ID: 927713895

View in Genome Browser
Species Human (GRCh38)
Location 2:25341098-25341120
Sequence GCCGGAGGAGGATCGCGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 128}

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927713871_927713895 24 Left 927713871 2:25341051-25341073 CCGCCCCTCCCGGCCCCGCCGGC 0: 1
1: 2
2: 21
3: 250
4: 1728
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713879_927713895 9 Left 927713879 2:25341066-25341088 CCGCCGGCGCCCCGCACCCCCAG 0: 1
1: 0
2: 5
3: 64
4: 671
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713891_927713895 -10 Left 927713891 2:25341085-25341107 CCAGCCACAGGTGGCCGGAGGAG 0: 1
1: 1
2: 2
3: 12
4: 206
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713873_927713895 20 Left 927713873 2:25341055-25341077 CCCTCCCGGCCCCGCCGGCGCCC 0: 1
1: 2
2: 15
3: 160
4: 1087
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713874_927713895 19 Left 927713874 2:25341056-25341078 CCTCCCGGCCCCGCCGGCGCCCC 0: 1
1: 2
2: 25
3: 237
4: 1693
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713885_927713895 -2 Left 927713885 2:25341077-25341099 CCGCACCCCCAGCCACAGGTGGC 0: 1
1: 1
2: 17
3: 131
4: 887
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713882_927713895 0 Left 927713882 2:25341075-25341097 CCCCGCACCCCCAGCCACAGGTG 0: 1
1: 0
2: 1
3: 47
4: 531
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713890_927713895 -9 Left 927713890 2:25341084-25341106 CCCAGCCACAGGTGGCCGGAGGA 0: 1
1: 0
2: 0
3: 19
4: 192
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713867_927713895 29 Left 927713867 2:25341046-25341068 CCCCGCCGCCCCTCCCGGCCCCG 0: 1
1: 2
2: 31
3: 450
4: 2117
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713875_927713895 16 Left 927713875 2:25341059-25341081 CCCGGCCCCGCCGGCGCCCCGCA 0: 1
1: 0
2: 8
3: 102
4: 692
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713888_927713895 -8 Left 927713888 2:25341083-25341105 CCCCAGCCACAGGTGGCCGGAGG 0: 1
1: 0
2: 1
3: 24
4: 259
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713877_927713895 11 Left 927713877 2:25341064-25341086 CCCCGCCGGCGCCCCGCACCCCC 0: 1
1: 1
2: 8
3: 126
4: 1008
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713880_927713895 6 Left 927713880 2:25341069-25341091 CCGGCGCCCCGCACCCCCAGCCA 0: 1
1: 1
2: 7
3: 135
4: 1023
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713872_927713895 21 Left 927713872 2:25341054-25341076 CCCCTCCCGGCCCCGCCGGCGCC 0: 1
1: 3
2: 23
3: 194
4: 1540
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713868_927713895 28 Left 927713868 2:25341047-25341069 CCCGCCGCCCCTCCCGGCCCCGC 0: 1
1: 2
2: 35
3: 417
4: 2115
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713869_927713895 27 Left 927713869 2:25341048-25341070 CCGCCGCCCCTCCCGGCCCCGCC 0: 2
1: 4
2: 72
3: 597
4: 3342
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713887_927713895 -7 Left 927713887 2:25341082-25341104 CCCCCAGCCACAGGTGGCCGGAG 0: 1
1: 0
2: 0
3: 30
4: 270
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713878_927713895 10 Left 927713878 2:25341065-25341087 CCCGCCGGCGCCCCGCACCCCCA 0: 1
1: 0
2: 6
3: 51
4: 606
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713876_927713895 15 Left 927713876 2:25341060-25341082 CCGGCCCCGCCGGCGCCCCGCAC 0: 1
1: 0
2: 12
3: 128
4: 991
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128
927713883_927713895 -1 Left 927713883 2:25341076-25341098 CCCGCACCCCCAGCCACAGGTGG 0: 1
1: 1
2: 9
3: 66
4: 691
Right 927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927713895 Original CRISPR GCCGGAGGAGGATCGCGGCG CGG Intronic