ID: 927713835

View in Genome Browser
Species Human (GRCh38)
Location 2:25340945-25340967
Sequence GGCCCGCGGTGGGGACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 515}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927713816_927713835 18 Left 927713816 2:25340904-25340926 CCACATTGCGGCGCCGCCACCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713826_927713835 -10 Left 927713826 2:25340932-25340954 CCCGGGCACCCACGGCCCGCGGT 0: 1
1: 0
2: 0
3: 7
4: 112
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713811_927713835 25 Left 927713811 2:25340897-25340919 CCCGCCCCCACATTGCGGCGCCG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713821_927713835 2 Left 927713821 2:25340920-25340942 CCACCGCGGCCGCCCGGGCACCC 0: 1
1: 0
2: 9
3: 89
4: 724
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713807_927713835 30 Left 927713807 2:25340892-25340914 CCCGCCCCGCCCCCACATTGCGG 0: 1
1: 0
2: 2
3: 27
4: 310
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713813_927713835 21 Left 927713813 2:25340901-25340923 CCCCCACATTGCGGCGCCGCCAC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713809_927713835 29 Left 927713809 2:25340893-25340915 CCGCCCCGCCCCCACATTGCGGC 0: 1
1: 0
2: 1
3: 15
4: 260
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713822_927713835 -1 Left 927713822 2:25340923-25340945 CCGCGGCCGCCCGGGCACCCACG 0: 1
1: 0
2: 1
3: 28
4: 302
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713810_927713835 26 Left 927713810 2:25340896-25340918 CCCCGCCCCCACATTGCGGCGCC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713820_927713835 5 Left 927713820 2:25340917-25340939 CCGCCACCGCGGCCGCCCGGGCA 0: 1
1: 0
2: 4
3: 83
4: 450
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713814_927713835 20 Left 927713814 2:25340902-25340924 CCCCACATTGCGGCGCCGCCACC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713812_927713835 24 Left 927713812 2:25340898-25340920 CCGCCCCCACATTGCGGCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 84
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713815_927713835 19 Left 927713815 2:25340903-25340925 CCCACATTGCGGCGCCGCCACCG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515
927713824_927713835 -7 Left 927713824 2:25340929-25340951 CCGCCCGGGCACCCACGGCCCGC 0: 1
1: 0
2: 0
3: 25
4: 261
Right 927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927713835 Original CRISPR GGCCCGCGGTGGGGACAGGG AGG Intronic
900095148 1:937218-937240 GGCCCGGGCTGGGAACAGGATGG - Intronic
900291634 1:1926192-1926214 GGGCCGCAGTGTGGCCAGGGTGG + Intronic
900332695 1:2144145-2144167 GGCCAGCGGAGAGGACAGGCAGG - Intronic
900389572 1:2428108-2428130 GGGCCATGCTGGGGACAGGGTGG - Intronic
900527260 1:3135289-3135311 GGTCTGCGGTGGGGGCAGGGCGG + Intronic
900563852 1:3322818-3322840 GCCCCAGGATGGGGACAGGGAGG + Intronic
900634911 1:3658164-3658186 GGACCGTGGAGGGGACATGGGGG + Intronic
900650943 1:3729842-3729864 GGCCATGGTTGGGGACAGGGAGG + Intronic
901066501 1:6497087-6497109 GCACCGCGGTGGGGGCAGAGCGG + Exonic
901086375 1:6614297-6614319 GGTCCGCGGAGGGGACGCGGAGG - Intronic
901466020 1:9421761-9421783 GGCAGGCAGAGGGGACAGGGAGG - Intergenic
901551255 1:9997560-9997582 AGACGGCCGTGGGGACAGGGGGG - Intronic
901853281 1:12029415-12029437 GGCCTGCAGTCTGGACAGGGTGG + Intronic
901863441 1:12089054-12089076 GGCCCAGGCTGGGGTCAGGGAGG - Intronic
902581541 1:17410735-17410757 GGCCCGAGGTGGGGCCTGGCAGG - Intronic
902585731 1:17437954-17437976 GGCCCGCGGCGGGGGAGGGGCGG - Intronic
902622134 1:17656701-17656723 GACCAGCGGTGAGGACTGGGGGG + Exonic
902815433 1:18913726-18913748 CGCCTGGGGTGGGGTCAGGGCGG + Intronic
903672749 1:25046181-25046203 GGCCTGGGGTGGGGCCCGGGAGG + Intergenic
903681517 1:25100671-25100693 GGCCCTGTGTGGGGACAGGGAGG - Intergenic
904301564 1:29557746-29557768 GGGTCGGGGTGGGGACAGGGTGG - Intergenic
904483289 1:30807383-30807405 GGCCCGGGGCGGGGGCGGGGTGG - Intergenic
904591414 1:31617622-31617644 GGCCGGCGGGAGGGGCAGGGCGG - Intergenic
904622973 1:31786560-31786582 GGCCCGGGGTGGGGCCAGGCAGG + Intergenic
905094317 1:35456144-35456166 GGCCTGCGTTGGCCACAGGGGGG + Exonic
905153104 1:35948465-35948487 GGCCGGCGGTGGGGTGGGGGCGG - Intronic
905182382 1:36175292-36175314 GGCTGGGGGTGGGGACAGGCAGG + Intronic
905239396 1:36572123-36572145 GGGCCGAGGTGGGGACAGCTGGG - Intergenic
905239403 1:36572143-36572165 GGGCCGAGGTGGGGACAGCTGGG - Intergenic
906240382 1:44239006-44239028 GGGCAGCAGTGGGGAGAGGGAGG - Intronic
906500931 1:46341459-46341481 GGCCGGCAGTATGGACAGGGTGG - Intronic
907261284 1:53220535-53220557 CGCCCGCCGCGGGGACACGGAGG - Intronic
908473823 1:64470176-64470198 AGCAAGCGGTGGGGAAAGGGAGG - Intergenic
909431183 1:75589694-75589716 TGCCAGAGGTGGGGGCAGGGTGG - Intronic
912384144 1:109262977-109262999 GGCCCGGGGTGGAGCCAGGCTGG + Intronic
913971804 1:143422339-143422361 GGCCCTCAGTGGGGACTGGGAGG - Intergenic
914066183 1:144247952-144247974 GGCCCTCAGTGGGGACTGGGAGG - Intergenic
914112970 1:144718402-144718424 GGCCCTCAGTGGGGACTGGGAGG + Intergenic
914704026 1:150157023-150157045 GGCTCACTGTGGGGAGAGGGAGG + Intronic
915835327 1:159171620-159171642 GGGCCGAGGTGGGGACCGGGAGG - Exonic
916107328 1:161441355-161441377 GGTCCGGGGTGGGGACGCGGGGG + Intergenic
916108915 1:161448773-161448795 GGTCCGGGGTGGGGACGCGGGGG + Intergenic
916110503 1:161456154-161456176 GGTCCGGGGTGGGGACGCGGGGG + Intergenic
916112088 1:161463564-161463586 GGTCCGGGGTGGGGACGCGGGGG + Intergenic
916113675 1:161470945-161470967 GGTCCGGGGTGGGGACGCGGGGG + Intergenic
916974581 1:170062009-170062031 GTCACGTGGTGGGGAGAGGGGGG + Intronic
917869464 1:179229180-179229202 GGCCGGGGGTGGGGTCGGGGCGG - Intronic
918487479 1:185045283-185045305 GGACCGCGGTGGGCGCCGGGGGG + Intergenic
920345201 1:205301784-205301806 GGCAGGTGGTGGGGGCAGGGTGG + Intergenic
920385662 1:205568962-205568984 GGCCCGCGGCGGGGAGGGAGGGG - Exonic
920501850 1:206490543-206490565 GGGCCGGGGTGGGGACGTGGGGG - Intronic
922485827 1:225972465-225972487 GCCCCGGGGTGGGCACAAGGTGG + Intergenic
923291167 1:232547561-232547583 GGCCCGGGGTGGGGGCTGGGTGG + Intronic
923391130 1:233515273-233515295 GGCCCGGGGTGGGAAGTGGGAGG + Intergenic
923608057 1:235463216-235463238 GGGACTTGGTGGGGACAGGGTGG + Intronic
1063652018 10:7947269-7947291 GGCCTGCGGTGGGGGCTGGAGGG - Intronic
1064274192 10:13891762-13891784 GGGCGGCGGCGGGGACGGGGCGG - Intronic
1067807921 10:49405934-49405956 GGACCTGGGTGGGGACAGGCAGG - Intergenic
1067977362 10:51041468-51041490 GGCCCGTGGTGGGTACAGCCTGG + Intronic
1069909922 10:71752705-71752727 GGGCCAGGATGGGGACAGGGAGG - Intronic
1070805600 10:79268978-79269000 GACCAGCGGGTGGGACAGGGAGG + Intronic
1072687993 10:97550092-97550114 GGCCAGCTGTTGGGACAAGGAGG + Intronic
1072717064 10:97759354-97759376 GGCCAGGGGTGGGGAGAGTGGGG - Exonic
1073540257 10:104312063-104312085 GGGCAGAGTTGGGGACAGGGGGG - Exonic
1073820682 10:107260132-107260154 GGGCCTCGGAGGGGAAAGGGTGG + Intergenic
1074227037 10:111494555-111494577 GGCCAGAGGTGGGGAAGGGGTGG + Intergenic
1074829866 10:117240961-117240983 CGGCCGAGGCGGGGACAGGGAGG + Intergenic
1075083169 10:119397257-119397279 GCCCCGAGGTGGGGTCGGGGTGG - Intronic
1075263084 10:120979758-120979780 GGCTCGCGGTAGGGACACGTGGG - Intergenic
1075438386 10:122461404-122461426 CGCCCGCGGAGGGGGCAGGGCGG - Intergenic
1075651470 10:124130342-124130364 GGGCTGTGGTGGGGACAGCGGGG + Intergenic
1075800749 10:125152041-125152063 GGCCCGCGGAGGGGCCAGGGTGG + Intronic
1076522115 10:131087822-131087844 TGGCCGGGGTGGGGACGGGGTGG + Intergenic
1077010084 11:375783-375805 GGCCCGCGCGGGGGCGAGGGCGG + Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077146787 11:1050076-1050098 GGCCTGAGGTGGGGCCCGGGCGG + Intergenic
1077250576 11:1558945-1558967 GGCCCACGCTGGGCACAGGCAGG + Exonic
1077308066 11:1876687-1876709 GGCCCTCAGCGGGGACTGGGAGG + Intronic
1077311088 11:1889409-1889431 GGCCCGGGGTGCGGTGAGGGCGG + Exonic
1077441755 11:2572136-2572158 GGCCCAGGTTGGGGACAGGACGG + Intronic
1077479642 11:2807630-2807652 AGCCGGCGGTGGGCACAGGCGGG + Intronic
1077601926 11:3580542-3580564 GGCCTGTGGTGGGGGTAGGGGGG - Intergenic
1078317353 11:10304682-10304704 AGCCCGCGGAAGGGACAGCGCGG - Intronic
1078699538 11:13668205-13668227 GGCCCGCGCGGGAGACAGCGGGG - Intergenic
1079114960 11:17634955-17634977 GGCCCGGGGTGGGGAGGGTGGGG + Intronic
1079375301 11:19886984-19887006 GGCTGGGGGTGGGGAAAGGGGGG - Intronic
1079426039 11:20342976-20342998 GGCCCCCGCTGGAGCCAGGGAGG + Intergenic
1081569303 11:44279622-44279644 GGCCCGAGATGGGGACTTGGGGG - Intronic
1081705645 11:45180843-45180865 GGCGCGCGGTGGGGAAGGGGAGG - Intronic
1083194849 11:61079801-61079823 GCCCAGCTTTGGGGACAGGGTGG - Intergenic
1083261996 11:61528232-61528254 AGCCAGCGGTGGGGACATGGGGG - Intronic
1083292092 11:61696061-61696083 GCCTGGTGGTGGGGACAGGGAGG - Intronic
1083319193 11:61834946-61834968 GGCCCAGGGTGCGGGCAGGGAGG - Intronic
1083592686 11:63904693-63904715 ACCCTGTGGTGGGGACAGGGAGG - Intronic
1084054859 11:66625612-66625634 GGCCCGGGGTGGGGAGAGGCGGG - Exonic
1084129114 11:67119585-67119607 GCCCCGGGGGGCGGACAGGGCGG - Intronic
1084435623 11:69137635-69137657 GGCCTGGGGTGGGGCCAGGTGGG + Intergenic
1084814925 11:71640149-71640171 GGCTTGTGGTGGGGGCAGGGGGG + Intergenic
1084933206 11:72573436-72573458 GGGACGCGGCGGGGACGGGGGGG - Intergenic
1085076611 11:73597737-73597759 GGCCGGGGGTGGGGTGAGGGTGG - Intronic
1085123621 11:73982888-73982910 GGCCCGGGGTGGGGCCTGCGGGG + Exonic
1085442082 11:76574670-76574692 GGCTCATCGTGGGGACAGGGAGG + Intergenic
1085442097 11:76574744-76574766 GGGCCTTGGTGGGGAGAGGGAGG + Intergenic
1087053081 11:93905627-93905649 GGCCCTCTGTGGGGAAAGGGAGG - Intergenic
1089586520 11:119513078-119513100 GGCCCTTGGTGGGGAAACGGAGG - Intergenic
1090939126 11:131372219-131372241 GGCAAGGGGTGGGGACAGGAGGG + Intronic
1091703395 12:2678581-2678603 GGCCCGCGGCCGGGAGAGAGCGG - Intronic
1091907482 12:4200658-4200680 GGCCAGTGCTGAGGACAGGGGGG - Intergenic
1091930124 12:4389319-4389341 GGCCCTGGGTGGGGACAGCGAGG - Intergenic
1091973761 12:4809514-4809536 GCCCCGCGGTGGACGCAGGGCGG + Exonic
1092428072 12:8389885-8389907 GGCCTGTGGTGGGGGTAGGGGGG - Intergenic
1093972344 12:25386391-25386413 GGGCCGCGGGCGGGACAGCGGGG + Intergenic
1094199354 12:27780571-27780593 GGCCCGCGCGGGGAAAAGGGCGG + Exonic
1094555693 12:31497807-31497829 GGGCAGCGGAGGGGGCAGGGAGG + Intronic
1096475747 12:51907705-51907727 GGTCCGCGGACGGGACCGGGTGG + Intronic
1096575127 12:52548122-52548144 GGGCTGAGGTGGGGCCAGGGAGG - Intronic
1096976211 12:55700509-55700531 AGCCTGGGTTGGGGACAGGGTGG - Intronic
1097054260 12:56240460-56240482 GGGCTGCGGTGGGGAGAGGGGGG + Exonic
1097190257 12:57216389-57216411 GGGCCGAGGTGGGGACGGGCGGG - Intergenic
1098929298 12:76391922-76391944 GCCAAGGGGTGGGGACAGGGAGG + Intronic
1099228124 12:79993310-79993332 AGCCCACGGCGGGGAGAGGGGGG + Intergenic
1099989816 12:89709532-89709554 GCCGCGCGGTCGGGAAAGGGTGG + Intergenic
1101168270 12:102061799-102061821 GGCCCGAGGCCGTGACAGGGTGG + Intronic
1101308320 12:103553671-103553693 GGGCTGGGGTGGGGACTGGGAGG - Intergenic
1102691276 12:114763023-114763045 TCCCCGAGGTGGGGGCAGGGAGG - Intergenic
1103400732 12:120641177-120641199 GGCCCGCGGGCGGGATGGGGAGG + Exonic
1103553462 12:121751872-121751894 GGCCCATGCTGGGGACAGGCAGG - Intronic
1103566172 12:121817013-121817035 GGCCTGGGGTGGAGACAGGAGGG - Exonic
1103782617 12:123409111-123409133 GGCCCGAGGTGGGGTTGGGGGGG - Exonic
1104001636 12:124863975-124863997 GGCCCGGGGCGGGGTCGGGGCGG + Intronic
1104799020 12:131540755-131540777 GGCAAGTGGTGGGGACTGGGAGG + Intergenic
1104943413 12:132405213-132405235 GGCCCTCGGCGGGGACAGCTGGG - Intergenic
1105217895 13:18300132-18300154 GGCCCGAGGTGGGGTTGGGGGGG - Intergenic
1105628624 13:22138665-22138687 GGACAGAAGTGGGGACAGGGTGG + Intergenic
1105891718 13:24686897-24686919 GGGCTGGGGTGGGGGCAGGGAGG + Intronic
1106042858 13:26110357-26110379 GTCACGGGGTGGGGAAAGGGGGG + Intergenic
1108578319 13:51807883-51807905 GGCCAGAGGTGGGTACAAGGTGG - Intergenic
1110439077 13:75507583-75507605 GGCAAGCGGTGGGGGCTGGGGGG + Intergenic
1111113596 13:83748058-83748080 AGCCTGGGGTGGGGAAAGGGAGG + Intergenic
1111811433 13:93096976-93096998 GGCCGGGGGTAGGGAGAGGGGGG - Intergenic
1113744444 13:112733345-112733367 GATCCGCAGTGGGGACAGGATGG + Intronic
1113820176 13:113208379-113208401 GGGCCGCCGTGGGGGCCGGGCGG - Intronic
1113857888 13:113458762-113458784 TGCCCGCCGAGGGGGCAGGGAGG + Intronic
1114539709 14:23446061-23446083 GGCCCGCAGTGGGGAGGAGGGGG - Intergenic
1118339147 14:64879999-64880021 GTCCCGCGGCGGGGGCGGGGAGG + Intergenic
1118854617 14:69611544-69611566 GCCCCGCGGAGGGGAGGGGGCGG - Intergenic
1119437992 14:74610688-74610710 CGCCCGCGGTGGGCAGGGGGTGG + Intronic
1119932975 14:78566146-78566168 GGCCGGCGTTGGGGGCGGGGTGG - Intronic
1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG + Intronic
1121330449 14:93046345-93046367 GCCCCACGGTGGGGACAGCAGGG + Intronic
1121520263 14:94581346-94581368 GTCCCGGGGCGGGGCCAGGGAGG + Intronic
1121779122 14:96610553-96610575 GCCCCGGGTTGGGGTCAGGGAGG + Intergenic
1122234853 14:100325749-100325771 GGCCCACGGTGAGGAGAGTGGGG - Intronic
1122307149 14:100773330-100773352 GGCCTGTGGTTGGGGCAGGGGGG + Intergenic
1122502632 14:102211449-102211471 GGCCCACGATGGGCACAGGGTGG - Intronic
1122545059 14:102517358-102517380 GGACCGCGCTGGGCGCAGGGAGG + Intergenic
1122556206 14:102581751-102581773 GCCCCATGGTGGGGACAGTGGGG + Intergenic
1122582006 14:102777187-102777209 GGCGCGCGGCGGGGACGGGAGGG + Intergenic
1122887588 14:104717287-104717309 TGCCCGGGGGGGGGACTGGGAGG - Intronic
1122904545 14:104795755-104795777 GGCGCGGGGCGGGGAGAGGGCGG - Intergenic
1124629335 15:31327873-31327895 GGCGCGAGGTGGGGGCCGGGCGG + Intronic
1124937475 15:34186529-34186551 GGCAGGAGGTGGGGACAGGCGGG + Intronic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1128161093 15:65423104-65423126 GGTCCCCGGCGGGGCCAGGGTGG - Intergenic
1128269213 15:66293819-66293841 CGCCAGCGGCGGGGACACGGAGG + Intronic
1129871731 15:78945505-78945527 GGAGCGAGGTGGGGACAGGCAGG - Intronic
1129871775 15:78945631-78945653 GGTGCGAGGTGGGGACAGGCAGG - Intronic
1129871875 15:78945949-78945971 GGTGCGAGGTGGGGACAGGAAGG - Intronic
1131056641 15:89378918-89378940 GGCCCGCTGTGCGGACCGAGGGG - Intergenic
1131250280 15:90825748-90825770 AGCCCACGGTGGGGAGGGGGAGG - Intergenic
1131257365 15:90871510-90871532 GGCCCGCAGTCGGGCCCGGGCGG + Intronic
1132651145 16:1021935-1021957 GGCCCGCGCTGGGGTGTGGGAGG - Intergenic
1132686820 16:1165710-1165732 GAGCCGGGGTGGGGGCAGGGAGG - Intronic
1132763663 16:1523796-1523818 GGCCACCGGTGGGGACCTGGGGG - Intronic
1132778918 16:1612470-1612492 GGCCCGCGGAGGGGACGTGCCGG + Intronic
1132798857 16:1741637-1741659 GGCCCCTGGTGCAGACAGGGCGG + Intronic
1132885053 16:2178887-2178909 GGCCCGCGGTAGGTGCGGGGCGG - Exonic
1132909281 16:2299978-2300000 CGCCTCCTGTGGGGACAGGGAGG - Intronic
1132994613 16:2816775-2816797 AGCCCGCAGTGGGGACAGCCTGG + Intergenic
1133213141 16:4273901-4273923 AGCCCGCGGAGGGAACAGTGCGG - Intergenic
1133229694 16:4360702-4360724 GGCCAGCAGTGAGGAGAGGGGGG - Intronic
1133229724 16:4360789-4360811 GGCCAGCAGTGAGGAGAGGGGGG - Intronic
1133230505 16:4364423-4364445 GGCCGGCAGTGGGGAGATGGGGG + Intronic
1134163834 16:11915174-11915196 GGCCCGCGGCGGTGGCCGGGCGG - Intronic
1134207516 16:12250073-12250095 GGACTGTGGTGGGGACAGGCAGG + Intronic
1134554648 16:15154821-15154843 GGGGCGCGGTGGGGGCGGGGCGG + Intergenic
1136519674 16:30787298-30787320 GGACAGCGGTGGGAGCAGGGAGG + Intergenic
1136910512 16:34141220-34141242 GGGGCGGGGTGGGGGCAGGGCGG - Intergenic
1137300438 16:47143700-47143722 GGCCGGCGATGGGGACGGAGTGG - Exonic
1137576141 16:49601579-49601601 GGCACATGGTGGGGACAGGCTGG + Intronic
1137718054 16:50611039-50611061 GCCCAGCTGTGGGGGCAGGGAGG - Intronic
1137787769 16:51151917-51151939 GTCCCGCGGCGGGATCAGGGGGG + Intergenic
1138273066 16:55710002-55710024 GGCCTTCTCTGGGGACAGGGTGG - Intergenic
1138279389 16:55761439-55761461 AGCCTGGGGAGGGGACAGGGCGG + Intergenic
1138289140 16:55832238-55832260 AGCCTGGGGAGGGGACAGGGCGG - Intronic
1138349816 16:56340549-56340571 GGCCCCAGGTGGGGGCAGTGAGG - Intronic
1139466157 16:67155201-67155223 GGCCCGGGGTGGCGACGGGGAGG - Exonic
1139746416 16:69078228-69078250 GGCCCGCTGTGGGGAAGGGTCGG + Intronic
1139780619 16:69348474-69348496 GGCGCGGGGTGGGGAGCGGGTGG + Intronic
1139955723 16:70692154-70692176 GGCCAGCCGTGGGTTCAGGGTGG + Intronic
1140902572 16:79383216-79383238 GGACTGGGGTGGGGGCAGGGTGG + Intergenic
1141397009 16:83714031-83714053 GGCCAGCGATGGGTATAGGGTGG - Intronic
1141682580 16:85553232-85553254 CGCGCGGGGTGGGGGCAGGGAGG + Intergenic
1141689514 16:85588343-85588365 GGCCCGCAGCGGGGAAGGGGGGG - Intergenic
1141698508 16:85631944-85631966 GGCCCGCCTTGGGGGCAGCGTGG + Intronic
1142142674 16:88479548-88479570 GGGCCACGGTGGGGACAGAGAGG - Intronic
1142185629 16:88693532-88693554 GGCCGGGGGTGGGGAGGGGGTGG - Intergenic
1142265681 16:89063076-89063098 CGCCGGCGGTGGGGGCAGGTGGG - Intergenic
1142285866 16:89171353-89171375 GGGCCGGGGTGGGGCCGGGGCGG - Intergenic
1142509769 17:386094-386116 GGCCGGCGGGGCGCACAGGGAGG - Intronic
1142698940 17:1648244-1648266 GGCCTGCGCTGGGAACTGGGAGG - Intronic
1142708233 17:1709760-1709782 GGCCGGTGGTGGGGATGGGGCGG - Intronic
1142708281 17:1709892-1709914 GGCATGGGGTGGGGACATGGGGG + Intronic
1142751889 17:1994030-1994052 AGCCGGGGGTGGGGACTGGGGGG - Intronic
1142809067 17:2386861-2386883 GGCCCCCAGTGGGGACAGGGAGG - Exonic
1143174907 17:4950032-4950054 GGCCTGGGGTGGGGGCTGGGAGG + Intronic
1143411863 17:6713877-6713899 GGCCCGCGGTGCGGAGGGCGCGG - Intergenic
1143515472 17:7417469-7417491 GGCCCGCGGCGGGGAGCAGGGGG - Exonic
1143528907 17:7489361-7489383 GGCACACGGTGGGCACAGTGAGG + Intronic
1143565287 17:7717202-7717224 GGCGCGGGGCGGGGAAAGGGAGG - Intergenic
1143595026 17:7909038-7909060 GGCCAGCAGTGAGGGCAGGGTGG + Intronic
1143904691 17:10198916-10198938 GGGCCGGGGCGGGGCCAGGGCGG + Intergenic
1144100664 17:11939579-11939601 GACCTGCGGTGTGGACAGGAAGG - Intronic
1144679747 17:17185130-17185152 GGCCAGCAGTGGGGGCTGGGAGG + Exonic
1145263966 17:21370650-21370672 GGCCCCACGTGGGGACAGGGAGG + Intergenic
1145694248 17:26774657-26774679 AACCCGCGGTGGGGGCGGGGGGG - Intergenic
1146270930 17:31485383-31485405 TGCCCATGGTGGGGACAGGGAGG + Intronic
1147192698 17:38747220-38747242 GGCCCACCGTGGAGACAGGCAGG + Intronic
1147395700 17:40140796-40140818 GGGGCGGGGTGGGGACCGGGCGG + Intronic
1147451827 17:40510471-40510493 ATGCCGCGGTGGGGCCAGGGAGG - Intergenic
1147585687 17:41652899-41652921 GGCCCAGGGTGGGCCCAGGGTGG - Intergenic
1147951937 17:44112341-44112363 GGCCAGCGGTGGGGAGGGCGGGG - Intronic
1148553608 17:48564785-48564807 GGACAGGAGTGGGGACAGGGAGG + Intronic
1148680668 17:49471777-49471799 GGCCAGAGGTGGGGTCAGAGAGG - Intronic
1148686852 17:49505913-49505935 GGCCCGCGGGGAGGGCTGGGTGG + Intronic
1148736056 17:49865536-49865558 GGCACAAGGTGGGGAGAGGGCGG - Intergenic
1148911311 17:50944541-50944563 TGCCCGCGGTCGGGCCGGGGAGG + Intergenic
1149614657 17:57988036-57988058 GGGGCACGGGGGGGACAGGGGGG - Intronic
1150387615 17:64773952-64773974 GGCCCTGAGTGGGGACAGGTGGG + Intergenic
1150823848 17:68457530-68457552 GGGGCGGGGTGGGGACGGGGCGG - Intergenic
1150823863 17:68457557-68457579 GGGGCGGGGTGGGGACGGGGCGG - Intergenic
1150823878 17:68457584-68457606 GGGACGCGGCGGGGACGGGGCGG - Intergenic
1151195850 17:72430731-72430753 TGTCCGCGGTGAGGACAGTGAGG - Intergenic
1151212888 17:72558089-72558111 GGCCCTAGGTGGGGAAAGTGAGG - Intergenic
1151431483 17:74066467-74066489 AGCCCCAGGTGGGGACAGAGGGG - Intergenic
1151499527 17:74480092-74480114 TGTCCCAGGTGGGGACAGGGAGG + Intronic
1151655714 17:75495046-75495068 GGCGTGGGGTGGGGACGGGGTGG + Intronic
1151848420 17:76674478-76674500 GGCCAGGGGTGGGGCCTGGGCGG + Exonic
1152245353 17:79182459-79182481 GGCCTGCACTGGGGACAGAGGGG - Intronic
1152357923 17:79815509-79815531 GGACCGCGGGCGGGACAGGAGGG + Intergenic
1152527273 17:80895519-80895541 GGCACTGGGTGTGGACAGGGTGG - Intronic
1152655130 17:81515715-81515737 GGTTGGCGGTGGGGACTGGGGGG - Intronic
1152714530 17:81892043-81892065 GGCTCGCGGTGGGGTCCGGCGGG + Intronic
1152932146 17:83115471-83115493 TGCCCTCGGTGGGGAGAGTGAGG + Intergenic
1154500137 18:14991981-14992003 GGCCAGTGGAGGGAACAGGGTGG + Intergenic
1155152472 18:23134417-23134439 GGGCGGGGGCGGGGACAGGGTGG - Intergenic
1156266970 18:35497902-35497924 GGCCCGCGCTGGGAAAAAGGTGG - Exonic
1156268062 18:35506032-35506054 AGGCCTTGGTGGGGACAGGGTGG + Intergenic
1158435898 18:57435536-57435558 CGCCCGGGGTGGGGGCGGGGTGG - Intergenic
1158836292 18:61334232-61334254 CGCCTGCAGAGGGGACAGGGTGG + Intronic
1159085377 18:63783759-63783781 GGCAAGAGGTGGGCACAGGGAGG - Intronic
1160011293 18:75108731-75108753 GGCCCTCGGTGGAGGCAGGGAGG - Intergenic
1160021522 18:75185318-75185340 GCCCCTCGGTGGGCACTGGGTGG + Intergenic
1160747935 19:720373-720395 GGCCCGGGGAGGGGCGAGGGGGG + Intronic
1160767730 19:815846-815868 GGGCAGCTGTGGGGACAAGGTGG + Exonic
1160992209 19:1864418-1864440 CGCCCGCGGCGGGGCCCGGGAGG + Intergenic
1161032577 19:2064988-2065010 GGCCTGTGGCGGGGACAAGGAGG + Intergenic
1161087458 19:2341583-2341605 CGACAGCGGTGGGGACCGGGCGG - Intronic
1161141487 19:2650829-2650851 GGCCAGCAGTGGAGACAAGGAGG + Intronic
1161574966 19:5049999-5050021 GGCCCGAGGAAGGGAGAGGGGGG - Intronic
1161576168 19:5055605-5055627 GGCCCGTGATGGGGGCTGGGAGG + Intronic
1161818975 19:6517233-6517255 GGTCCTCTGTGGGTACAGGGTGG + Intergenic
1161967892 19:7558833-7558855 TGTCCGCTGTGGGGCCAGGGGGG - Exonic
1162065710 19:8124044-8124066 GTCCCGCAGTGGGCACAGTGTGG - Intronic
1163243047 19:16076194-16076216 AGCCCGCGGCGGGGCCAGGCCGG + Intronic
1163314609 19:16533225-16533247 GGGGCGGGGTGGGGACATGGTGG + Intronic
1163771123 19:19192050-19192072 GGCCTGCGGGCGGGACAGAGGGG - Intronic
1163783386 19:19261855-19261877 GGCCCGGGCCGGGGATAGGGGGG + Intronic
1163822172 19:19502311-19502333 GGCCTGCAGTGGAGAAAGGGGGG - Exonic
1164634440 19:29782033-29782055 GGCCCGAGCTGGGGACTGAGTGG - Intergenic
1164693633 19:30227874-30227896 GGCCGGCGGAGGGGACCGGCGGG + Intergenic
1164834562 19:31349295-31349317 GGCCCGCGGGGGGGCGAGGCGGG + Exonic
1165300232 19:34963936-34963958 GGACCGCGAGGGGGACAGTGAGG - Exonic
1165318891 19:35074138-35074160 GGGCAGAGGTGGGGCCAGGGTGG - Intergenic
1165862018 19:38914251-38914273 GGGCCCAGGTGGGGTCAGGGAGG + Intergenic
1166232515 19:41433432-41433454 GGACTGCGGTGGGGAGAGGGTGG + Exonic
1167207159 19:48110465-48110487 GGCAAGCCGTGGGGGCAGGGAGG - Exonic
1167244192 19:48364066-48364088 GGCCGGCGGTGGAGAAAGGCAGG - Exonic
1167266997 19:48488199-48488221 GGGCCTCTGTGAGGACAGGGTGG - Intronic
1167303963 19:48696351-48696373 GGCCCGGGGTGGAGAAGGGGAGG - Intronic
1167608293 19:50493336-50493358 GGCCTGCGGAGGGGAGAGGGAGG + Intergenic
1168069971 19:53943613-53943635 GCACTGGGGTGGGGACAGGGTGG + Exonic
1168267431 19:55230458-55230480 CTCCCGGGGTGGGGGCAGGGCGG - Exonic
1168317971 19:55492289-55492311 GGGACGTGGTGGGGACACGGAGG + Intronic
925298846 2:2795688-2795710 GGCCTGCTGTGGGGAGCGGGGGG + Intergenic
926075388 2:9938549-9938571 GGCCAGGTGTGGGCACAGGGTGG + Intergenic
926165316 2:10519222-10519244 TGCCCGTGGTGGGAACATGGAGG - Intergenic
926284978 2:11481933-11481955 CGGCGGCGGTGGGGAGAGGGCGG + Intergenic
927710465 2:25322636-25322658 GGGCGGCAGTGGGGACAGTGTGG - Intronic
927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG + Intronic
928067069 2:28175466-28175488 TGCTGGCAGTGGGGACAGGGTGG - Intronic
929588913 2:43132812-43132834 GGCCCGGGGTGGGTAGAGGTAGG - Intergenic
931204957 2:60137905-60137927 TGCCCTCTGTGGGGAGAGGGAGG - Intergenic
931348829 2:61470819-61470841 GGGCGGCGGCGGGGACGGGGCGG + Intergenic
934176494 2:89583271-89583293 GGCCCTCAGTGGGGACTGGGAGG - Intergenic
934286804 2:91657632-91657654 GGCCCTCAGTGGGGACTGGGAGG - Intergenic
934296410 2:91746533-91746555 GGCCCGAGGTGGGGTTGGGGGGG + Intergenic
934736434 2:96692017-96692039 GGCGGGGGGGGGGGACAGGGTGG + Intergenic
934975090 2:98796487-98796509 GGCCAGGTGTGGGGACAGGAAGG - Intronic
935021588 2:99237566-99237588 GGTCAGCGGTGGGGGCAGTGTGG + Intronic
935123281 2:100200231-100200253 GGCCCTCGGTGCGGTCAGGGAGG + Intergenic
937047126 2:118857737-118857759 GGCCCGCGGAGAGCCCAGGGCGG + Intergenic
937125591 2:119473358-119473380 GGCCCTGGGAGAGGACAGGGTGG - Intronic
937287627 2:120763144-120763166 GGCCTGTGGTGGGGGCAGGAAGG - Intronic
937305696 2:120869165-120869187 TGGCCCCAGTGGGGACAGGGAGG + Intronic
938140662 2:128791921-128791943 AGCCCTGTGTGGGGACAGGGAGG + Intergenic
942120678 2:172773637-172773659 GGTCCGCGGGGGGGGCAGTGTGG - Intronic
944128929 2:196325035-196325057 TGCCCGTGGTGGGCACAGGTGGG + Exonic
944728402 2:202495537-202495559 GGCCCAGGATGGGGACATGGCGG + Intronic
946174075 2:217912103-217912125 GGCCCAAGGTGGGGCCAGGAGGG + Intronic
946175768 2:217921249-217921271 GGCCCACAGTGGGCACAGAGTGG + Intronic
947586853 2:231361796-231361818 GGCCCCCGGAGAGGACAGGCAGG + Intronic
947590446 2:231382242-231382264 GGCCGTGGGTGGGGACAGGCAGG + Intergenic
947634750 2:231674305-231674327 GGCCTGTGGTGAGGACAGGAGGG - Intergenic
948216621 2:236237502-236237524 GGGCCGGGGTAGGGACGGGGCGG + Intronic
948828077 2:240583771-240583793 GGCCAGCAGTGGGGTCATGGCGG + Intergenic
948957762 2:241307072-241307094 GGGGGGCGGGGGGGACAGGGGGG + Intronic
1168895129 20:1319095-1319117 GGCCTGGGGTGGGGGCAGGTGGG - Intronic
1169145340 20:3248636-3248658 GGCCCGGGGTGTGGTCAGGTGGG + Intergenic
1170438131 20:16350876-16350898 GGCACGGGGTGGGCACTGGGGGG + Intronic
1170634400 20:18092270-18092292 GGAAGGGGGTGGGGACAGGGAGG - Intergenic
1171013562 20:21521719-21521741 GGGCCGCGGTGAGGAAGGGGCGG - Intergenic
1171088800 20:22264798-22264820 GGCATGGGGTGGGGACAGAGTGG + Intergenic
1171293007 20:23993440-23993462 GGCCTGCGGAGAGGCCAGGGTGG + Intergenic
1174379635 20:50148358-50148380 AGACTGAGGTGGGGACAGGGAGG + Intronic
1174383596 20:50172844-50172866 GGCCTGCAGAGGGGACAGGCAGG + Intergenic
1175248844 20:57597054-57597076 GGCCTGAGGTGGGGTCAGGCGGG - Intergenic
1175249101 20:57598178-57598200 GGCCGGGGGTGGGGAAAGGGGGG - Intergenic
1175443870 20:59007448-59007470 GGCCGGCGGCGGGGTCAGGCTGG - Intergenic
1175921677 20:62453167-62453189 GACCCCCGGTGGGGACTGTGTGG + Intergenic
1176025460 20:62983200-62983222 GGCCTGTACTGGGGACAGGGAGG - Intergenic
1176241673 20:64078466-64078488 GACCCTGGGTGGGGACAGAGAGG - Intronic
1177640107 21:23834668-23834690 GGCACAAGATGGGGACAGGGTGG - Intergenic
1178724329 21:35037559-35037581 TGCCCGTGGAGGGGACAGGTCGG - Intronic
1179295725 21:40060563-40060585 GGCCCGGGGTGGGGTAGGGGTGG + Intronic
1179435960 21:41362283-41362305 GGCTGGCCCTGGGGACAGGGTGG + Intronic
1179810112 21:43865013-43865035 GGGACGCGGAGGGGACACGGGGG - Intergenic
1179955290 21:44735013-44735035 GGCCTGGGGTTGGGAGAGGGAGG - Intergenic
1179970806 21:44836066-44836088 GGGACGGGGTGGGGACGGGGTGG - Intergenic
1180011412 21:45053902-45053924 GGCCTGGGCTGGGTACAGGGAGG + Intergenic
1180064263 21:45404987-45405009 GGCCCGGGGAGGGGAGAGGGGGG - Intergenic
1180073324 21:45449534-45449556 CCCCCACGGTGGGGGCAGGGTGG - Intronic
1180109832 21:45642749-45642771 GGCGGGCGGAGGGGACAGGGCGG + Intergenic
1180144213 21:45910289-45910311 GGGCCGTGCTGGGGACAGGGAGG + Intronic
1180156932 21:45982468-45982490 GTCCCTCGGTGGGGACGGTGGGG - Intronic
1180701871 22:17785604-17785626 GGCCCAGGGTGGGGCCAGGGTGG - Intergenic
1180782776 22:18530056-18530078 GTACCGCGGGGGGGACGGGGAGG - Intronic
1180824065 22:18851155-18851177 GGCCTGCGGAGAGGCCAGGGTGG + Intronic
1180967753 22:19799414-19799436 GGGCCGCGGTGGTGACGAGGAGG - Intronic
1181009596 22:20032631-20032653 GGGCAGGGGTGGGGACAGGCAGG + Intronic
1181110908 22:20602523-20602545 GGCTCCTGGTGGGGGCAGGGGGG - Intergenic
1181124491 22:20694309-20694331 GGCCTGCGGAGAGGCCAGGGTGG + Intergenic
1181188673 22:21123393-21123415 GGCCTGCGGAGAGGCCAGGGTGG - Intergenic
1181210526 22:21287100-21287122 GGCCTGCGGAGAGGCCAGGGTGG + Intergenic
1181239666 22:21469394-21469416 GTACCGCGGGGGGGACGGGGAGG - Intergenic
1181387639 22:22557643-22557665 GGGCGGCGGTGGGGACCGGGGGG + Intronic
1181398984 22:22639791-22639813 GGCCTGCGGAGAGGCCAGGGTGG - Intergenic
1181474207 22:23158647-23158669 GGCCAGAGGTGGGGCCAGGAGGG + Intronic
1181477973 22:23180413-23180435 GCCGCGCCGTGGGCACAGGGCGG - Exonic
1181501714 22:23319137-23319159 GGCCTGCGGAGAGGCCAGGGTGG - Intergenic
1181650436 22:24256268-24256290 GGCCTGCGGAGAGGCCAGGGTGG + Intergenic
1181706944 22:24654470-24654492 GGCCTGCGGAGAGGCCAGGGTGG - Intergenic
1182357709 22:29729792-29729814 AGGCCAGGGTGGGGACAGGGTGG - Exonic
1182469867 22:30542109-30542131 GGGTCGCGGTGTGGGCAGGGTGG - Intronic
1182845776 22:33429855-33429877 GGCCCGCTGTGGGTTCATGGAGG + Intronic
1183214148 22:36468231-36468253 GGCCAGGGCTGGGGGCAGGGAGG + Intronic
1183743249 22:39679688-39679710 GGGACGGGGTGGGGACAGGCGGG - Intronic
1183903478 22:41022640-41022662 TGCCCGCGGTGGGGGCAGGGAGG + Intergenic
1183930668 22:41234320-41234342 GCCCAGAGGTGGGGGCAGGGAGG + Intronic
1184241043 22:43211383-43211405 GGCGTGCGGGGGAGACAGGGAGG + Intronic
1184241359 22:43212713-43212735 GGCCTGGGGTGGGGACGGGGTGG + Intronic
1184303322 22:43577001-43577023 GGACAGGGGTGGGGTCAGGGTGG - Intronic
1184667807 22:45997765-45997787 GGCCCGTGCTGGAGGCAGGGCGG - Intergenic
1184693558 22:46128100-46128122 AGCCGGCGGTGGGGATGGGGTGG - Intergenic
1184778499 22:46635140-46635162 GGCCAGGGGTGGAGGCAGGGAGG - Intronic
1184778515 22:46635186-46635208 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778535 22:46635232-46635254 GGCCAGGGGTGGGGGCAGGGAGG - Intronic
1184778554 22:46635278-46635300 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778574 22:46635324-46635346 GGCCAGGGGTGGGGGCAGGGAGG - Intronic
1184778628 22:46635462-46635484 GGCCAGGGGTGGGGGCAGGGAGG - Intronic
1184778647 22:46635508-46635530 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184778666 22:46635554-46635576 GGCCGGGGGCGGGGGCAGGGAGG - Intronic
1184796973 22:46738291-46738313 GGACCGCGGAGGGGACGGGCGGG + Intergenic
1185047678 22:48537199-48537221 CACCCGGGGTGGGGGCAGGGTGG + Intronic
1185206393 22:49541488-49541510 AGCCCGCGGAGAGGACAAGGAGG - Intronic
1185223388 22:49640135-49640157 GGGCTGCCGTGGGGACAGGTTGG + Intronic
1185270269 22:49926671-49926693 GACCCGGGGTGGGGGGAGGGAGG - Intronic
1185270298 22:49926725-49926747 GACCCGGGGTGGGGGGAGGGAGG - Intronic
1185270316 22:49926758-49926780 GACCCGGGGTGGGGGGAGGGAGG - Intronic
1185270334 22:49926791-49926813 GACCCGGGGTGGGGGGAGGGAGG - Intronic
1185324235 22:50217873-50217895 GGGCTGCGGGGGGGCCAGGGCGG - Intronic
1203216420 22_KI270731v1_random:8330-8352 GGCCTGCGGAGAGGCCAGGGTGG - Intergenic
1203274206 22_KI270734v1_random:77059-77081 GGCCTGCGGAGAGGCCAGGGTGG + Intergenic
949260726 3:2099750-2099772 GGCCCGGGGAGGGGACGGGGCGG - Intronic
950412440 3:12847909-12847931 AGCCAGCAGTGGGGACAGGGAGG - Intronic
952211241 3:31231263-31231285 GGGCAGCGGTGGGGTCAGTGGGG + Intergenic
952414315 3:33076514-33076536 GGCCCACGGTGGTGACAATGAGG + Intronic
952970187 3:38645795-38645817 GGCGAGGGGTGGGGTCAGGGAGG - Intronic
953626647 3:44577676-44577698 GGCCAGCAGTGGGGGCTGGGCGG - Intronic
953982045 3:47417953-47417975 GGTGCGGGGTGGGGAGAGGGGGG + Intronic
954216284 3:49126250-49126272 GGCCCATGGTGGTGCCAGGGTGG - Intronic
954228658 3:49199566-49199588 AGCCAGAGGTGGGGACAGGAGGG + Intronic
954634011 3:52061830-52061852 AGCTAGCGGTGGGGACAGGGAGG - Intergenic
954708950 3:52495538-52495560 GGCCAGCGGTGGGAACAGGGAGG + Intronic
955060299 3:55487469-55487491 GGCCCGGGGCGGGGGAAGGGGGG + Exonic
955387707 3:58492359-58492381 TGCCCGCGGCGGGGCCTGGGCGG + Intronic
955636057 3:61030811-61030833 TGCCCGGGATGGGGGCAGGGGGG + Intronic
956568141 3:70662670-70662692 GTCCTGGGGTGGGGGCAGGGGGG + Intergenic
956677934 3:71753419-71753441 CGCCCGCGCTGGGGTCACGGTGG - Intronic
960617535 3:119609518-119609540 GGCCCACGTTGGGGGCATGGTGG + Exonic
961359418 3:126357552-126357574 GGGCCGGGGCGGGGCCAGGGCGG - Intergenic
962919232 3:139935822-139935844 GGCGCGCCGTGGGGACAAGCAGG + Intronic
963248289 3:143082910-143082932 GGCCTGAGGTGGGGGAAGGGGGG - Intergenic
964571588 3:158112796-158112818 GGCCTGAGGTGGGGGCATGGGGG - Intronic
966868522 3:184275954-184275976 CGCCCGGGGTGGGGGGAGGGTGG - Intronic
967424983 3:189316655-189316677 TGTGCGTGGTGGGGACAGGGGGG - Intronic
967877631 3:194277681-194277703 GGATGGTGGTGGGGACAGGGAGG - Intergenic
968288069 3:197519771-197519793 CCCCTGGGGTGGGGACAGGGAGG + Intronic
968442921 4:633674-633696 GACCTGCAGTGGGCACAGGGTGG - Intronic
968486728 4:866529-866551 GGTCAGCTGTGGGGACAGGCGGG + Exonic
968702927 4:2065263-2065285 GGCCTGCAGTGTGGGCAGGGTGG + Exonic
969016375 4:4106886-4106908 GGCCTGTGGTGGGGGCAGGGGGG - Intergenic
969431795 4:7159426-7159448 GGGAGGCGGTGGGGGCAGGGTGG - Intergenic
969461413 4:7331112-7331134 GGCTGGGGGTGGGGACAGGGTGG + Intronic
969626932 4:8310442-8310464 GGCCCTCGGCGTGGGCAGGGTGG - Intergenic
969629180 4:8325579-8325601 GGCCTGCAGTGCGGACAGGTTGG - Intergenic
970565371 4:17327114-17327136 GGAGCACGATGGGGACAGGGAGG - Intergenic
970636962 4:18021123-18021145 GGCCCCCGGCGGCGACAAGGGGG + Intronic
974861407 4:67526157-67526179 GGCCTGTGGTGGGGGGAGGGAGG + Intronic
977766654 4:100806258-100806280 GGCACGGGATGGGGACATGGAGG + Intronic
981532383 4:145764992-145765014 GCCCACCGGTGGGGACAGTGTGG + Exonic
982172846 4:152678522-152678544 GGGCGGCGGTGGGGGGAGGGGGG + Intronic
982573189 4:157076087-157076109 GGGCCGCAGCGGGGACAGCGCGG - Exonic
983238718 4:165207735-165207757 GGCGCGCGGTGAGGAGAGCGCGG + Intronic
985485578 5:146502-146524 GGGCCACAGTGGGGACAGGAGGG - Intronic
985573417 5:662675-662697 GAGCCGCGCTGGGGCCAGGGAGG + Exonic
985685081 5:1277652-1277674 GGTGGGCGGTGGGGACGGGGGGG + Intronic
991573201 5:68076881-68076903 GGGCAGCGGTGGGGAGAGAGAGG + Intergenic
997265166 5:132490976-132490998 GGCCCGCGGTGGCCCCGGGGCGG - Intergenic
997521113 5:134525334-134525356 GCCCGGCCCTGGGGACAGGGCGG + Intronic
998130361 5:139648657-139648679 GGCCCGAGGCGGGGAGGGGGGGG - Exonic
1001293885 5:170485418-170485440 GGCCCAGGGTGTGGACGGGGAGG + Intronic
1001839727 5:174864869-174864891 CTCCCTGGGTGGGGACAGGGTGG - Intergenic
1001958029 5:175861691-175861713 GGACCCAGGTGGGGACAGAGCGG + Intronic
1001959756 5:175872684-175872706 GCCACGGGGTGGGGACGGGGCGG + Intronic
1002316420 5:178347096-178347118 AGTGCGCGGTGAGGACAGGGAGG - Intronic
1002342682 5:178527179-178527201 GGCCCTCGGTGAGGAGAGTGGGG + Intronic
1002527715 5:179824108-179824130 GGCCTGGGGTGGGCTCAGGGTGG + Intronic
1003175812 6:3751675-3751697 GGCCCGCGTTCGGGGCAGCGGGG + Exonic
1006040931 6:31254302-31254324 GTCATGGGGTGGGGACAGGGGGG - Intergenic
1006105287 6:31712703-31712725 GACACTCGGTGGGAACAGGGTGG + Exonic
1006105708 6:31715191-31715213 GGGCCCCAGTGGGGACAGGGAGG - Intronic
1006369235 6:33633854-33633876 GGGCCGGGGCGGGGCCAGGGAGG + Intronic
1006392118 6:33764543-33764565 GGCCTGAGGTGGGGAGTGGGTGG - Intergenic
1006809567 6:36811145-36811167 GGCTGGGGGTGGGGACAAGGTGG - Intronic
1006838916 6:37015722-37015744 GGCCCGTGGCAGGGGCAGGGAGG - Intronic
1006863173 6:37187226-37187248 GGCCTGGGGTGGGGGCCGGGGGG + Intergenic
1006929821 6:37680958-37680980 GGCCCCAGTAGGGGACAGGGAGG - Intronic
1007106555 6:39287153-39287175 GGCTGGCGGTGGGGAAAGAGGGG - Intergenic
1007910008 6:45504119-45504141 GGCCCTTGGTGGGGACAAGGGGG + Intronic
1008027431 6:46653445-46653467 GGCCCGCGGTGGGAGGAGGAGGG + Intronic
1009899681 6:69796636-69796658 GGCGGGCGGCGGGGGCAGGGGGG - Intronic
1013283100 6:108657244-108657266 GGCCCACGTTGGGGACAAGCTGG + Intronic
1013721072 6:113028544-113028566 GGCTCTTGGTGGGGACATGGTGG - Intergenic
1014947702 6:127516426-127516448 GGCCCCCACTGGGGACCGGGTGG + Exonic
1014978274 6:127916340-127916362 GGACAGTGGTGGGGACTGGGTGG - Intronic
1017823418 6:158064756-158064778 GCCCCGCCGAGGGGGCAGGGTGG + Intronic
1018091191 6:160348152-160348174 GGCGCGCGGTGGGGCTCGGGCGG - Intergenic
1018574484 6:165245039-165245061 GGGCAGCGGAAGGGACAGGGTGG - Intergenic
1018778997 6:167045352-167045374 GGGCCGCGGGGGGGGCGGGGAGG - Exonic
1018955569 6:168408037-168408059 TGCCTGCTGTGTGGACAGGGTGG - Intergenic
1019197575 6:170291251-170291273 GGCGTGCGGAGGGGACGGGGCGG - Intergenic
1019352230 7:559685-559707 GGCTCGCTGTGGAGTCAGGGAGG + Intronic
1019524971 7:1476764-1476786 AGCCCAGGTTGGGGACAGGGAGG + Intronic
1019718668 7:2555088-2555110 AGCCGGCGGGGGGGAGAGGGGGG + Intronic
1019979319 7:4609542-4609564 GGGCCAGGGTGGGGGCAGGGGGG + Intergenic
1021183789 7:17539026-17539048 GGGACTCGGTGGGGAAAGGGTGG + Intergenic
1023819180 7:43970891-43970913 GGCCAGGGATGGGGGCAGGGCGG - Intergenic
1024586247 7:50844397-50844419 GGCCAAAGGTGGGGACAGAGAGG - Intergenic
1026824116 7:73570665-73570687 GGCCTCCTGTGGGGACCGGGCGG - Exonic
1026837186 7:73647130-73647152 GCCCAGAGGTGGGGGCAGGGTGG + Intergenic
1026969850 7:74461170-74461192 GGTCTGTGGTGGAGACAGGGTGG + Intronic
1027438479 7:78192884-78192906 GGCCCACGGTGGGGTGAGGTGGG + Intronic
1028125482 7:87108078-87108100 GTCCCATGGTGGGGACAGGGAGG - Intergenic
1029375036 7:100172037-100172059 GGCCCGGGGCGGGGACGGTGTGG - Intronic
1029640201 7:101815738-101815760 GGCCCGCGGAGGGGAGGGGGAGG + Intergenic
1029715277 7:102322137-102322159 GCCTGGCGGTGTGGACAGGGCGG + Intergenic
1029715287 7:102322174-102322196 GCCTGGCGGTGTGGACAGGGCGG + Intergenic
1029715297 7:102322211-102322233 GCCTGGCGGTGTGGACAGGGCGG + Intergenic
1029715307 7:102322248-102322270 GCCTGGCGGTGTGGACAGGGCGG + Intergenic
1029729972 7:102433063-102433085 GGCGGGGAGTGGGGACAGGGCGG - Intergenic
1031966706 7:128032313-128032335 GGCCCGGGGAGGGGGGAGGGGGG - Intronic
1032095288 7:128935178-128935200 AGGAGGCGGTGGGGACAGGGAGG - Intergenic
1032121686 7:129161753-129161775 GGCACAAGGTGGGGGCAGGGAGG - Intronic
1033284073 7:140025986-140026008 GGCCCCAGGTGTGGGCAGGGTGG - Intronic
1034281607 7:149858845-149858867 GGCCAGCTGTGGGGGCAGAGGGG + Intronic
1034281617 7:149858878-149858900 GGCCAGCTGTGGGGGCAGAGGGG + Intronic
1034281627 7:149858911-149858933 GGCCAGCTGTGGGGGCAGAGGGG + Intronic
1034281637 7:149858944-149858966 GGCCAGCTGTGGGGGCAGAGGGG + Intronic
1034281647 7:149858977-149858999 GGCCAGCTGTGGGGGCAGAGGGG + Intronic
1034281657 7:149859010-149859032 GGCCAGCTGTGGGGGCAGAGGGG + Intronic
1034281667 7:149859043-149859065 GGCCAGCTGTGGGGGCAGAGGGG + Intronic
1034449499 7:151129694-151129716 TGCCCGCGGTGGGGAGGTGGGGG - Intronic
1035277600 7:157757437-157757459 GGCGGCCGGTGGGGACAAGGAGG + Intronic
1036242674 8:7092700-7092722 GGCATGTGGTGGGGGCAGGGGGG + Intergenic
1036258131 8:7221329-7221351 GGCCAGTGGTGGGGGTAGGGGGG - Intergenic
1036310180 8:7679925-7679947 GGCCAGTGGTGGGGGTAGGGGGG - Intergenic
1036767285 8:11556957-11556979 GGCACGGTGTGGGGACAGGGAGG + Intronic
1036830057 8:12014446-12014468 GGCCTGTGGTGGGGGTAGGGGGG - Intronic
1036899141 8:12658739-12658761 GGCCTGTGGTGGGGGCAGGGGGG - Intergenic
1037390467 8:18387067-18387089 GGCCTGGGGTGGGGGAAGGGGGG + Intergenic
1037579154 8:20234568-20234590 GGCCCTGGGTGGGGGGAGGGCGG - Intergenic
1037691641 8:21185977-21185999 AGCCTGCTGTGGGGACAGGGAGG + Intergenic
1037811655 8:22089971-22089993 CGCCCGTGGTGGGGCCTGGGTGG + Intronic
1038824791 8:30988865-30988887 TGCCAGCGGTGGGGGCTGGGGGG + Intergenic
1039951262 8:42174589-42174611 GGAACGCTGTGGGGATAGGGAGG - Intergenic
1040610438 8:48977520-48977542 GGCCCGCGGTGTGGGCGGAGAGG - Intergenic
1045661791 8:104445637-104445659 GGATGGCGGTGGGGAGAGGGGGG + Intronic
1046709884 8:117499124-117499146 GGCACAGGGTGGGGGCAGGGTGG - Intergenic
1047079375 8:121442931-121442953 GGCCCGGGATGGGGGCATGGCGG + Intergenic
1049214026 8:141399472-141399494 GCCATGCGGAGGGGACAGGGAGG - Intronic
1049426941 8:142541912-142541934 GGGCCGCGGGGGAGACAGCGGGG - Intronic
1049487342 8:142873450-142873472 GACCTGGGGTGGGCACAGGGAGG - Exonic
1049492140 8:142911051-142911073 GACCTGGGGTGGGCACAGGGAGG - Exonic
1049798384 8:144506672-144506694 GGCCTGCGGGGTGGGCAGGGGGG + Intronic
1049988347 9:971932-971954 GGGCCGGGGTGGGGACTGGAGGG - Intergenic
1051170273 9:14314170-14314192 GGGCCGGGGTGGGGGCGGGGTGG + Intronic
1051340027 9:16102495-16102517 GGGCGGGGGTGGGGGCAGGGGGG + Intergenic
1057229060 9:93308028-93308050 GGGCAGCGGTGGGCACAGAGTGG + Intronic
1057949511 9:99358786-99358808 GGACGGTGGTGGGGACAGTGAGG + Intergenic
1059677708 9:116555533-116555555 GGCCTGGGGTGGGGACGGGGTGG - Intronic
1060175319 9:121493315-121493337 AGCCCTCGGTGGGCACAGGTAGG - Intergenic
1060552497 9:124492303-124492325 GGGCCAGGGTGGGGACACGGGGG - Intronic
1060557137 9:124513767-124513789 GGCCCCTTGTGGGCACAGGGAGG - Intergenic
1060980050 9:127786423-127786445 GGCCCGTGGTGGGGGCGGGGAGG + Intronic
1061071612 9:128314265-128314287 GGCCTGGGGTGGCCACAGGGTGG - Intronic
1061273545 9:129557388-129557410 GTCCCAGGGTGGGGACAGGGTGG + Intergenic
1061293522 9:129665569-129665591 GGCGCGCGGGGAGGAGAGGGCGG + Intergenic
1061370075 9:130193071-130193093 GGCCCGGTGTGGGGGCAGGAGGG + Intronic
1061449470 9:130660616-130660638 GGCCGGCGGGGCGGGCAGGGCGG + Intergenic
1061893370 9:133634413-133634435 GGCCCGCGTTGTGGGAAGGGGGG - Intergenic
1061921002 9:133782458-133782480 GGCCTGTGATGGGGACAAGGGGG + Intronic
1062155565 9:135046293-135046315 GACCCTGGGTGGGGGCAGGGTGG + Intergenic
1062171510 9:135137389-135137411 GGCCCCCACTGGGGGCAGGGAGG + Intergenic
1062434015 9:136538425-136538447 GGCCCAGGGAGGGGACAGTGTGG + Intronic
1062453835 9:136626629-136626651 GGGCAGGGGTGGGGGCAGGGCGG + Intergenic
1062453848 9:136626652-136626674 GGGCAGGGGTGGGGGCAGGGCGG + Intergenic
1062453861 9:136626675-136626697 GGGCAGGGGTGGGGGCAGGGCGG + Intergenic
1062548878 9:137077106-137077128 GGGGCGCGGAGTGGACAGGGCGG + Intergenic
1062613435 9:137385391-137385413 GGCTGGCGATGGGGCCAGGGTGG + Intronic
1185456160 X:311832-311854 GGGCCGCCGTGCGGACACGGGGG + Intronic
1185761213 X:2691135-2691157 GGCCCGGGGAGGAGACAGAGGGG - Intergenic
1186455489 X:9707223-9707245 GGCCAGGGGTGGGGAGAGGTGGG - Intronic
1186506975 X:10101324-10101346 GGACCGGGGTGAGGACAGGGTGG - Intronic
1186640576 X:11450903-11450925 GGTCAGCGGTGGGGAAATGGGGG - Intronic
1187077194 X:15947029-15947051 GGCAGGCGGTGGGGGTAGGGGGG + Intergenic
1187846135 X:23540333-23540355 TGCCAGGGGTGGGGAAAGGGTGG - Intergenic
1189320989 X:40087122-40087144 GGGCCGGGGCCGGGACAGGGAGG + Intronic
1190700977 X:52989714-52989736 GGCCCTGGGAGAGGACAGGGTGG + Intronic
1192780823 X:74292602-74292624 GGGCGGGGGTGGGGAGAGGGAGG - Intergenic
1197058231 X:122146019-122146041 GTCCTGGGGTGGGGAAAGGGGGG + Intergenic
1197902913 X:131392896-131392918 GGCAGGGGGTGGGGGCAGGGGGG - Intronic
1200081676 X:153579931-153579953 GGCGCGAGGTGGGAGCAGGGAGG - Intronic