ID: 927718404

View in Genome Browser
Species Human (GRCh38)
Location 2:25367514-25367536
Sequence CAGCTGCTCCAGGGCGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927718404_927718418 17 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718418 2:25367554-25367576 CAGCGATTACAGGCGGTGGGGGG No data
927718404_927718413 13 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718413 2:25367550-25367572 TGGCCAGCGATTACAGGCGGTGG No data
927718404_927718420 27 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718420 2:25367564-25367586 AGGCGGTGGGGGGAGCCTGAGGG No data
927718404_927718412 10 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718412 2:25367547-25367569 GCATGGCCAGCGATTACAGGCGG No data
927718404_927718419 26 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718419 2:25367563-25367585 CAGGCGGTGGGGGGAGCCTGAGG No data
927718404_927718409 -7 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718409 2:25367530-25367552 GCAGCTGCCTGACACAGGCATGG No data
927718404_927718415 15 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718415 2:25367552-25367574 GCCAGCGATTACAGGCGGTGGGG No data
927718404_927718417 16 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718417 2:25367553-25367575 CCAGCGATTACAGGCGGTGGGGG No data
927718404_927718411 7 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718411 2:25367544-25367566 CAGGCATGGCCAGCGATTACAGG No data
927718404_927718414 14 Left 927718404 2:25367514-25367536 CCATGGCCGCCCTGGAGCAGCTG No data
Right 927718414 2:25367551-25367573 GGCCAGCGATTACAGGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927718404 Original CRISPR CAGCTGCTCCAGGGCGGCCA TGG (reversed) Intergenic
No off target data available for this crispr