intronic
1048618242 8:136103186-136103208 AAGGTGAGAGGGTGTGAGGAAGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048696260 8:137031631-137031653 AAGGGGAGGAAGGGAGAGGAGGG - Intergenic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1049310437 8:141931257-141931279 AAGGAGAGGCCTGGGGAGGAGGG + Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049361149 8:142213075-142213097 AAAGAGAGGGAGAGTGAGGGAGG - Intronic
1049397266 8:142406805-142406827 ACGCAGAGGCAGTGTCATGAGGG + Intergenic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049593048 8:143471313-143471335 CAGAAGAGGCAGTGTGGGGCGGG + Intronic
1049616388 8:143577497-143577519 AAGGAGGGGCTGGGTGAGGGTGG - Intronic
1049796906 8:144501094-144501116 GAGGAGAGGGAGTGAGGGGAAGG - Intronic
1049812738 8:144582756-144582778 AAGGAGGGCCAGTGAGAGAAGGG + Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1050718446 9:8557064-8557086 AAGGAGGACCAGTGAGAGGAAGG + Intronic
1051527232 9:18059185-18059207 GAGGAGAGACAATGTGATGAGGG - Intergenic
1051642449 9:19236473-19236495 AAGTAGAGGCTGTGTCATGAAGG + Intronic
1051857474 9:21585494-21585516 AAGGAGGAGCTGTGTGAAGATGG + Intergenic
1053004741 9:34596963-34596985 AGGGAGAGGGAGTGGGAGGTGGG + Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053522195 9:38791504-38791526 AGGGATAGGAAGTGTGTGGAGGG - Intergenic
1054194422 9:62015968-62015990 AGGGATAGGAAGTGTGTGGAGGG - Intergenic
1054452848 9:65412679-65412701 AAGGAGAAGCAGTGTGGGATGGG - Intergenic
1054643985 9:67572722-67572744 AGGGATAGGAAGTGTGTGGAGGG + Intergenic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055677775 9:78682798-78682820 AAGGGGAGGAAGAGAGAGGAAGG - Intergenic
1055820190 9:80252990-80253012 AAGGTGAGGCAGAGAGGGGAAGG + Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056661489 9:88547028-88547050 AAGCAGTGGCAGTGTGATGTGGG + Intronic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1057029908 9:91767728-91767750 AACCAGGGGCAGTGTCAGGAAGG + Intronic
1057144724 9:92750023-92750045 AAGGTGAAGAAGTGTGATGAGGG - Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057272272 9:93657904-93657926 AGGGTGAGACAGTGGGAGGATGG + Intronic
1057499392 9:95584684-95584706 AATGAGAGGTGGTGGGAGGAAGG + Intergenic
1058862245 9:109127723-109127745 GAGGTGAGGCAGAGTGAGCAGGG - Intergenic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1059146160 9:111901528-111901550 AGTGAGGGGCAGTGTGGGGAGGG + Intronic
1059406383 9:114100202-114100224 ATGGAGAGGTAGTTTGAGGCTGG + Intergenic
1059670440 9:116485908-116485930 AGGAAGAGGCAGGGAGAGGAAGG + Intronic
1060243313 9:121923740-121923762 AAAGAGAGTCAGTGTGATGTTGG - Intronic
1060403231 9:123360447-123360469 AAGGAGGGGCGGGGTGTGGAGGG - Intronic
1060405521 9:123371145-123371167 AAGGAAAGACACTGTGAGGTTGG - Exonic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1061753935 9:132799747-132799769 GAGGAGAGGCAGTGTGGGTGCGG - Intronic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1061900401 9:133669310-133669332 AGGGAGAGGGAGGGTGAGGGAGG - Intronic
1061900416 9:133669350-133669372 AAGGAGTGTCAGAGTGACGAGGG - Intronic
1062042777 9:134411806-134411828 AAGGAGAGGCACTGGCAGCAGGG - Intronic
1062113760 9:134796684-134796706 AGGGTGAGGCAGGGTGAGGGAGG + Intronic
1062158177 9:135065654-135065676 AGAGAGAGGCAGGGTAAGGAAGG - Intergenic
1062185643 9:135216860-135216882 AAGGAGAGTGAGTGTGAGTGAGG + Intergenic
1062750163 9:138246726-138246748 GAGGAGAGGCAGGGGCAGGAGGG - Intergenic
1185495498 X:551264-551286 AAGGAGAGAGAGAGAGAGGAAGG - Intergenic
1186078776 X:5908064-5908086 GAGGAGAGACAGTGGAAGGAGGG + Intronic
1186116070 X:6306442-6306464 GGTGAGAGTCAGTGTGAGGATGG + Intergenic
1186387769 X:9127405-9127427 AAAGATTGGAAGTGTGAGGAGGG - Intronic
1186556706 X:10567456-10567478 AAGCAGAGGCTGTGTGCGCAGGG + Exonic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187505329 X:19874527-19874549 CAGGAGAGGAAGTGTGGAGAAGG + Intronic
1187677221 X:21728192-21728214 AAGGAGGGGAAGGGAGAGGAGGG - Intronic
1187726589 X:22209665-22209687 GAGGAGAGGGAGGGAGAGGAAGG - Intronic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188583335 X:31742491-31742513 AAGGAGAGGAAGAGAGATGAGGG + Intronic
1188611621 X:32106527-32106549 AAGGAGAGGCTGTCTGAGTAGGG + Intronic
1188878973 X:35468659-35468681 CAGGGAAGGCAGTGTGGGGAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189588670 X:42488574-42488596 AGGGAGAGAGAGTGAGAGGAAGG - Intergenic
1190057415 X:47189793-47189815 AAGGAGAGGGAGAGGGAGGGTGG - Intergenic
1190169921 X:48104101-48104123 TAGGAGAGGCACTGTCAGGAAGG + Intergenic
1190175333 X:48144275-48144297 TAGGAGAGGCACTGTCAGGAAGG - Intergenic
1190187846 X:48251440-48251462 TAGGAGAGGCACTGTCAGGAAGG + Intronic
1190220790 X:48511221-48511243 AAAGAGAGGGAGTGGGAGGAAGG - Intronic
1190221812 X:48516747-48516769 GAGCAGAGGTAGGGTGAGGAGGG + Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190656728 X:52619207-52619229 TAGGAGAGGCACTGTCAGGAAGG + Intergenic
1190953692 X:55171274-55171296 AGGGGGAGTGAGTGTGAGGAGGG + Intronic
1191929841 X:66359232-66359254 CAAGAGGGGCAGTGTGAGGTGGG + Intergenic
1192133185 X:68572137-68572159 GAGCAGAGGAAGTGTGAGCATGG - Intergenic
1192185052 X:68941000-68941022 GAGGGGAGGAAGGGTGAGGAGGG + Intergenic
1193037022 X:76962395-76962417 AAGGAGAGAAGGTGAGAGGAGGG - Intergenic
1193428368 X:81368949-81368971 AAGGTGAGTAAGAGTGAGGAAGG - Intergenic
1194093104 X:89602350-89602372 AGAGAGAGGGAGTGAGAGGACGG - Intergenic
1194280014 X:91939394-91939416 AAGGAGAGGAGGTGTGAGACAGG + Intronic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194652368 X:96531294-96531316 AAAGAGAGTCAGTGGGAAGATGG + Intergenic
1194988728 X:100521349-100521371 AAGAAGAGGGAGAGTGAGGGAGG + Intergenic
1195616959 X:106920198-106920220 CAGGAGAGGCCTTGTGGGGAGGG - Intronic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1196460724 X:115926842-115926864 AAGGTGAGGGAGTGGGAGTAGGG + Intergenic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197196738 X:123709952-123709974 AAGGAGAAGCAGTGTGTGCAAGG + Intronic
1197231358 X:124007171-124007193 AAGGAGAGGGAGGGAGAGGGAGG - Intronic
1197371044 X:125626940-125626962 TATGAGAAGCAGTGTCAGGACGG + Intergenic
1197371152 X:125627678-125627700 CATGAGAAGCAGTGTCAGGACGG - Intergenic
1198034605 X:132788439-132788461 AAGGAGAGGGAGAGAGATGAAGG - Intronic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198376464 X:136045096-136045118 TAGGGGAGGGAGAGTGAGGAGGG + Exonic
1198388542 X:136150345-136150367 AAGGAGAGGCATGGGGAAGAAGG - Intronic
1198466689 X:136909979-136910001 AAGGGGAGGAACTGTGAGGAAGG - Intergenic
1199506041 X:148562720-148562742 AAAGAGAGGAAGAGAGAGGAAGG - Intronic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1200445738 Y:3258453-3258475 AGAGAGAGGGAGTGAGAGGACGG - Intergenic
1200597488 Y:5162895-5162917 AAGGAGAGGAGGTGTGAGACAGG + Intronic
1201146075 Y:11066423-11066445 AGGGAGAGGAAGGGAGAGGATGG + Intergenic
1201146085 Y:11066451-11066473 AGGGAGAGGAAGGGAGAGGAAGG + Intergenic
1201146237 Y:11066938-11066960 AGGGAGAGGGAGGGAGAGGAAGG + Intergenic
1201146281 Y:11067075-11067097 AAGGAGAGGGAGGGAGAAGAAGG + Intergenic
1201146356 Y:11067305-11067327 AAGGAGAGGAAGGGAGAGGGAGG + Intergenic
1201146615 Y:11068128-11068150 AGGGAGAGGGAGTTAGAGGAAGG + Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201516636 Y:14825332-14825354 GAGGAGAGACAGTGGAAGGAGGG - Intronic