ID: 927714452

View in Genome Browser
Species Human (GRCh38)
Location 2:25342598-25342620
Sequence CTGCCTCAGCACTGGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 498}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927714442_927714452 1 Left 927714442 2:25342574-25342596 CCGCCAGAGCCCACTGCGCTCTG 0: 1
1: 0
2: 2
3: 29
4: 261
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714445_927714452 -9 Left 927714445 2:25342584-25342606 CCACTGCGCTCTGCCTGCCTCAG 0: 1
1: 0
2: 6
3: 132
4: 961
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714439_927714452 9 Left 927714439 2:25342566-25342588 CCCGACCTCCGCCAGAGCCCACT 0: 1
1: 0
2: 1
3: 20
4: 195
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714444_927714452 -8 Left 927714444 2:25342583-25342605 CCCACTGCGCTCTGCCTGCCTCA 0: 1
1: 0
2: 0
3: 50
4: 736
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714437_927714452 21 Left 927714437 2:25342554-25342576 CCCTGCAGTTCTCCCGACCTCCG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714438_927714452 20 Left 927714438 2:25342555-25342577 CCTGCAGTTCTCCCGACCTCCGC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714436_927714452 27 Left 927714436 2:25342548-25342570 CCTTCGCCCTGCAGTTCTCCCGA 0: 1
1: 0
2: 0
3: 7
4: 101
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714441_927714452 4 Left 927714441 2:25342571-25342593 CCTCCGCCAGAGCCCACTGCGCT 0: 1
1: 0
2: 1
3: 14
4: 208
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714443_927714452 -2 Left 927714443 2:25342577-25342599 CCAGAGCCCACTGCGCTCTGCCT 0: 1
1: 1
2: 1
3: 32
4: 330
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498
927714440_927714452 8 Left 927714440 2:25342567-25342589 CCGACCTCCGCCAGAGCCCACTG 0: 1
1: 0
2: 2
3: 26
4: 303
Right 927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG 0: 1
1: 0
2: 3
3: 57
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927714452 Original CRISPR CTGCCTCAGCACTGGGGCTG GGG Intergenic
900077706 1:831344-831366 CTGCTTCAGCAATGGTGATGGGG + Intergenic
900100391 1:959951-959973 CTCCCCCAGCCCTGGCGCTGAGG + Intergenic
900205642 1:1430998-1431020 CTGCCCCGGCACTCGGGCTCTGG - Intergenic
900351201 1:2235482-2235504 CTGGCTCACCCCGGGGGCTGGGG + Intronic
900380135 1:2379875-2379897 CAGTCTCACCTCTGGGGCTGTGG + Intronic
900420494 1:2554039-2554061 CTGGCACAGCATTGGGTCTGGGG + Intergenic
900494718 1:2971247-2971269 CTGCCTCAGAGGTGGGGGTGGGG - Intergenic
900593442 1:3469792-3469814 CGGGCTAAGCACTGGGGCTGTGG + Intronic
900626173 1:3609713-3609735 CTGCCTCTGCACCTGGGCTCGGG - Intronic
900898990 1:5504130-5504152 TGGGCTCAGCCCTGGGGCTGGGG + Intergenic
901311161 1:8270616-8270638 CTTCCTCATCGCTGGGGGTGGGG + Intergenic
901930094 1:12591615-12591637 CTGCCTCAGCATGGGTGCCGTGG + Intronic
902082611 1:13831414-13831436 CTACCTCAGCACTGAGGCATGGG + Intergenic
902678851 1:18029104-18029126 CTGCCCCAGCACTGGGGCCTGGG - Intergenic
902823177 1:18955942-18955964 CGGCCTCAGCAGTGGCGCGGCGG - Exonic
904314633 1:29652241-29652263 CTGCCACAGCTCTAGGGCAGGGG + Intergenic
904367333 1:30022697-30022719 CAGCCTCAGCTCTGGTGCTGAGG + Intergenic
904384541 1:30132738-30132760 CTGCCACAGCTCTAGGGCAGGGG - Intergenic
904470613 1:30733794-30733816 CCCTCCCAGCACTGGGGCTGGGG + Exonic
904650655 1:32003535-32003557 CAGGCTCAGGCCTGGGGCTGGGG - Intergenic
905043278 1:34977288-34977310 ATGCCTTGGCACTGGGCCTGGGG - Intergenic
905112395 1:35605462-35605484 CTGCTGGAGCACTGGGTCTGGGG - Intronic
905286031 1:36880916-36880938 AGGGGTCAGCACTGGGGCTGTGG + Intronic
905450415 1:38052480-38052502 CTGCCTCAGCCCCTAGGCTGTGG + Intergenic
905587623 1:39133195-39133217 CTGCTTCCACCCTGGGGCTGGGG + Intronic
906147068 1:43566482-43566504 CAGCCTCAACACTCAGGCTGAGG - Intronic
906536745 1:46554930-46554952 CTGAATCAGGGCTGGGGCTGGGG + Intergenic
906540943 1:46585548-46585570 TTTCCTCTGCACTGGGCCTGCGG - Intronic
906642317 1:47448939-47448961 CTGTCTCAGAAATGGAGCTGGGG + Intergenic
909680621 1:78287550-78287572 CTGCCCCAGCTCTGTGGCTCAGG + Intergenic
912321427 1:108717289-108717311 CTGCCTCCGCTCAGTGGCTGCGG - Intronic
912386351 1:109273028-109273050 GTGGGCCAGCACTGGGGCTGTGG + Intronic
912756603 1:112329603-112329625 CTGCCCCAACCCTGTGGCTGCGG + Intergenic
912812102 1:112802447-112802469 CGGCCTCTTCCCTGGGGCTGAGG + Intergenic
915097796 1:153475951-153475973 CTGCCTCAGCCTTGGGGATTGGG - Intergenic
915268616 1:154735811-154735833 CTGCCTCAGCACAGGGCCTGAGG - Intronic
915524186 1:156466131-156466153 CTGCCTCCTCAGTGGGGCAGTGG - Exonic
916936453 1:169632964-169632986 CTGCCCCAGGACTGGGGCCAGGG + Intergenic
917199160 1:172497313-172497335 CTGGCGCAGCTCTGGGGCTCCGG + Intergenic
917279971 1:173370954-173370976 CTGCCTCAGCATAGGGGACGTGG - Intergenic
918046646 1:180945505-180945527 CCGCCCCAGCCATGGGGCTGAGG - Exonic
919826476 1:201506960-201506982 CTGCGACAGCCCCGGGGCTGCGG + Intronic
920094962 1:203480678-203480700 CTGATTCAGCCCTGGGGCTGAGG + Intronic
920842436 1:209565959-209565981 CTGTCTCAGCCCTGCTGCTGCGG - Intergenic
922890606 1:229058865-229058887 ATGCCTCAGTCCTGGGGATGGGG + Intergenic
922949843 1:229549466-229549488 TTGCTTCAGCAAAGGGGCTGCGG + Intronic
923475064 1:234324550-234324572 CTGCTTCAGGACTGGTGCAGTGG - Intergenic
923991035 1:239437151-239437173 CTGCCACTGCACTCAGGCTGGGG - Intronic
924178125 1:241413554-241413576 GTGACTCAGTACTGGAGCTGTGG - Intergenic
924772543 1:247089767-247089789 CTGGCTGAGGGCTGGGGCTGGGG - Intergenic
924794918 1:247286194-247286216 GTGCCTCCGGACTGGGCCTGAGG - Intergenic
1062828224 10:587654-587676 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828248 10:587746-587768 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828272 10:587838-587860 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828296 10:587930-587952 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828308 10:587976-587998 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828320 10:588022-588044 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828344 10:588114-588136 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828356 10:588160-588182 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062828368 10:588206-588228 CTGCCTCAGCCCTGACCCTGCGG + Intronic
1062939917 10:1413302-1413324 CTGACACAGCACTGGGGAAGGGG + Intronic
1063591199 10:7397190-7397212 CTTCCTCAGCAGTGAGCCTGGGG - Intronic
1064215208 10:13394556-13394578 CTGCCTTGGAACTGGGGCTCTGG + Intergenic
1064311015 10:14211918-14211940 ATGCCTCAGCACTGGGGAAGTGG + Intronic
1065021818 10:21508155-21508177 CTGCCAGAGCTCAGGGGCTGCGG + Intergenic
1065351253 10:24797520-24797542 CTGCCTCAGTACTGGGATTGCGG + Intergenic
1065708053 10:28489307-28489329 CTCCCACAGCTCTGGGACTGAGG - Intergenic
1065709748 10:28504443-28504465 CTGCTTCTATACTGGGGCTGCGG + Intergenic
1066210707 10:33234893-33234915 CTGCAACAGCACAGGGGCAGTGG + Intronic
1066505667 10:36039735-36039757 CTGCCTCAGCCATGGGGGTTGGG - Intergenic
1066656089 10:37701054-37701076 GTCCCTCAGCAGTGGGGCTCCGG - Intergenic
1067143367 10:43674931-43674953 TTGCCTCATCATTGGGGCTCTGG + Intergenic
1067227807 10:44386707-44386729 CGGCCGCAGCGCTGGGGCTCCGG + Intergenic
1067799862 10:49351505-49351527 CTGCAGCAGACCTGGGGCTGTGG - Intergenic
1068548804 10:58384048-58384070 TTGCCTCACCTTTGGGGCTGGGG + Intergenic
1069903051 10:71716940-71716962 CTGCCTCATCCCTGTGTCTGGGG + Intronic
1070736269 10:78865796-78865818 CTGCCACACCACTGGTGGTGGGG - Intergenic
1071601332 10:86959951-86959973 CTGCCTTGGGGCTGGGGCTGGGG + Intronic
1075025994 10:118983508-118983530 CTGCCACAGAGCTGGGGTTGGGG - Intergenic
1075414919 10:122255608-122255630 CTGCCTCGGCACGGTGGCTACGG + Intergenic
1075990441 10:126833881-126833903 CTACCTCACCACTGAGTCTGTGG + Intergenic
1076249469 10:128974002-128974024 CTGTGTCAGCCCTGGTGCTGGGG - Intergenic
1076722540 10:132399009-132399031 AAGCCTCAGGACTGGGGCTGGGG - Intronic
1077020864 11:416684-416706 CTGCTTCAGGACAGGCGCTGGGG - Intronic
1077159176 11:1104924-1104946 CTGCCCCTGCCCTGGAGCTGGGG + Intergenic
1077251745 11:1563793-1563815 CTCCGCCAGCAGTGGGGCTGGGG - Intronic
1077374118 11:2197605-2197627 CTGCCACAGGAGTGGGGCAGGGG + Intergenic
1077482967 11:2825170-2825192 CTGCGGCGGGACTGGGGCTGGGG + Intronic
1077491542 11:2863019-2863041 CTTCCTCAGCCCTGGGCCGGCGG + Intergenic
1077917862 11:6622765-6622787 CTGCCTCAGCCTTGCGGCTACGG + Exonic
1077953824 11:6991388-6991410 CTGCGGCAGGGCTGGGGCTGTGG + Intergenic
1078244603 11:9562889-9562911 CTGACTCAGCACAGGAGCAGGGG - Intergenic
1079081272 11:17415184-17415206 CTCCCCCAACACTGGGGCTGGGG + Intronic
1079362336 11:19779303-19779325 CTGCCTGGGCTCTGGGGCAGTGG - Intronic
1080750254 11:35144194-35144216 CTGCCTCCTGGCTGGGGCTGGGG + Intronic
1081244359 11:40746406-40746428 CTGCTTTAGGACTGAGGCTGAGG + Intronic
1081616471 11:44594405-44594427 CAGCCACTGCACTGGGGCTGGGG - Intronic
1081676774 11:44974563-44974585 CTGGCTCAGCCCTGGGGAAGGGG - Intergenic
1081858319 11:46317535-46317557 CTGCCTGGACACTGGGGCTGGGG - Intronic
1083765474 11:64839387-64839409 ATGCCTCTGCACTAGGCCTGGGG + Intronic
1083892193 11:65601123-65601145 GAGTCTCAGGACTGGGGCTGCGG - Intronic
1084063206 11:66688948-66688970 CTGGCACAGCTCTGGGGCAGTGG - Intronic
1085384455 11:76149152-76149174 CTCCCTCTTAACTGGGGCTGCGG - Intergenic
1086941607 11:92803901-92803923 GGGCCTCAGCACTGGGAGTGGGG - Intronic
1087011889 11:93522385-93522407 CTTTCTCAGCAGAGGGGCTGTGG + Intronic
1088287129 11:108200764-108200786 CTGCCTCATTAATGAGGCTGTGG + Intronic
1088837891 11:113593891-113593913 CTCCGTCACCACTGGGACTGTGG - Intergenic
1089372399 11:117970794-117970816 CTGCCCCAACACTGAGCCTGGGG + Intergenic
1090173469 11:124625815-124625837 AGGGCCCAGCACTGGGGCTGAGG + Exonic
1090204256 11:124876099-124876121 CTGCACCAGCACTGGGGCACTGG - Exonic
1090653194 11:128824534-128824556 CGGGCTCAGCCCTGGGGGTGGGG + Intergenic
1090969581 11:131628832-131628854 CTGCTGCAGCTCTGGGGCAGAGG + Intronic
1091857386 12:3750864-3750886 AGGCCCCAGCACTGGGGCAGTGG - Intronic
1092211769 12:6651035-6651057 CAGCCTCAGCACCGGGAGTGGGG + Exonic
1092523367 12:9294800-9294822 CTGCCTCTGGACAGGGGCAGTGG - Intergenic
1092543927 12:9437099-9437121 CTGCCTCTGGACAGGGGCAGTGG + Intergenic
1092562014 12:9625459-9625481 TTGCCACAGCAATGGGCCTGTGG + Intergenic
1094070979 12:26412523-26412545 AGGCCTCAGCTCTGGGCCTGGGG - Intronic
1094493531 12:30975931-30975953 CGGCCTCAGCACCGTAGCTGAGG + Intronic
1096079992 12:48826884-48826906 CTGCCGCAGCCCTGGGGGAGTGG - Intronic
1096179688 12:49543875-49543897 GGGAGTCAGCACTGGGGCTGGGG - Intronic
1096181260 12:49551787-49551809 CTGCTGAAGCCCTGGGGCTGAGG + Intronic
1096230567 12:49894567-49894589 CTGCCCAGGCCCTGGGGCTGGGG - Intronic
1097038917 12:56142690-56142712 CTGCCGGAGCTCTGGGGCTGAGG - Exonic
1097516573 12:60615836-60615858 CTTCCTCAGCAATGAGTCTGAGG + Intergenic
1097691523 12:62738848-62738870 CTGCCTCTGCACTGGGAGAGAGG - Intronic
1098484604 12:71006059-71006081 CTGCCTCAGCTGTAGTGCTGGGG + Intergenic
1098991022 12:77065310-77065332 CCGCCTCCCCACTGGCGCTGGGG + Intronic
1099874670 12:88390269-88390291 CTGCCTTAGCTTTGGAGCTGAGG + Intergenic
1100838037 12:98585790-98585812 CAGACCCAGCTCTGGGGCTGAGG - Intergenic
1102006299 12:109591160-109591182 CTGCCCCAGCAGTGGGGTGGAGG - Intronic
1102059689 12:109923199-109923221 CTCCCTCAACTCTGGGGATGGGG + Intronic
1102534466 12:113570175-113570197 CTGCCTCAGGCCTCGGGCAGGGG + Intergenic
1103536820 12:121639000-121639022 GTGTGTCAGCCCTGGGGCTGGGG + Intronic
1103964458 12:124629807-124629829 CTGCCTCAGCATGGTGGCTCTGG + Intergenic
1104747504 12:131219556-131219578 CAGCCACAGCCTTGGGGCTGGGG + Intergenic
1104811126 12:131621041-131621063 TGGCCTCAGCCCTGGGGCTCTGG - Intergenic
1104916685 12:132269173-132269195 CGGCCTCAGCGCTGAGGCAGGGG + Intronic
1105255244 13:18739859-18739881 GTTCCTCAGCACAGGAGCTGAGG + Intergenic
1106083877 13:26523210-26523232 CTGCCTCCGCAGAGAGGCTGTGG - Intergenic
1106099101 13:26679205-26679227 CTGCCTCCCCACTGGGAGTGGGG + Intronic
1106776659 13:33016278-33016300 CTGCCTCCGCCCTGGCACTGGGG - Intergenic
1107282872 13:38756499-38756521 CTGCTTCAGCACTATGGTTGGGG + Intronic
1108167605 13:47709543-47709565 CTGCCTGAGCACTGGGGGAATGG + Intergenic
1108478476 13:50843555-50843577 CTGCAGCAGGAGTGGGGCTGGGG - Exonic
1113160669 13:107377126-107377148 CTGCTTCTTCACTGGGGGTGGGG - Intronic
1113874775 13:113587283-113587305 CTGCATAGGCACAGGGGCTGGGG + Intronic
1114567433 14:23643174-23643196 CTGGCTCAGCAGCAGGGCTGGGG - Exonic
1114636030 14:24187399-24187421 CTACCTCAGCACTGAAGATGTGG - Exonic
1117325234 14:54662778-54662800 CTCCCTCAGCACAGGGTGTGGGG + Intronic
1119014083 14:71031323-71031345 CTGTCCCAGCACTTGGCCTGGGG - Intronic
1121235642 14:92389698-92389720 CTGGCTTAGCACAGGGGATGTGG - Intronic
1121263990 14:92587292-92587314 CTGCCTAGGAACTGGGACTGGGG + Intronic
1121449476 14:93998263-93998285 CTGGGGAAGCACTGGGGCTGGGG - Intergenic
1121493591 14:94377383-94377405 CTGCCGTGGCACTGGAGCTGCGG + Exonic
1121505402 14:94473223-94473245 CAGCCTCAGAACTGGGGTGGTGG + Intronic
1121635574 14:95451834-95451856 GTGCCTGAGCCCGGGGGCTGAGG + Intronic
1122527324 14:102396737-102396759 CTTCCACAGAACTGGGGTTGGGG - Intronic
1122846947 14:104505386-104505408 CTGCAGCAGCTCTGGGGGTGGGG - Intronic
1123019238 14:105389855-105389877 CTGGCGCAGCCCTGGGGCCGCGG - Intronic
1123136761 14:106034464-106034486 CTGTCTCAGGAGTGGGGGTGAGG + Intergenic
1123151404 14:106185257-106185279 CTCTCTCAGCCCTGGGACTGGGG + Intergenic
1123171560 14:106377655-106377677 CTTCCTCAGCCCTGAGACTGGGG + Intergenic
1123195269 14:106610118-106610140 CTCCCTCAGCCCTGGGACTGGGG + Intergenic
1123223127 14:106874939-106874961 CTTCCTCAGCCCTGAGACTGGGG + Intergenic
1123399803 15:19973140-19973162 CTCCCTCAGCCCTGGGACTGGGG + Intergenic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125462615 15:39920746-39920768 CTGCCTCAGCACTGGCGACGGGG + Exonic
1125994761 15:44147834-44147856 CTGCCACAGGGCTGGGGGTGGGG - Intronic
1126089173 15:45036080-45036102 CTGGCTCAGCAGTGAAGCTGCGG - Intronic
1128356133 15:66928079-66928101 CTCCCTCTGCACTGGGGTTGTGG - Intergenic
1128614815 15:69100831-69100853 CTGCCTAAGTCCAGGGGCTGAGG + Intergenic
1129385824 15:75195749-75195771 GTGCCCCAGCACTGGGGGAGGGG + Intronic
1129573432 15:76715261-76715283 CTGCATCAGCTGTGGTGCTGGGG - Intronic
1129853697 15:78810318-78810340 CTCCCTGAGCACCGGGCCTGGGG + Intronic
1130256864 15:82329871-82329893 CTGCCTGTGCACTGGCCCTGCGG + Intergenic
1130542931 15:84835023-84835045 AGGCCCCAGCCCTGGGGCTGTGG + Intronic
1130598084 15:85260117-85260139 CTGCCTGTGCACTGGCCCTGCGG - Intergenic
1132042555 15:98537220-98537242 CTGCCTCTGAAGTGAGGCTGGGG - Intergenic
1132177126 15:99724789-99724811 CTGCCTCCTCACTGGCACTGTGG + Intronic
1132767626 16:1542430-1542452 CTGCCTCAGCATTGAGGAAGGGG - Intronic
1133207124 16:4240459-4240481 CCTGCTCAGCACTTGGGCTGTGG - Intronic
1133229806 16:4361133-4361155 CAGGCTCAGGAATGGGGCTGGGG - Intronic
1133344263 16:5059720-5059742 CTGCATCCTCACTGGGGATGGGG + Intronic
1133812243 16:9169800-9169822 CTGCACCAGCCCAGGGGCTGAGG - Intergenic
1134032572 16:11004304-11004326 CGTCCTGGGCACTGGGGCTGGGG + Intronic
1135529696 16:23242387-23242409 CTGCCCCACCACTGTGGATGGGG - Intergenic
1136284512 16:29233254-29233276 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1137275678 16:46931905-46931927 CAGCCTCTTCCCTGGGGCTGGGG + Intergenic
1137468460 16:48732783-48732805 CTGCCACAGCCCAGGGGCAGAGG - Intergenic
1138347316 16:56328048-56328070 GTGCCTCAGGACTGGGGGAGGGG - Intronic
1138366377 16:56481294-56481316 CTGGCTCAGCACTGGGGCGAGGG + Intronic
1138414737 16:56865151-56865173 CTGCGTCTGCACTGGGGAGGAGG - Intergenic
1138659474 16:58508898-58508920 CTGCCTTGGCAATGGGGGTGGGG + Intronic
1139504529 16:67392385-67392407 CACCCGCAGCCCTGGGGCTGAGG + Intronic
1139511816 16:67432074-67432096 CTGCCTCAGCAGTTTGGCAGTGG - Intronic
1139521077 16:67483097-67483119 CTGCCCCAGGCCTGGGCCTGCGG - Exonic
1139666407 16:68459853-68459875 GTCCATCAGCCCTGGGGCTGAGG + Intergenic
1139846798 16:69927212-69927234 CTGCCCCAGGGCTGTGGCTGGGG + Intronic
1139951572 16:70674736-70674758 TCCCCTCAGCACTGGGGCTGGGG - Intronic
1139962040 16:70723714-70723736 TTGCCTGAGCTATGGGGCTGGGG + Intronic
1141480315 16:84301958-84301980 CTGCCTCTGCCCTGTGGCTGCGG - Intronic
1141574550 16:84955594-84955616 CTGCCTGGGCACTGGGGATCAGG + Intergenic
1141651686 16:85396267-85396289 CTGCCCAGGCACTGGGGCGGGGG + Intergenic
1142089547 16:88202767-88202789 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1142111228 16:88332748-88332770 CGGCCTGAGCAGTGGTGCTGGGG - Intergenic
1142194385 16:88732801-88732823 CTGCCCCAGAGCTGTGGCTGTGG - Intronic
1142411235 16:89918237-89918259 CAGCTGCAGCCCTGGGGCTGTGG - Exonic
1143107856 17:4538388-4538410 CTGCCCCAGAGCTGAGGCTGAGG + Exonic
1143512875 17:7405588-7405610 CTGGCTCAGCCCTGGGGCCGTGG - Intronic
1143766365 17:9140323-9140345 CTGCCACAGCACCAGGGCAGGGG - Intronic
1144057055 17:11552726-11552748 GTGCCTCAGCACTGAAGTTGAGG + Intronic
1144203107 17:12958914-12958936 CTTTCTCAGCACTGGGGATTAGG + Intronic
1144638932 17:16927098-16927120 CGGCCTCAGCCCTGGGGAGGAGG + Intergenic
1144669543 17:17125226-17125248 CTGCCTCAACACTGACCCTGGGG - Intronic
1144697287 17:17313618-17313640 CAGCCTCATCCCAGGGGCTGCGG + Intronic
1144846840 17:18224684-18224706 CTGGCTCAGGGCTGGGGCTGCGG - Intergenic
1145826007 17:27877757-27877779 CTGTGGCAGCACAGGGGCTGGGG + Intronic
1145905400 17:28513650-28513672 CCGCCTCAGCCCTCGGGCAGGGG + Intronic
1146278659 17:31531148-31531170 CTGCCTCTGCCCAGGGGTTGGGG - Intronic
1146491600 17:33287410-33287432 CTATCTGAGCACTGGGGCTTTGG - Intronic
1146935407 17:36809810-36809832 CTCCCTGTGCTCTGGGGCTGGGG - Intergenic
1147195074 17:38761044-38761066 CTGCCTTAGAAGTGGTGCTGAGG + Intronic
1147322269 17:39653475-39653497 CGGCCTCAGCAGCAGGGCTGGGG - Exonic
1148108436 17:45131758-45131780 CTGCCAGAGCAGTGTGGCTGTGG + Intronic
1148783235 17:50133230-50133252 CTGGCCCAGCACAGGGGCTGGGG + Intergenic
1148840792 17:50495493-50495515 CTTTCTCAGGGCTGGGGCTGGGG + Intergenic
1149232151 17:54546962-54546984 CTGCTACTGCACTGGGGCAGGGG - Intergenic
1149289529 17:55203229-55203251 CTACCTCAGCACAGGGGAAGAGG - Intergenic
1149429782 17:56588555-56588577 CTGGCTCCGCACTGGGGAAGGGG - Intergenic
1150284876 17:63949016-63949038 GTGGGGCAGCACTGGGGCTGGGG - Intronic
1150331248 17:64296101-64296123 GTTCCTCAGCAGTGGGGCAGGGG - Intergenic
1150658316 17:67055255-67055277 CTGCCTGAGCGCCGGGGCCGGGG + Intronic
1151546373 17:74795757-74795779 CTGGCTAAGCACTGGGGCCTTGG + Intronic
1151878340 17:76880077-76880099 CTGCTTCAGCTCTTGGGGTGGGG + Intronic
1151891938 17:76956252-76956274 TTGCTTCAGCCCAGGGGCTGGGG - Intergenic
1152242565 17:79168011-79168033 CTCACCCAGCCCTGGGGCTGGGG - Intronic
1152745711 17:82037697-82037719 CGCCCTCCGCACTGGGGCTGCGG + Exonic
1152800839 17:82330020-82330042 CTCCCACCGCACTGGGGGTGGGG - Intronic
1152935758 17:83135799-83135821 CTGACTCACCCCTAGGGCTGAGG + Intergenic
1203162432 17_GL000205v2_random:63866-63888 CAGCCTCTGCTCTGGGCCTGGGG - Intergenic
1153625657 18:7020249-7020271 CTGCCTCTGCTGTGGGGCAGCGG - Intronic
1153988676 18:10376008-10376030 CTGCCTCCACATTTGGGCTGTGG - Intergenic
1154174305 18:12074918-12074940 CTGCCTCCACACTGTGGCTTAGG - Intergenic
1155367875 18:25066718-25066740 CTGTCTCAGGACTGGTTCTGTGG - Intronic
1155474730 18:26226635-26226657 CTGCCTCAGCCCTGCGCCTCAGG - Exonic
1155925973 18:31655467-31655489 CTGCCTTTTCACTGGGGGTGGGG - Intronic
1156491809 18:37500877-37500899 CAGCCTCCCCAGTGGGGCTGGGG - Intronic
1157184060 18:45523205-45523227 CAGACTCAGCATAGGGGCTGGGG - Intronic
1157419298 18:47531835-47531857 CTGCGCCAACACTCGGGCTGCGG + Intergenic
1158404512 18:57149116-57149138 CTGCCTAAGTGGTGGGGCTGGGG + Exonic
1158516206 18:58132117-58132139 ATCCCTCAGCCCTGGGTCTGTGG - Intronic
1160499962 18:79396571-79396593 CGCCCTCAGCGCTGGGGCAGAGG - Intronic
1160739541 19:679690-679712 CTGTCTGAGCAGCGGGGCTGCGG + Intronic
1160844679 19:1161140-1161162 GTGCCTGAGTACTGGGGGTGGGG + Intronic
1160844702 19:1161199-1161221 GTGCCTGAGCACTGGGGGTGGGG + Intronic
1160844725 19:1161258-1161280 GTGCCTGAGCACTGGGGGTGGGG + Intronic
1160844741 19:1161310-1161332 GTGCCTGAGTACTGGGGGTGGGG + Intronic
1160844813 19:1161522-1161544 GTGCCTGAGCACTGGGGGGGTGG + Intronic
1160953583 19:1679302-1679324 ATGCCTCAGGCCAGGGGCTGGGG + Intergenic
1161044531 19:2128158-2128180 CCGCCTCAGCACTTGGTCTGAGG + Intronic
1161218083 19:3104723-3104745 CTTCCTGAGCGCAGGGGCTGTGG - Intronic
1161290672 19:3492016-3492038 ATCCCTAATCACTGGGGCTGGGG - Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1162016963 19:7851277-7851299 CTCCCTCAGCACTCTGTCTGAGG - Intronic
1162412583 19:10515335-10515357 CTGCCTCAGGCCTGAGCCTGGGG - Intronic
1162456922 19:10790845-10790867 CAGCCTCACCACTTGGGCTCAGG + Intronic
1162934179 19:13972931-13972953 CTCCACCAGCACTGGGGCTGGGG - Exonic
1163094123 19:15043255-15043277 CTGCCTCCACACAGGGGCAGGGG + Intergenic
1163613996 19:18315959-18315981 CAGCCTCAGCACAGGGGCGGTGG - Intronic
1163647655 19:18499081-18499103 CTGCCTCAGCTTTAAGGCTGAGG - Intronic
1163716916 19:18878304-18878326 CTGCCCCAGGCCTGGGGCTTCGG + Exonic
1163822018 19:19501394-19501416 CTGCTTCAGCACGGGGTGTGGGG - Exonic
1164389511 19:27805782-27805804 CTGCTTCAGCACGGGGCCTGTGG + Intergenic
1164683809 19:30153431-30153453 CTGTCTCAGGGCTTGGGCTGGGG - Intergenic
1164809886 19:31147481-31147503 CAACCTCAGGACTGGGCCTGGGG + Intergenic
1165136562 19:33673496-33673518 GAGCCTCAGAACTGGGGGTGGGG - Intronic
1165151580 19:33763818-33763840 GTCCCTCAGCCCTGGGGCAGTGG + Intronic
1165616555 19:37206954-37206976 CTGCCTCTGCCCTAAGGCTGTGG + Intronic
1165763355 19:38335674-38335696 CTGTCTCAGCACTGAGGGCGCGG - Intergenic
1166141562 19:40808037-40808059 CTGCCCCATCATGGGGGCTGGGG + Exonic
1167699430 19:51033818-51033840 CTTCCTTAGCAGTGGGCCTGGGG - Intronic
1167769546 19:51506014-51506036 CTGCCTTTGCTGTGGGGCTGAGG + Intergenic
1167880927 19:52456688-52456710 CTGCATCATCCCTGGTGCTGTGG + Intronic
1168136913 19:54357751-54357773 CTGCCTCAGCCCCGGGGGAGGGG - Intronic
1168161175 19:54511341-54511363 CTGCCTCGGCAGTGGGGGAGGGG + Intergenic
1168180933 19:54662831-54662853 CTGCCTCAGCCCTAGCTCTGGGG + Exonic
1168291761 19:55360646-55360668 CTCCCTCAGCTCTGGGGCCTGGG + Intronic
1168722739 19:58563223-58563245 CCGCCCCAGCACTGGGGGCGGGG - Exonic
925309699 2:2873858-2873880 CTGCTCCAGCTCTGGGCCTGGGG + Intergenic
925941033 2:8819387-8819409 CTCCCTCAGCCCTGGAGATGAGG + Intronic
926128138 2:10284431-10284453 CTGCTTCAACACTGTGGGTGGGG + Intergenic
926361902 2:12096560-12096582 CTGTCTCAGCTATGGGGCTCTGG - Intergenic
927088368 2:19691873-19691895 TTTCCTCATCTCTGGGGCTGTGG - Intergenic
927698021 2:25251112-25251134 CTCCATCAGGACTGGGGCAGTGG + Intronic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
927790948 2:26009088-26009110 CTGCCACTGAATTGGGGCTGAGG - Intergenic
929114245 2:38431021-38431043 CTGCCTTAGAGCTGGGTCTGGGG + Intergenic
929449792 2:42029029-42029051 CAAGCTCAGCACTGTGGCTGTGG - Intergenic
929995669 2:46824997-46825019 CTGACTCAGTACTGGGGGTCAGG - Intronic
929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG + Intronic
930891919 2:56400228-56400250 CTGCCACAGCCCAGGGGCTCAGG - Intergenic
931463919 2:62470620-62470642 CTGGCCCACCACTGGGGGTGGGG + Intergenic
932405040 2:71507100-71507122 GCTCCTCAGCACTGGGGCTTGGG - Intronic
932741121 2:74291848-74291870 CTTCCACTGCACTGTGGCTGAGG + Intronic
934853361 2:97714844-97714866 CTGCCAGGGCAGTGGGGCTGAGG - Intronic
935092099 2:99905091-99905113 CTGTCTCAGCATTGGGGCAGAGG - Intronic
937549873 2:123074653-123074675 CTGCCATTGCACTGGGCCTGGGG + Intergenic
937994066 2:127679874-127679896 CTGCCCCAGGACCTGGGCTGTGG - Intronic
938390047 2:130897827-130897849 CTGATTCAGCACTGGGGGTGAGG + Intronic
938663548 2:133511182-133511204 CTGCAGCAACACTGGTGCTGGGG - Intronic
939961306 2:148568418-148568440 CTGCTTCAGCCCTGTGGCTTCGG - Intergenic
941924931 2:170885261-170885283 CAGCCTCACCACTTGGGCTCAGG - Intergenic
943428650 2:187769937-187769959 ATTCCCCAGCATTGGGGCTGGGG + Intergenic
943441249 2:187931252-187931274 CTGCCTCATTAATGAGGCTGTGG - Intergenic
944303095 2:198146875-198146897 TGGCCTCAGCACTGCTGCTGGGG - Exonic
946161028 2:217836156-217836178 CCGCCTCCGCAGAGGGGCTGGGG + Exonic
946225469 2:218261957-218261979 CAGCCTCAGGCCTGGGGGTGTGG + Intronic
946339366 2:219058176-219058198 AGGCCTCAGCCCTGAGGCTGCGG - Intronic
947651105 2:231786745-231786767 CAGCCACAGCACTGAAGCTGAGG - Intronic
947813031 2:233016088-233016110 TTCCCTCAGCCCTGGGCCTGGGG - Intergenic
948005353 2:234603755-234603777 CTGCCCCAGCTCTGAGGCTTGGG + Intergenic
948221507 2:236273288-236273310 CAGCCCCAGAAGTGGGGCTGGGG + Intergenic
948230036 2:236342689-236342711 CTGCTGCAGCATTGGAGCTGGGG + Intronic
948280857 2:236747107-236747129 CCATCTCAGCACCGGGGCTGTGG + Intergenic
948290556 2:236821124-236821146 CTGCCTGACCACTGTGCCTGGGG + Intergenic
948495458 2:238345839-238345861 CTGGCAGAGCACTGGCGCTGTGG + Intronic
948531811 2:238613700-238613722 TGGCCCCAGCACTGGAGCTGCGG - Intergenic
948804613 2:240448149-240448171 CTGCCTCTCCACAGGGCCTGCGG - Intronic
948852144 2:240713642-240713664 CTGCCTCATCACTGGGAGAGGGG + Intergenic
949021483 2:241743494-241743516 CAGCCTCAGCGCCAGGGCTGAGG - Intronic
1172070389 20:32252423-32252445 CTGTCTCAGGTCTGGGGGTGGGG - Intergenic
1172216931 20:33242295-33242317 CTGCCTCAGCCCTGACACTGAGG + Intronic
1172841018 20:37902914-37902936 CCGCCTCCGCACTCGGGCGGGGG + Intergenic
1173648734 20:44650086-44650108 CTCCCTCTGCCCTTGGGCTGGGG - Intronic
1173741975 20:45407544-45407566 CTGCCAGAGCACTGAGGCTATGG - Intronic
1174910339 20:54601152-54601174 CAGAGTGAGCACTGGGGCTGAGG + Intronic
1174922158 20:54715325-54715347 CTGCCTCACTACTTGAGCTGGGG + Intergenic
1175150749 20:56931994-56932016 CTCCAACAGCACTGGGACTGGGG + Intergenic
1175323176 20:58103708-58103730 CTCCTTCTGCCCTGGGGCTGAGG + Intergenic
1175467813 20:59204439-59204461 CTGTCAAAGCTCTGGGGCTGTGG - Intronic
1175520138 20:59597446-59597468 CAGCCTGAGCTCTGGAGCTGAGG + Intronic
1175677762 20:60961488-60961510 CTGCCTGTGCTCTGCGGCTGTGG - Intergenic
1175853087 20:62104258-62104280 TTGCCTGAGCACTGGTGGTGGGG + Intergenic
1175907295 20:62387159-62387181 CGGGCTCAGGGCTGGGGCTGGGG + Intronic
1176145179 20:63562284-63562306 CTACCTCTGCAGAGGGGCTGCGG + Exonic
1176382999 21:6122732-6122754 CTCCCTCAGCACTGGGGTGGAGG + Exonic
1177198671 21:17929991-17930013 CTGCCTGAGCATTTTGGCTGTGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179659405 21:42864916-42864938 CTGCCACAGCCCTGGGGGTGGGG - Intronic
1179740470 21:43415507-43415529 CTCCCTCAGCACTGGGGTGGAGG - Exonic
1179831514 21:44000069-44000091 CTGACCCAGCAATGGGGGTGCGG - Intergenic
1180017852 21:45098905-45098927 CTGCCTCAGAATTGGGGGTCAGG + Intronic
1180165285 21:46022587-46022609 CAGCCTCAGCTCCGGGTCTGCGG - Intergenic
1181468091 22:23121181-23121203 CAGCCTCAGGTCTGGGGATGGGG - Intronic
1181625339 22:24119039-24119061 CTGTCCCACCTCTGGGGCTGGGG - Intronic
1182095540 22:27622998-27623020 CTTCCTCCCCACTGGGGTTGGGG - Intergenic
1182358124 22:29731426-29731448 CTGCCTCACCACCCTGGCTGTGG + Exonic
1183032484 22:35116468-35116490 CTGACTCACCACTGGCTCTGTGG - Intergenic
1183273952 22:36879581-36879603 CTGCATCAGAGCTGGGGATGGGG - Intergenic
1183380861 22:37489819-37489841 CAGCCTCATCACTGTGGCTGAGG + Intergenic
1183455720 22:37922170-37922192 CTGCAGGAGCACTGGAGCTGGGG - Exonic
1183497252 22:38153962-38153984 CTGCCACAGGGCTGGGGCAGTGG + Intronic
1183597924 22:38823306-38823328 CTGCCTCAGCCATGGGCCTTGGG - Intronic
1184408306 22:44312644-44312666 CTGGCTAAGCACTGGGTCTAAGG - Intronic
1184730040 22:46366898-46366920 GGGCCGCAGGACTGGGGCTGAGG + Intronic
1184816628 22:46876798-46876820 CTGCAGCAGCCCTGGGGGTGGGG - Intronic
1184841911 22:47057058-47057080 CTGCCTTAGCCCCGGGTCTGTGG + Intronic
1184979594 22:48086530-48086552 CAGCCTGGGTACTGGGGCTGGGG - Intergenic
1185021578 22:48379780-48379802 CTGCTCCAGCTCTGGGGCTCTGG - Intergenic
950129695 3:10533734-10533756 CTGTCCCAGCACTGGCACTGGGG - Intronic
950136025 3:10581480-10581502 GTTCCTCATCACTGTGGCTGTGG - Intronic
950656823 3:14441698-14441720 CTGCCTGAGGACTTGGGGTGTGG - Intronic
952337888 3:32420768-32420790 GTTCCTCAGAACTGGGTCTGGGG + Intronic
952383486 3:32821846-32821868 CTGCCTCGGCTCTGGGGACGTGG + Intronic
952904483 3:38130811-38130833 CTGCCACAGCCCTGGGACAGGGG + Intronic
953025103 3:39140495-39140517 CTGCCAGAGTACTGGAGCTGAGG + Intergenic
954453082 3:50582173-50582195 CTTCCTCAGGAATGGGCCTGAGG - Exonic
954635363 3:52068207-52068229 GTGGCTCAGCATGGGGGCTGCGG + Intergenic
954636726 3:52074944-52074966 CTTCCCCAGCACAGGGGCAGAGG + Intergenic
954683510 3:52358476-52358498 CAGGCTTAGCGCTGGGGCTGTGG + Intronic
954692382 3:52402457-52402479 CTGCCTCAGGCCAGGAGCTGAGG + Intronic
954707669 3:52489660-52489682 CTACCTCAGCAATGCTGCTGTGG - Exonic
954811388 3:53250433-53250455 GTGCCTCAGGAGTAGGGCTGGGG - Intronic
955329600 3:58036171-58036193 CTTCGTCAGCTCTGGGGCTTTGG + Intronic
956718393 3:72098215-72098237 CTGCCTGAGCCATGGTGCTGAGG + Intergenic
956718394 3:72098218-72098240 CTGCCTCAGCACCATGGCTCAGG - Intergenic
956927769 3:74007979-74008001 CTGCCTGAACCCTGAGGCTGAGG - Intergenic
957078500 3:75619195-75619217 CTGACCCTGCTCTGGGGCTGGGG + Intergenic
957362915 3:79182521-79182543 CTTCATCAGCACTGGGGCACAGG + Intronic
960280147 3:115772219-115772241 CTGGCTGTGCACTGGGTCTGAGG - Intergenic
960747760 3:120908606-120908628 GCGCCTCAGCGCTGGGCCTGGGG + Intronic
960915168 3:122687491-122687513 CTTCCTGAGCACTGGGTGTGAGG + Intronic
961382173 3:126501990-126502012 CTTCCTCAGCTCGGGGGTTGCGG + Intronic
961658772 3:128457415-128457437 CTCCCTCTGCACTGGGCCTGGGG - Intergenic
962746675 3:138402079-138402101 CTGACTCAGATCTGGGGCTAGGG + Intronic
965605563 3:170494946-170494968 CTTAGTCAGCTCTGGGGCTGGGG - Intronic
966863807 3:184245213-184245235 CTGGCCCAGCGCTGGGGCTGGGG - Exonic
967078169 3:186024070-186024092 CTGAATCAACATTGGGGCTGGGG - Intergenic
967850095 3:194075891-194075913 CTGCCTCAGCACATGGGTTCAGG + Intergenic
968080956 3:195846833-195846855 CTGCCTCCCCAGTGAGGCTGTGG + Intergenic
968297738 3:197590652-197590674 CTCTCTCAGAACTGGGGATGTGG - Intergenic
968456582 4:703641-703663 TTGCCTCAGGACTGGCGGTGGGG + Intergenic
968626001 4:1626961-1626983 CTGCCTGAGGGCAGGGGCTGTGG + Intronic
968814014 4:2812488-2812510 CGGCCCCAGGACTGGGGCTCGGG + Intronic
969239590 4:5889750-5889772 CTCCCCCAGCACTGTGGTTGGGG + Intronic
969258714 4:6020714-6020736 CTGACTGAGCTCTGGGGCGGTGG + Intergenic
969870410 4:10101105-10101127 CTGCCTTGGCGCTGGGGCCGTGG - Intronic
972646856 4:40976686-40976708 CAGACACAGCACTGGGGCTCAGG + Intronic
972662378 4:41128963-41128985 CTGGCTCGTCACTGGGGCTTAGG - Intronic
974064449 4:57064948-57064970 CTGCCTAGGCAGTGGAGCTGTGG - Intronic
975171181 4:71233504-71233526 ATGCCTCAGCACTTGGTCTTAGG + Intronic
975671894 4:76788188-76788210 CTGCATCAGCACTGGGTTTGAGG - Intergenic
975738137 4:77401614-77401636 CTCCCTCACCACTGGGACTCAGG - Intronic
976072685 4:81259767-81259789 CTGGCTTAACACTGGGGCTGGGG - Intergenic
976922005 4:90453311-90453333 CTGCCTCATTAATGAGGCTGTGG - Intronic
981156459 4:141442234-141442256 CCGCTGCAGCACTGGTGCTGAGG - Intergenic
982674532 4:158360474-158360496 AAGTCTCAGCAATGGGGCTGTGG - Intronic
982753754 4:159194089-159194111 GAGCCTCAGCAAAGGGGCTGTGG + Intronic
983195275 4:164799509-164799531 CTGCCTCACTACTTGAGCTGGGG - Intergenic
985564778 5:610038-610060 CTGCCACAGCCCTTAGGCTGTGG - Intergenic
985754289 5:1703931-1703953 CGGCCACAGCACTGGGGCTTCGG - Intergenic
986179057 5:5376449-5376471 CTGGTCCAGCGCTGGGGCTGGGG - Intergenic
986334679 5:6745069-6745091 CTGCCTCAGCGGTGTGACTGTGG + Intronic
987065686 5:14287415-14287437 TTGCCTCAGCCCTGGAGATGAGG + Intronic
989141666 5:38207655-38207677 CTGTCCCAGGACTGGGGATGTGG - Intergenic
991166151 5:63566817-63566839 CTGCATCATTAATGGGGCTGTGG + Intergenic
992592394 5:78308861-78308883 CAGCCTAATCACTGTGGCTGTGG - Intergenic
993945343 5:94111522-94111544 CCCCCTCAGCCCTGTGGCTGGGG - Exonic
996240858 5:121199484-121199506 CAGCCTCAGCTGTGGGGTTGAGG + Intergenic
997398058 5:133580443-133580465 CTTCATAAGGACTGGGGCTGGGG - Intronic
997759477 5:136431326-136431348 CTCCCTCCTCCCTGGGGCTGGGG + Intergenic
998007387 5:138666008-138666030 CAGGCCCAGCAGTGGGGCTGAGG + Intronic
998093629 5:139384745-139384767 CTGCATCAGCTCTGGGTGTGTGG - Intergenic
999432236 5:151534472-151534494 CAGCCACAGCACAGTGGCTGGGG + Exonic
1000729739 5:164818697-164818719 CTCTCTCAGCACTGCGGCTCTGG + Intergenic
1001384553 5:171328093-171328115 CTGGCTGAGGACTGGGGGTGGGG + Intergenic
1002206148 5:177563929-177563951 CTGCCACAACTCAGGGGCTGCGG - Intergenic
1002279161 5:178120732-178120754 GTGCCTCAGCACTGGGGTACAGG + Intronic
1004183936 6:13405997-13406019 CTGCCTCAGAAGTTGGGGTGGGG - Intronic
1005674125 6:28136892-28136914 CTGCCTAAGCACTTGGGTTCCGG + Intergenic
1005713688 6:28526387-28526409 CTGCTTCAGAGCTGGGTCTGAGG + Intronic
1005904000 6:30244576-30244598 ATTCCTCAGCAGTGGGTCTGAGG + Intergenic
1006453706 6:34120272-34120294 AGGCCTCAGCACAGGGCCTGGGG + Intronic
1006603620 6:35241840-35241862 CTGGAGCAGCCCTGGGGCTGGGG - Exonic
1007113203 6:39325436-39325458 CTGCCCCAGCCCAGGGGATGGGG + Intergenic
1007113481 6:39327161-39327183 CTGCCCCAGCCCAGGGGATGGGG + Intergenic
1007689212 6:43687833-43687855 CTGCCCCACCACTGCGGCGGCGG - Intergenic
1008150687 6:47948078-47948100 CTGCTTCAGAGCTGGAGCTGTGG + Intronic
1010653798 6:78487679-78487701 CTGCCCCTTCACTGGAGCTGGGG + Intergenic
1013227902 6:108133910-108133932 CTGCCCCAGCCCAGGGCCTGCGG + Intronic
1013356612 6:109350909-109350931 CTGCTTCTCCACTGGAGCTGAGG + Intergenic
1013524052 6:110958511-110958533 GTGCCTCAGAGCAGGGGCTGGGG - Intergenic
1013857458 6:114591397-114591419 CTGCCTCCTCCCTTGGGCTGGGG + Intergenic
1017124364 6:151051813-151051835 CTGCCTAAGGAGTGGGGCTTGGG + Intronic
1017719047 6:157232384-157232406 CTTCTGCAGGACTGGGGCTGAGG - Intergenic
1017769549 6:157634626-157634648 GTGCCTCAGAACTGGCACTGGGG + Intronic
1018153359 6:160961471-160961493 CTGCCCCAGCTCTGAGGATGGGG + Intergenic
1018388787 6:163327698-163327720 CTCCCGCTGCACTGGGGCTGTGG - Intergenic
1018461389 6:164002666-164002688 TTGCCTGAGCTCTGGGGTTGGGG + Intergenic
1018627477 6:165793466-165793488 CTGCCTGAGACCCGGGGCTGGGG + Intronic
1018817310 6:167343197-167343219 CTGACACAGCCCTGGGGCTCGGG - Intronic
1019032276 6:169023998-169024020 CTGCGGCCGCCCTGGGGCTGCGG - Intergenic
1019199050 6:170298984-170299006 CTGACTCATCACAGGGGCTGAGG + Intronic
1019422677 7:958368-958390 CTGCCTCAGCTGTGGGGATGGGG + Intronic
1019515456 7:1438030-1438052 CACCCTCAGTCCTGGGGCTGGGG - Intronic
1021202378 7:17741323-17741345 GCTCCTCAGCACTGAGGCTGTGG - Intergenic
1021825283 7:24544774-24544796 CAGCCGCAGCAGAGGGGCTGAGG + Intergenic
1022837307 7:34130592-34130614 CAGGCTCTGCACTAGGGCTGGGG + Intronic
1025107935 7:56188211-56188233 CTGCCTGAGCACTGGTGCTTAGG + Intergenic
1030673494 7:112362485-112362507 CTGCCACTTCACTGGGGCTGAGG + Intergenic
1031977383 7:128102667-128102689 CTGCCTGAGGAGAGGGGCTGGGG + Intergenic
1032115171 7:129110819-129110841 CTGCATCAGAGCTGGGGGTGGGG + Intergenic
1032654898 7:133917041-133917063 CTGCCTGACAACTGGGGCTGAGG + Intronic
1033598274 7:142871513-142871535 CTCCTTCAGCTCTGGGGCAGAGG - Exonic
1033774123 7:144587894-144587916 CTGCCTTTGCAGTTGGGCTGGGG + Intronic
1034215321 7:149401214-149401236 GTGCCACAGCACTGGAGGTGGGG + Intergenic
1034253000 7:149707026-149707048 CTGGCTGATCCCTGGGGCTGGGG + Intergenic
1034540366 7:151754505-151754527 CTGGGCCAGCACTGGGGCTTAGG + Intronic
1034686014 7:152972184-152972206 CTGCCTCTGTACTCAGGCTGTGG - Intergenic
1035173339 7:157033099-157033121 CTGCCCCAGCTCTGTGGCTCTGG - Intergenic
1035254198 7:157615612-157615634 TTGGCTCAGCACTGGTCCTGCGG + Exonic
1035527918 8:328293-328315 CTGCTTCAGCAATGGTGATGGGG - Intergenic
1035601814 8:901735-901757 CTGCCACAGCAATGGGGCAATGG - Intergenic
1036649622 8:10634022-10634044 CTGCCTCAGGCCTGCAGCTGGGG - Intronic
1036755555 8:11468600-11468622 AGGGCTCAGCACCGGGGCTGTGG - Intronic
1037766247 8:21774184-21774206 CTGCCTGGGCACTGGGGAGGGGG - Intronic
1037965641 8:23131834-23131856 ATTCCTGAGCACTGGAGCTGAGG - Intergenic
1038133367 8:24758888-24758910 CTGCCTCAGTTGTGGTGCTGGGG - Intergenic
1038810840 8:30841000-30841022 TTGCCTGAGCACAGGGGCGGAGG - Intronic
1041082921 8:54230461-54230483 CTGGCACAGCCCTGGGGCCGGGG - Intergenic
1041157791 8:55005766-55005788 CAGCCCCAGCACTCAGGCTGAGG - Intergenic
1041292111 8:56317867-56317889 CTATCTGGGCACTGGGGCTGAGG + Intronic
1046103810 8:109644254-109644276 CTGCCTTAGCTCAGGGTCTGCGG - Intronic
1046768744 8:118098032-118098054 GTGGCTCTGCCCTGGGGCTGGGG + Intronic
1048163124 8:132038957-132038979 CTGCATCAGCCGTGGGGCTGAGG - Intronic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049235092 8:141508300-141508322 CCGCCTTAGGCCTGGGGCTGCGG + Intergenic
1049258050 8:141624374-141624396 CTGTCTGAGCATTAGGGCTGGGG - Intergenic
1049268762 8:141683273-141683295 CGGCCACAGCACAGGGGCTGGGG + Intergenic
1049418296 8:142505478-142505500 GTGGCCCTGCACTGGGGCTGAGG + Intronic
1049562079 8:143316966-143316988 CTGGGGCAGCACTGGGGCTGTGG - Intronic
1050425744 9:5510923-5510945 CTGCCTCAGAAATTGTGCTGAGG + Intronic
1051313004 9:15796749-15796771 CCTCCTCAGCCCTGGGGTTGGGG + Intronic
1051522967 9:18011481-18011503 CCGCCCCAGCACTGATGCTGAGG + Intergenic
1052049140 9:23825227-23825249 CCGCCTGAGGGCTGGGGCTGGGG - Intronic
1054722175 9:68615164-68615186 CAGCCACACCACTGGTGCTGGGG + Intergenic
1055597854 9:77883706-77883728 CTGCTTCTGCACTGAGTCTGTGG + Intronic
1056897602 9:90565514-90565536 GTGGCTCAGGACTGAGGCTGAGG - Intergenic
1057041718 9:91853102-91853124 CTGGCTGGGGACTGGGGCTGAGG + Intronic
1057272749 9:93659930-93659952 CTACCCCAGCACAGCGGCTGAGG - Intronic
1057297717 9:93859307-93859329 GTGCCTCAGCCCTGTAGCTGGGG + Intergenic
1057328057 9:94084610-94084632 CAGCCGCAGTACTGGGTCTGAGG - Exonic
1057476994 9:95411477-95411499 CAGCCTCTTCCCTGGGGCTGGGG + Intergenic
1057818273 9:98311688-98311710 CTGCTCCAGCAGTGGGGCTGTGG - Intronic
1057894269 9:98894649-98894671 GTGCCCCAGCACTGTGCCTGAGG + Intergenic
1058843574 9:108934104-108934126 CAGCCGCAGCACTGGGAGTGCGG + Exonic
1058904080 9:109467367-109467389 CTGAATCACCACTGGGGGTGCGG - Intronic
1059437674 9:114286299-114286321 GTACCTCTGCACTGGGGCTGTGG - Intronic
1059768509 9:117406136-117406158 CTCCTTCATCTCTGGGGCTGTGG - Intronic
1060199632 9:121645120-121645142 CTGGCCCAGGCCTGGGGCTGAGG - Intronic
1060243384 9:121924333-121924355 CTGCCACAGTGCTGGGGATGTGG - Intronic
1060670263 9:125462488-125462510 CAGCCTCTGAACTGGGGCTAAGG + Intronic
1060679031 9:125544879-125544901 CTGACTCTCCACAGGGGCTGGGG + Intronic
1060872850 9:127056595-127056617 CTGCCATTCCACTGGGGCTGGGG - Intronic
1061167887 9:128934887-128934909 CTGCCACAGCACTGGGGATAGGG + Intronic
1061425082 9:130493609-130493631 CTGGGTCAGCCCAGGGGCTGCGG - Intronic
1061456414 9:130701246-130701268 GCAGCTCAGCACTGGGGCTGAGG + Intronic
1061468929 9:130807105-130807127 CTGCCACAGCACTCCAGCTGGGG + Intronic
1061576671 9:131511668-131511690 CGGCCCCAGCTCTGTGGCTGTGG + Intronic
1061727649 9:132590174-132590196 CTGCCCCCGGACCGGGGCTGAGG - Exonic
1061728295 9:132593782-132593804 GTGCCTCAACACTGGTCCTGGGG + Exonic
1061962160 9:133993693-133993715 CTGGCTCAGCCCGGAGGCTGGGG + Intergenic
1062083135 9:134634951-134634973 CTGCCTCAGCAAGGGGCCTGAGG - Intergenic
1062249893 9:135588737-135588759 GTTCCTCGTCACTGGGGCTGGGG + Intergenic
1062483416 9:136762950-136762972 CTGCCTGAGTTCTGGGGCTGGGG - Intronic
1062597126 9:137304435-137304457 CTGCCACGGCAGTGTGGCTGTGG + Intergenic
1062612384 9:137380752-137380774 CGGCTTCAGTAGTGGGGCTGGGG + Intronic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1186361036 X:8842087-8842109 CTGGCTCCACACTGGGGCTTTGG + Intergenic
1187004009 X:15213855-15213877 CTGGGACAGCACTGCGGCTGGGG + Intergenic
1188765687 X:34088484-34088506 CTGCCTCATTAATGAGGCTGTGG + Intergenic
1189160050 X:38802026-38802048 CTGCTTAAGCACTGGGGGTTGGG + Intronic
1189239916 X:39517096-39517118 CTGCCCCAGGGCTGAGGCTGGGG - Intergenic
1190911071 X:54773328-54773350 CTCCCCCTACACTGGGGCTGGGG + Intronic
1191251159 X:58260843-58260865 CAGGCCCAGCACAGGGGCTGTGG - Intergenic
1192034039 X:67544675-67544697 CTGGCTCCGCACTCGGGGTGGGG - Exonic
1192227843 X:69241600-69241622 TTGGCTCAGAACTGGTGCTGAGG + Intergenic
1193080907 X:77405084-77405106 CTGACTGTGCCCTGGGGCTGGGG - Intergenic
1195079293 X:101355889-101355911 TGGGCTCAGCACTGGGGCAGAGG + Intronic
1195914711 X:109924756-109924778 CTGCTTCAGGGCTGGGACTGGGG - Intergenic
1197512669 X:127390152-127390174 ATGCCTGAACTCTGGGGCTGTGG - Intergenic
1197732809 X:129826492-129826514 CTGCCTGATCACTGGGCCTGGGG - Intronic
1198428384 X:136542035-136542057 CGGCCTCAGGACTGGGGCTGGGG - Intronic
1199695946 X:150342594-150342616 CAGCCCCAGCTCTGGAGCTGAGG - Intergenic
1200124617 X:153807417-153807439 CTGCCTGGGAGCTGGGGCTGAGG - Intronic
1200218961 X:154381254-154381276 CTGCCTTAGCAGTGGGGGTGGGG + Exonic
1201145825 Y:11065014-11065036 CTCCATCAGCACTGGGGCAAGGG - Intergenic