ID: 927718733

View in Genome Browser
Species Human (GRCh38)
Location 2:25369570-25369592
Sequence CGTCAGTACCAGAGGATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927718731_927718733 -10 Left 927718731 2:25369557-25369579 CCAAAAGCATCGTCGTCAGTACC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 63
927718730_927718733 -5 Left 927718730 2:25369552-25369574 CCAGGCCAAAAGCATCGTCGTCA 0: 1
1: 0
2: 0
3: 1
4: 65
Right 927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 63
927718725_927718733 28 Left 927718725 2:25369519-25369541 CCCTACCATCAGGTGGTCAGGAA 0: 1
1: 0
2: 2
3: 12
4: 98
Right 927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 63
927718726_927718733 27 Left 927718726 2:25369520-25369542 CCTACCATCAGGTGGTCAGGAAA 0: 1
1: 0
2: 3
3: 14
4: 132
Right 927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 63
927718727_927718733 23 Left 927718727 2:25369524-25369546 CCATCAGGTGGTCAGGAAAGCTT 0: 1
1: 0
2: 1
3: 12
4: 143
Right 927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927718733 Original CRISPR CGTCAGTACCAGAGGATGCT TGG Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906922393 1:50078526-50078548 AGTCAGTACCAGGGGAAACTGGG + Intronic
912950258 1:114115894-114115916 GGACAGTCCCAGAGGAGGCTGGG - Intronic
914393279 1:147241139-147241161 CTTCAGTACCATAGAGTGCTTGG + Intronic
915354426 1:155247695-155247717 AGCCAGTGCAAGAGGATGCTGGG + Exonic
917931979 1:179828897-179828919 AGTCAGTAGCAGAGGAGGCAGGG - Intergenic
918192216 1:182186762-182186784 CGTCAGAACCTGATCATGCTGGG - Intergenic
920714082 1:208323140-208323162 CTTCACTCCCAAAGGATGCTAGG - Intergenic
922233459 1:223705646-223705668 TGTCAGCACCACAGGGTGCTGGG - Intronic
922800347 1:228362148-228362170 GGTGAGAACCAGAGGAAGCTTGG - Intronic
1063159296 10:3408199-3408221 CCTCAGGAGCAGAGGATGCAGGG + Intergenic
1064375060 10:14787995-14788017 TATCAGGATCAGAGGATGCTGGG - Intergenic
1087520185 11:99223255-99223277 TGTCAGTAGCAGAGGATAATGGG + Intronic
1087983302 11:104644934-104644956 CGTGAGTACCAACGGATCCTAGG + Intergenic
1088741940 11:112774408-112774430 ATTCAGCACCAGATGATGCTGGG - Intergenic
1095264432 12:40137347-40137369 CCTCAGTGCCTGATGATGCTTGG - Intergenic
1096606779 12:52772291-52772313 CGCCTGGACCAGGGGATGCTGGG + Intronic
1104920806 12:132289780-132289802 CGTCTGGACCAGGGGCTGCTTGG - Intronic
1113948875 13:114060204-114060226 CGGCAGGACCGGAGCATGCTGGG + Intronic
1114259629 14:21026908-21026930 CATCAGCACCAGAGGAACCTGGG + Intronic
1117429859 14:55646124-55646146 TGTGTGTACCAGAGGATGCCAGG + Intronic
1117544971 14:56785873-56785895 TGTCAGGACCAGAGGATGTTTGG - Intergenic
1122871535 14:104641080-104641102 GGTCAGGAGCAGAGGGTGCTGGG + Intergenic
1125512055 15:40297420-40297442 AGACACTCCCAGAGGATGCTAGG - Intronic
1126350992 15:47744630-47744652 CGTAAGTGCCAGTGGAGGCTCGG + Intronic
1127888088 15:63221696-63221718 CTTCAGGACCAGAGCATGGTTGG + Intronic
1133125365 16:3642698-3642720 CTTCTGTCCTAGAGGATGCTTGG + Intronic
1133663203 16:7939100-7939122 CTTCAGTAGCAGAGGATGGAAGG + Intergenic
1136229832 16:28879680-28879702 CGTCTGTACAATGGGATGCTCGG - Intronic
1138443045 16:57046628-57046650 GGACAGTACCAGAGGCTCCTGGG - Exonic
1147325162 17:39666506-39666528 CGGCACTAACAGAGGGTGCTGGG - Exonic
1152410122 17:80118890-80118912 TGCCAGGAACAGAGGATGCTGGG + Intergenic
1152797056 17:82313734-82313756 CGTCAGTACGAGAGAGTGCCTGG - Intergenic
927718733 2:25369570-25369592 CGTCAGTACCAGAGGATGCTTGG + Intergenic
934620119 2:95798575-95798597 CGTCAGTGCCAGAAGCTGCTGGG + Intergenic
934640769 2:96025982-96026004 CGTCAGTGCCAGAAGCTGCTGGG - Exonic
940130571 2:150376798-150376820 CATCAGTCCCAGAGCAAGCTGGG + Intergenic
940197086 2:151106684-151106706 CGCAAGTACCAAAGGAAGCTGGG + Intergenic
944971851 2:205002409-205002431 TGTCAGTCGCAGAGGAAGCTGGG - Intronic
946056828 2:216910073-216910095 AGGCAGTGCCAGAGGATTCTTGG + Intergenic
1171183251 20:23106463-23106485 CGTTAGTGTCAGGGGATGCTGGG + Intergenic
1172144065 20:32743987-32744009 CGGCAATACCAGGTGATGCTGGG - Exonic
1173788268 20:45811045-45811067 TGTCTGTTCCAGAGGATGCCTGG + Exonic
1182286848 22:29253872-29253894 CGGCAGTCCCAGAAGCTGCTGGG - Intronic
1184703490 22:46194055-46194077 CCCCAGCACCAGAGCATGCTGGG + Intronic
952568981 3:34691117-34691139 GGTCTGCACCAGAGAATGCTAGG - Intergenic
957304376 3:78438053-78438075 TGTTAGTAACAGAGGAAGCTGGG + Intergenic
969974584 4:11085303-11085325 CCTCAGTACCTGAGGCTGGTAGG - Intergenic
984615277 4:181889761-181889783 CGTCAGCAGTAGAGGATGTTAGG - Intergenic
989258629 5:39394342-39394364 CCTCAGTACCAGTGGACACTTGG + Exonic
993822932 5:92643127-92643149 TGTCTGTACAAGAGGCTGCTAGG - Intergenic
1000336634 5:160246141-160246163 GGTCAGGAGCACAGGATGCTGGG + Intergenic
1001912033 5:175528452-175528474 CCTCAGTATCCGTGGATGCTTGG - Exonic
1004039716 6:11963495-11963517 TGTCATTACCAGAGGTTGGTGGG - Intergenic
1013463489 6:110398164-110398186 GGTGATGACCAGAGGATGCTGGG - Intronic
1019348976 7:544350-544372 CTTCAGGCCCACAGGATGCTGGG + Intergenic
1030191817 7:106817895-106817917 CGGCAGGGCCAGAGGATTCTGGG + Intergenic
1034343758 7:150373276-150373298 CGTTAATACCAGAGGATGGAGGG - Intronic
1034436585 7:151065500-151065522 TGTCAGTACCAGTGGATGATTGG + Intronic
1038767358 8:30441635-30441657 CGTCTGTAACAGAGGAAGTTAGG - Intronic
1038906977 8:31915957-31915979 TGTCAGTTCCAGAATATGCTTGG - Intronic
1051369868 9:16349177-16349199 AGTCAGTCCCACAGGATGGTTGG + Intergenic
1052033969 9:23659505-23659527 AGTCAGCACTAGAGGATGCCTGG + Intergenic
1053002456 9:34584823-34584845 GGTCTGGACCAGAGGAGGCTGGG - Intronic
1061426178 9:130499764-130499786 CGACAGTAACAGAGGGTCCTAGG + Intronic
1186930098 X:14379889-14379911 CCTCAGTACCAGTGGAGGATTGG + Intergenic
1187753875 X:22498268-22498290 CATAAGTACCAGAGTATGTTGGG - Intergenic
1195342519 X:103919153-103919175 CTTCAGGGCCAGAGGCTGCTTGG - Intronic