ID: 927722926

View in Genome Browser
Species Human (GRCh38)
Location 2:25398371-25398393
Sequence GATCCTAACGCCAAGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927722926_927722933 15 Left 927722926 2:25398371-25398393 CCCCAGCCCTTGGCGTTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 927722933 2:25398409-25398431 GAAGCCAGGACAGAGCTGTCAGG 0: 1
1: 1
2: 1
3: 21
4: 282
927722926_927722934 16 Left 927722926 2:25398371-25398393 CCCCAGCCCTTGGCGTTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 927722934 2:25398410-25398432 AAGCCAGGACAGAGCTGTCAGGG 0: 1
1: 1
2: 1
3: 27
4: 222
927722926_927722932 1 Left 927722926 2:25398371-25398393 CCCCAGCCCTTGGCGTTAGGATC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 927722932 2:25398395-25398417 CACTGGATGAAAATGAAGCCAGG 0: 1
1: 0
2: 1
3: 25
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927722926 Original CRISPR GATCCTAACGCCAAGGGCTG GGG (reversed) Intronic
900484204 1:2913852-2913874 GGTCCTAAAACCAGGGGCTGGGG - Intergenic
901670219 1:10851667-10851689 GCTCCTCACCCCAGGGGCTGGGG - Intergenic
907829321 1:58049128-58049150 GATCCAAACACCAAGTGCTCCGG - Intronic
907915575 1:58865844-58865866 GCTCCTAAGGCCAAGAGCTATGG + Intergenic
910010137 1:82451597-82451619 CCTACTAAAGCCAAGGGCTGTGG - Intergenic
910864917 1:91779630-91779652 GATAATAATGCCAAGGACTGTGG + Intronic
914862760 1:151400001-151400023 GAACTTAACGCCGAGGACTGAGG - Exonic
922257084 1:223901803-223901825 GATCCTAGAGCCAAGAGATGAGG - Intergenic
923738616 1:236635398-236635420 GATCCTATGGCCAGGGGCAGAGG + Intergenic
924338277 1:243004614-243004636 GATCCTAGAGCCAAGAGATGAGG - Intergenic
1064035117 10:11908472-11908494 GATCCTCAGGCCTGGGGCTGGGG - Intergenic
1064490541 10:15851194-15851216 GATCCTAAAACCAAGACCTGGGG - Intronic
1068856952 10:61807625-61807647 GCTCCTAACGCCCAGGCCTATGG + Intergenic
1069062083 10:63904916-63904938 GATCCTAAGGGCAGGGGATGTGG + Intergenic
1070000794 10:72375623-72375645 TATCATCATGCCAAGGGCTGAGG + Intronic
1075607579 10:123824743-123824765 AATCCTAACTTCAAGGGATGTGG + Intronic
1081702539 11:45161269-45161291 GATCCCACCTCCATGGGCTGGGG + Intronic
1087262299 11:96024674-96024696 GATCCTTAGGCACAGGGCTGGGG - Intronic
1091317307 11:134623715-134623737 GATCCCAAGCCCTAGGGCTGTGG + Intergenic
1094284007 12:28772226-28772248 GTTCCTAACTCAAAGGGCTCTGG + Intergenic
1113385019 13:109840753-109840775 AATCCTGAAGACAAGGGCTGTGG - Intergenic
1117922187 14:60736475-60736497 GATCTTAACAAAAAGGGCTGAGG - Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1120359690 14:83482880-83482902 AATCATAATGCCAAGAGCTGAGG + Intergenic
1125254476 15:37747170-37747192 TATCCTAAGGCCAAGGCATGCGG + Intergenic
1125560656 15:40630459-40630481 GTTCCTAACCCCAGGGGTTGGGG - Intronic
1129172733 15:73817870-73817892 GGTCCTCCCGCCAAGGGCAGGGG - Intergenic
1131765126 15:95667841-95667863 GATCCTAATGGCATGGGGTGAGG - Intergenic
1132734531 16:1379041-1379063 TTTCCTAACGCCCGGGGCTGAGG - Intronic
1132939311 16:2499094-2499116 GAGCCAAGCGCCAGGGGCTGGGG - Intronic
1135959113 16:26981048-26981070 TATTCTAAGGCCAAGGGCTGGGG + Intergenic
1138139214 16:54552884-54552906 GATCTTAACTCCCTGGGCTGGGG - Intergenic
1141141612 16:81500176-81500198 GAACATGACGCCATGGGCTGTGG + Intronic
1141591373 16:85071311-85071333 CATACTGACGCCAAGGTCTGAGG - Intronic
1142223530 16:88866515-88866537 GACCCTGAGGCCCAGGGCTGGGG - Exonic
1142233625 16:88911221-88911243 GACCCTGACCCCAAGGCCTGTGG + Intronic
1143683395 17:8494248-8494270 GATCCTAGTTCGAAGGGCTGAGG - Intronic
1148020244 17:44548454-44548476 GAACCTAATGCCAAGGGGAGAGG - Intergenic
1148745343 17:49914914-49914936 GAACCTATCTCCTAGGGCTGTGG - Intergenic
1150463351 17:65371295-65371317 TTTCCTAACTCCTAGGGCTGTGG - Intergenic
1152233897 17:79128561-79128583 GCTCCTAACTCCAAGGTCTGTGG + Intronic
1153818008 18:8807676-8807698 GATCTTAACTCCTATGGCTGTGG - Intronic
1155564079 18:27113511-27113533 AATCCTAACCCCAAGGCCTTGGG + Intronic
1158714030 18:59862251-59862273 AAACCTAACCCCAAGGGCTTAGG + Intergenic
1161290332 19:3490685-3490707 GATCCTAGAGCCAATGGCTGCGG + Intergenic
1164769983 19:30801230-30801252 GGTCTTAAAGCCAAGGGCTCAGG + Intergenic
1165601465 19:37058480-37058502 GATCCAAAGGGCAAGGGCTGGGG + Intronic
1165862106 19:38914814-38914836 GAGGCTAACCCGAAGGGCTGTGG + Intergenic
927722926 2:25398371-25398393 GATCCTAACGCCAAGGGCTGGGG - Intronic
928400112 2:30971676-30971698 GATGCTAACCCCAGGGTCTGGGG + Intronic
947722820 2:232379941-232379963 GACCCCCAGGCCAAGGGCTGGGG + Intronic
948332613 2:237182122-237182144 ATTCCTCAGGCCAAGGGCTGTGG + Intergenic
948892786 2:240915447-240915469 GATCCCAGGGCCAGGGGCTGAGG - Intergenic
1170032172 20:11955220-11955242 GAACCTAAAGCCAAAGGCTTTGG - Intergenic
1174514174 20:51078588-51078610 GATGCTGAAGGCAAGGGCTGAGG - Intergenic
1175246080 20:57582944-57582966 GATCCTATTGCCAAGGGCACAGG + Intergenic
1175293892 20:57895749-57895771 GATGCTGACCCCCAGGGCTGGGG - Intergenic
1176289417 21:5036289-5036311 GATCCTAAGCCCCAGGACTGAGG + Intronic
1185248726 22:49788064-49788086 TTCCCTAACGCCAAAGGCTGCGG + Intronic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
957438852 3:80216381-80216403 GATGCAAACACCAAGTGCTGTGG + Intergenic
964756438 3:160093916-160093938 GATTCTAAATCCAGGGGCTGGGG - Intergenic
970942486 4:21651268-21651290 TATCATAAAGCCAAGGCCTGAGG + Intronic
979238842 4:118430665-118430687 GATCCTAGAGCCAAGAGATGAGG + Intergenic
979714619 4:123822708-123822730 AATCCTAACCCCAAAGGCAGTGG - Intergenic
998758700 5:145408148-145408170 GATCTAAACCTCAAGGGCTGCGG - Intergenic
998817943 5:146032440-146032462 GATCCTAAAGCCAGGGGAAGGGG + Intronic
1003890890 6:10562766-10562788 TACCCTGAAGCCAAGGGCTGGGG + Intronic
1006009736 6:31032352-31032374 GGTCCTGACGCCGTGGGCTGAGG - Exonic
1009418772 6:63442958-63442980 GGTCCCATCGCCAAGGGTTGAGG - Intergenic
1010540788 6:77089539-77089561 GATCATAATTCCAAGGTCTGTGG - Intergenic
1017044545 6:150334812-150334834 GATCCCACAGCCAAGGCCTGGGG + Intergenic
1023969328 7:44979508-44979530 GATCCTAATGCCCAGGCCTTTGG + Intergenic
1035869687 8:3124039-3124061 GATTCTAAGCCCAATGGCTGCGG + Intronic
1036081078 8:5556248-5556270 GATCATAAAGTCAATGGCTGAGG - Intergenic
1037625977 8:20607565-20607587 GATCCCAACCCCACGGGCTAGGG - Intergenic
1037988565 8:23304812-23304834 GAACCTGAGGCCAAGGGCAGGGG - Intronic
1054782434 9:69177323-69177345 GATCCTAAATCCAAGGGTTAGGG + Intronic
1056816410 9:89804542-89804564 GATCCTAACACCACCGGATGGGG - Intergenic
1059357395 9:113710538-113710560 GATCCTGACTGTAAGGGCTGTGG + Intergenic
1060287181 9:122264491-122264513 GATCCTAACAGCAAGCGGTGGGG + Intronic
1060563396 9:124567259-124567281 GATCAGAACTCCAAGGGGTGGGG + Intronic
1062407064 9:136401790-136401812 GCCCCTAACCCCAAGGGCTGAGG + Intergenic
1186659626 X:11656545-11656567 GCTGCTACAGCCAAGGGCTGTGG + Intronic
1199393752 X:147310137-147310159 CATCCTAAAGGCAAGGGCCGTGG + Intergenic
1202386599 Y:24332473-24332495 GATCCTAGAGCCAAGAGATGAGG + Intergenic
1202484186 Y:25337655-25337677 GATCCTAGAGCCAAGAGATGAGG - Intergenic