ID: 927723464

View in Genome Browser
Species Human (GRCh38)
Location 2:25402918-25402940
Sequence CTTTCTTAGTAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927723464 Original CRISPR CTTTCTTAGTAGAAGGAAGA AGG Intronic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
905592960 1:39180713-39180735 CTACCTTAGTAAAAGGAAGAAGG - Intronic
905600723 1:39248186-39248208 ATGTTTTAGTAGAAAGAAGACGG - Intronic
906863482 1:49389162-49389184 CATTCTTAGCTGAAGGAAGGAGG - Intronic
908222387 1:62020481-62020503 CTTTCTTTATGGAAGGAGGAGGG - Intronic
908649765 1:66319338-66319360 CTTTATTTGTAGAATGAAAATGG - Intronic
908874307 1:68652897-68652919 CTTTCTTATGAGAAGGGACAAGG + Intergenic
909929583 1:81480531-81480553 CTTTCTCTGTATAAGAAAGATGG + Intronic
911205533 1:95088545-95088567 CTTACTTTGTTAAAGGAAGATGG + Intergenic
911434831 1:97844420-97844442 CTATCCTAGGAGAAGGGAGAGGG + Intronic
912197769 1:107419609-107419631 TTTTTTTTGAAGAAGGAAGAAGG - Intronic
914384157 1:147151381-147151403 CTTACATGGTAGAAGGCAGAGGG + Intergenic
914925386 1:151881682-151881704 CTTGCTTTTTAGAAGCAAGAGGG - Intronic
917106004 1:171492698-171492720 GTTTCTTATTAAAAGCAAGAGGG + Intronic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
919659997 1:200234956-200234978 CATACTTAGTAGATGGCAGAGGG - Intergenic
920827807 1:209438063-209438085 CTTCCTTCTTAGAAGGCAGATGG - Intergenic
921634070 1:217471635-217471657 CTTTCTAACTTGATGGAAGAGGG + Intronic
924083041 1:240419686-240419708 GTTTCTTTGTAGAAGGACTAGGG + Intronic
1062794111 10:329912-329934 CTTTCTTAGTAGAAAACACAGGG + Intronic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1064660941 10:17607445-17607467 TTTTCTTAGTAGAAGAAATATGG - Intronic
1066055878 10:31679444-31679466 CTTTCTTTGGGGAAGAAAGATGG - Intergenic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1068544529 10:58330992-58331014 CTTTCCTTGAAGAAGGAATAAGG + Intergenic
1069342683 10:67430546-67430568 CTTTCCTAATACAAGGGAGATGG + Intronic
1069923141 10:71829633-71829655 CTTTATTAGTAGCATGAAAACGG + Intronic
1070427124 10:76299821-76299843 ATTTCTTTGTACAATGAAGACGG - Intronic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1072257928 10:93638529-93638551 ATTTCTTATTTAAAGGAAGAAGG + Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1074740278 10:116479732-116479754 CTTCCTTATTAGAAAGAAAAAGG - Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075661385 10:124199412-124199434 CTTTCTTACCAGAAGCAATAAGG + Intergenic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078903276 11:15661336-15661358 CTTTTCTAGAAGAATGAAGAAGG + Intergenic
1079481118 11:20881120-20881142 CTTACTTATCAGAAGGAAAAGGG - Intronic
1080586027 11:33683354-33683376 CTTTTTTTTTAGAAGGAAGATGG - Intergenic
1080609566 11:33892234-33892256 CATTCTGAGTAGGAGGATGAGGG - Exonic
1083970665 11:66072001-66072023 TTACCTTTGTAGAAGGAAGAGGG - Intronic
1084899135 11:72296694-72296716 CTTTCCTAGTAGAAGGAGTGGGG - Intronic
1087063170 11:94002638-94002660 CTTTAATGGTAGAAGGAAGAAGG + Intergenic
1087257746 11:95975358-95975380 CTTTTTTAGTAGAGGGGAAAGGG + Intergenic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1088018825 11:105094042-105094064 CTATCTTAGTTGAAGGAAGTAGG + Intronic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1088225713 11:107617461-107617483 CTTCCTTATCAAAAGGAAGAAGG + Intronic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1091082339 11:132682335-132682357 GTTTCTTAGAGGAAGGAAGGAGG + Intronic
1092565881 12:9664991-9665013 CTCACATAGTAGAAGGAACAAGG - Intronic
1092669238 12:10843629-10843651 TTTTCTTAGTAGAAGGAATAGGG + Intronic
1094019610 12:25900406-25900428 TTTTCTTAATAGAAGAAATAAGG - Intergenic
1095745169 12:45650092-45650114 CTTTCTTAGTATAATGAAAATGG + Intergenic
1096116128 12:49056319-49056341 ATTTCTTAGAAGAAGGGACAAGG - Intronic
1096218353 12:49810676-49810698 CTGACTTAATAGAAGGAAGCTGG - Intronic
1096672815 12:53210445-53210467 CTTTCTTGGTAGAAGAAAACAGG - Intergenic
1096905850 12:54934749-54934771 CTTTCTTCTTAGAAGAAAAATGG - Intergenic
1097587074 12:61528056-61528078 CTTTCTTAGTGGTAGAAAGTAGG - Intergenic
1097662633 12:62447400-62447422 CTTTATTAGTAGCATGAACATGG - Intergenic
1099312594 12:81046379-81046401 CTTTGATAGTTGTAGGAAGATGG + Intronic
1099330837 12:81284468-81284490 CTTTTTGAGTAGAAGAAACAGGG - Intronic
1099686778 12:85899675-85899697 CTTTTCTAGTAGATGGAAGCTGG + Intergenic
1100244140 12:92739480-92739502 GTTTCTTAGGACAAGGAAGGTGG - Intronic
1100358227 12:93851936-93851958 CTTTTTTAGTAACAGGAATATGG - Intronic
1100370877 12:93967265-93967287 TTTTCTTAGTACAAGAAGGAGGG - Intergenic
1100375336 12:94010334-94010356 GTTTCTTTGTAGAAGCATGAGGG + Intergenic
1100763903 12:97842035-97842057 CTTTCTAATTAGAAAGAGGAAGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1102698481 12:114818140-114818162 CCTTCTTGGTAGAAGGCAGGCGG + Intergenic
1105466994 13:20653260-20653282 CTTTCTAAGTAGAAGCCTGATGG - Intronic
1106084945 13:26533415-26533437 ATTTCTTAATAGAAGGAAAATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1107915054 13:45141351-45141373 CTTTCTTAGTTTAAAGCAGATGG + Intronic
1109234589 13:59799280-59799302 CTTCCTTCATCGAAGGAAGAAGG + Intronic
1110283007 13:73717531-73717553 ATTTATTAGTAAAAGGGAGAAGG - Intronic
1110438818 13:75505070-75505092 CTTTCTCAGGCCAAGGAAGAAGG - Intergenic
1111102860 13:83610691-83610713 CTTTATCAGTAGCATGAAGATGG - Intergenic
1111313102 13:86516298-86516320 CTTTATCAGTAGCAGGAAAATGG - Intergenic
1112840916 13:103576718-103576740 CTTTATTAGTAGAATGAGAATGG + Intergenic
1112884032 13:104147014-104147036 CTCACATGGTAGAAGGAAGAAGG + Intergenic
1113573905 13:111381514-111381536 ATTTATTAGTTGAAGGAATAAGG + Intergenic
1114058042 14:18992022-18992044 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1114104506 14:19409732-19409754 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
1114199804 14:20509479-20509501 CTTTAATAGTAGAAGGAATCTGG + Intronic
1114578142 14:23731662-23731684 CTTTATGAGCAGAAGAAAGAAGG - Intergenic
1114667865 14:24391253-24391275 ACTTCTTAGTACAAGGAAGAAGG + Intergenic
1115036174 14:28859076-28859098 CTTTTTTAACAAAAGGAAGAGGG - Intergenic
1116735862 14:48690697-48690719 TTTTCTTGGTAGAAGAAGGATGG - Intergenic
1117841621 14:59866749-59866771 CTTTCTCAAAAGAAAGAAGATGG + Intronic
1120763416 14:88306356-88306378 CTTCTTTGGTAGAAGCAAGATGG + Intronic
1121906180 14:97748254-97748276 ATTTCTTAGTAGGAGGAGGGAGG + Intergenic
1122846365 14:104501770-104501792 CTTTATTAGTAGCATGAAAATGG + Intronic
1124618124 15:31257126-31257148 CTTACATAGTAGAAGGGACAAGG - Intergenic
1124831950 15:33157561-33157583 GTTTGTTAGTAGAAGGCAGTAGG - Intronic
1124996268 15:34726082-34726104 ATTTCTTAGGAGATGAAAGAAGG + Intergenic
1126385686 15:48091062-48091084 ATTTCTTATTATAAGGGAGAGGG - Intergenic
1127044854 15:55014851-55014873 CTTTCTTAATAAAAATAAGAGGG + Intergenic
1128058910 15:64721183-64721205 CGTTCTTTGTAGGAGAAAGAGGG - Intergenic
1128095080 15:64947858-64947880 CATTCTTGGTAAAAAGAAGAGGG + Intronic
1128105500 15:65041643-65041665 TTCTCTTATTAAAAGGAAGAAGG + Intergenic
1128292259 15:66486919-66486941 CTCTCTCAATAGAAGGAAGGGGG + Intronic
1130529298 15:84733960-84733982 TTACCTTAGAAGAAGGAAGAAGG + Intergenic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1131007462 15:88990280-88990302 GTTTGTTGCTAGAAGGAAGATGG - Intergenic
1132140031 15:99384768-99384790 CTTTCTTACTAGAGAGAAGTGGG - Intronic
1132368494 15:101276457-101276479 GTCTCTTAGTAAAAGTAAGAGGG - Intronic
1133719805 16:8484256-8484278 TTGTCTTAGTGGAAGGAACAAGG + Intergenic
1135844197 16:25903574-25903596 CTTACTTATTAGAAGCAAAAGGG + Intronic
1140053088 16:71500337-71500359 CTTCCATAGTAGGAAGAAGATGG + Intronic
1140183283 16:72742108-72742130 CCTTCCTAGTAAAGGGAAGAGGG + Intergenic
1140960530 16:79907506-79907528 CTTTCTGGGTAGAAGGCAGCAGG + Intergenic
1142152003 16:88516789-88516811 CTCTCTTTGTAGAAGGAGAAGGG + Intronic
1142479271 17:208198-208220 CTTTCCTGGTAGAAGGTGGAAGG - Intergenic
1146975216 17:37105553-37105575 CTTTCTTAAGTAAAGGAAGAAGG - Intronic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1147710517 17:42460382-42460404 CATTGTCAGTAGAAGGGAGAAGG + Intronic
1150222325 17:63503188-63503210 TTTGCGTAGGAGAAGGAAGAGGG - Intronic
1150736824 17:67747795-67747817 CTTTCATAGCTGAAGGAAGGAGG + Intergenic
1150759131 17:67944568-67944590 CTTTTTTAATAGGAGGGAGAGGG - Intronic
1150849894 17:68694652-68694674 CTTTCCTAGTGGAAGGCAAATGG - Intergenic
1151049462 17:70960479-70960501 TTTTCTTATTAGAAGGATGGAGG + Intergenic
1151707620 17:75779171-75779193 CTTTCTTAGGTGAAAGAAAATGG - Exonic
1151752901 17:76051554-76051576 CTTTCTTAAGAGAAGAAAAAGGG - Intronic
1153388106 18:4522575-4522597 CTTTTTTAGTAGAGTGATGAGGG + Intergenic
1154191465 18:12234301-12234323 CTTCCTTAGTCGAGGGCAGATGG + Intergenic
1155737019 18:29236721-29236743 TTTTCCTAGCAGAAGCAAGAGGG + Intergenic
1155765733 18:29629943-29629965 CCTTCTTTGTAGAAGGGAGGAGG - Intergenic
1156544059 18:37946226-37946248 TTTTCTAAGTGGGAGGAAGAAGG - Intergenic
1157663278 18:49464377-49464399 CTTTCTTTGTAGAAGCTAAAGGG + Intergenic
1157924586 18:51749447-51749469 CTTTCTAAGTGGAAGCAACATGG + Intergenic
1159641680 18:70870569-70870591 CTTTTTTAGTATTAGGAAGTTGG - Intergenic
1159785049 18:72703952-72703974 CATGCTTAGCAGAAGGAAAACGG - Intergenic
1160182947 18:76651355-76651377 TTTACTTAGTAGAAGGAGCAGGG + Intergenic
1162204327 19:9044413-9044435 CTTCCGTAGAGGAAGGAAGAAGG - Intergenic
1162708698 19:12575317-12575339 CTTTCTATGTAGAATGAAGCTGG - Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1168508146 19:56953500-56953522 CTTTCTCTGTAAAAGGAAAATGG + Intergenic
925623547 2:5818790-5818812 ATTTCTTAGAAAAATGAAGAAGG - Intergenic
927121800 2:19971434-19971456 ATTTCATGGTGGAAGGAAGAAGG - Intronic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928271098 2:29855436-29855458 ATCTCTTGGTAGAAGGAAGAAGG - Intronic
929093461 2:38242301-38242323 TTTTCTCACTAAAAGGAAGAGGG - Intergenic
929338856 2:40787549-40787571 CTTTCTTAATAGAGGGCACATGG + Intergenic
929835732 2:45396499-45396521 CTTTCTTACTTTAAGTAAGATGG - Intronic
932641285 2:73449804-73449826 CTTTGTGAGTAGAAAGTAGACGG - Exonic
932644939 2:73490316-73490338 CTATTTTAGCAGAAGGTAGAAGG + Exonic
937648329 2:124291352-124291374 CTTTCATTATAGAATGAAGAAGG - Intronic
938283177 2:130082204-130082226 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938333810 2:130470770-130470792 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938356007 2:130649897-130649919 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938432433 2:131256696-131256718 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
939223706 2:139337932-139337954 CTATCTCAGGAGAAGGAAGGTGG + Intergenic
939354848 2:141088049-141088071 CTTTCCTGGTAGGGGGAAGAAGG + Intronic
940500729 2:154490192-154490214 CTTTCTTTGTAGCAGAAAGGAGG - Intergenic
942229357 2:173845397-173845419 CTTTTTTAGAAGAAGCAATAAGG + Intergenic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
943523720 2:188989935-188989957 CTTTCTTGGTAGAAGGCATGAGG - Intronic
945519370 2:210804556-210804578 CTTCCTTAGTAGAAAGACCATGG + Intergenic
1169635381 20:7685359-7685381 CTTTCTTAGTCTTAGGAATAAGG + Intergenic
1170096567 20:12651820-12651842 TTTTTATAGAAGAAGGAAGAAGG + Intergenic
1170664906 20:18378390-18378412 TTTTCTGAATGGAAGGAAGAGGG - Intergenic
1170822403 20:19765749-19765771 CTTACTTCATAAAAGGAAGAGGG - Intergenic
1174073682 20:47916788-47916810 CTTCCTTAGGAGTGGGAAGAAGG + Intergenic
1174895293 20:54442772-54442794 CAATCATAGTAGAAGAAAGACGG - Intergenic
1174966125 20:55217575-55217597 CTCTGTTAGTAGGATGAAGATGG + Intergenic
1176286874 21:5023053-5023075 ATTTCCTAGAAGAAGGGAGAAGG + Intronic
1176896615 21:14385912-14385934 CTTTCTTAATAAAAGAAAGCAGG - Intergenic
1177599642 21:23293951-23293973 TTTTCTTAGTAGGAAGAATATGG + Intergenic
1178262806 21:31115817-31115839 CATTGTTGGTAGAAGGAAAAAGG - Intergenic
1178531307 21:33378571-33378593 CTGTCCTAATAGAAGGAAGCTGG - Intergenic
1179103364 21:38376531-38376553 CTTTCCTAGTAGGAAGAACATGG - Intergenic
1179454523 21:41489582-41489604 CTTTCTTAGTCTCTGGAAGAAGG + Exonic
1179870307 21:44240422-44240444 ATTTCCTAGAAGAAGGGAGAAGG - Intronic
1180476527 22:15714638-15714660 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1182684212 22:32108711-32108733 CTTCATTAGTACAATGAAGAAGG + Intronic
1182952014 22:34385388-34385410 CTTTCCTAGAGGAAGGAAAAAGG - Intergenic
949323694 3:2840393-2840415 CTTTTCTAAAAGAAGGAAGAAGG - Intronic
949511611 3:4771486-4771508 CTTTCACAGTGGAAGGAAGTGGG - Intronic
949760681 3:7467057-7467079 CCTTCTCAGAAGGAGGAAGAGGG - Intronic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
950875336 3:16266157-16266179 CTTTCTTAGAAGAGGAAATAAGG - Intronic
950943157 3:16915103-16915125 CTGTCTTAGTAGACGGATGTTGG + Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952667785 3:35928086-35928108 GCTTATTAGTATAAGGAAGAGGG - Intergenic
952760460 3:36908997-36909019 CTCTCTTAGCAGATGGAACAGGG + Intronic
953622008 3:44541619-44541641 CCTTACTAGTAGAAGGAAAAAGG + Intergenic
953737325 3:45507292-45507314 CTTCCTTACTACATGGAAGATGG - Intronic
954079238 3:48203312-48203334 CTTTCTTAATAAAAGGCAGGAGG + Intergenic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
955868887 3:63416600-63416622 CTTTATTAGTAGCATGAAAACGG - Intronic
955929024 3:64037176-64037198 GTTTCTTAGAAGATGGGAGAAGG - Intergenic
958674316 3:97247579-97247601 CATTCTGAGTAGAAGGAACCAGG + Intronic
959950617 3:112175986-112176008 CTTTCTTAGGAGTAGGTATAGGG + Intronic
960738218 3:120803790-120803812 CTTTCCTAGTAGGATAAAGATGG - Intergenic
962488080 3:135864216-135864238 CCTTGGTAGCAGAAGGAAGAGGG - Intergenic
963713550 3:148776173-148776195 CTTACATGGTAGAAGGCAGAAGG - Intergenic
965211436 3:165794547-165794569 CTCACATAGTAGAAGGGAGAAGG + Intronic
965493513 3:169369162-169369184 CTTTCATAGAAGAAAGAATAAGG + Intronic
965768202 3:172153635-172153657 CTTTCTTATAGGAAGGAAGGAGG + Intronic
965858871 3:173123096-173123118 CGTTATTATTAGAAGGTAGAGGG + Intronic
966092642 3:176159027-176159049 CATTTGTAGCAGAAGGAAGATGG + Intergenic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
967143209 3:186581527-186581549 GTTTCTTGGTAGAACAAAGAAGG - Intronic
967679532 3:192344286-192344308 TTTTCATAGTAGGAGGAACATGG + Intronic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
971010567 4:22430188-22430210 CTTTATTAGTAGCATGAAAATGG + Intronic
971672088 4:29574721-29574743 CTTTCTTATTGGAGAGAAGAGGG + Intergenic
972020948 4:34313454-34313476 CTTTCATAGTAAATGGAAGATGG - Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
973601800 4:52549568-52549590 CTTCCTTACTGGAAGGAAGCGGG + Intergenic
974880533 4:67751893-67751915 GTTTGTTTGTAGAAGGGAGAGGG - Intronic
976291120 4:83418798-83418820 CTTTCTTAGTAGTCACAAGATGG - Intronic
978298691 4:107239747-107239769 CTGGCTTTGTAGAATGAAGAAGG - Intronic
979072737 4:116230398-116230420 CTTTCTTAAAACAAGAAAGAAGG + Intergenic
979673445 4:123385312-123385334 CTTTCTTAGTAGCATGAGAACGG - Intergenic
981756485 4:148145865-148145887 GTTTCTCAGTAGAAGGAAAAGGG + Intronic
982486211 4:155968661-155968683 CTTTCATAGTGGAAGGCAGAGGG - Intergenic
983378624 4:166962037-166962059 CCTTCTTTGAAGAAGGAAGGGGG - Intronic
983734599 4:171042594-171042616 CTTTCTTCATAGAAATAAGATGG + Intergenic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
983948178 4:173609384-173609406 CTTTCTTTGTAAAATGGAGATGG + Intergenic
984021584 4:174490086-174490108 TTTTCTTAGTAAAATGAAGTTGG - Intergenic
986253362 5:6081442-6081464 ATTTCTAAGTAGCAGGCAGATGG - Intergenic
986384536 5:7218649-7218671 TTTTCTTAGAAAAAGGACGAAGG + Intergenic
986626389 5:9726845-9726867 CTTTCTTATCAAAAGGAAAATGG - Intergenic
987736279 5:21847525-21847547 CTGCCTTAGAGGAAGGAAGAAGG - Intronic
990336358 5:54776568-54776590 CTTTCTTAGCAGAATGAGAATGG - Intergenic
990755597 5:59066061-59066083 TTCTTTTAGTAGAAGGAATAAGG - Intronic
992212865 5:74497477-74497499 CTTACATGGCAGAAGGAAGAGGG - Intergenic
992255450 5:74916444-74916466 GTTTTTTACTATAAGGAAGATGG + Intergenic
992681105 5:79153997-79154019 ATTTCTTAGGAGTGGGAAGATGG - Intronic
993065110 5:83088774-83088796 TTATCTTATTAGAAGGAAGTTGG - Intronic
993566245 5:89479193-89479215 ATTTCTTAGTAGAAGTTGGAAGG - Intergenic
994589496 5:101755690-101755712 TTTTCTCACTAAAAGGAAGAAGG + Intergenic
995073875 5:107958462-107958484 CTTTCTTTTCAGAAGGAAGTAGG - Intronic
995144320 5:108769320-108769342 CATTCTCATTAGAAGGAATATGG + Intronic
995926232 5:117378493-117378515 CTTTATTAGTAGCATGAGGATGG + Intergenic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
996518930 5:124404866-124404888 CTTTCTTAATTGAAGGACTATGG + Intergenic
998579282 5:143354217-143354239 CTTTCTTCGTATCAGCAAGAAGG + Intronic
998958816 5:147463850-147463872 CTTTCATACTAGAAGGCACAGGG + Intronic
1000537217 5:162493727-162493749 CTTTGCTGGTAGAAGGCAGAGGG - Intergenic
1000922670 5:167157165-167157187 CATTCTTTGTACAAGGTAGAAGG - Intergenic
1001010363 5:168092245-168092267 TTTGCTTAGCAGAAGGAATAAGG - Intronic
1001215630 5:169853265-169853287 GTTTCTTAGCAGCAGGAAAATGG + Intronic
1001694960 5:173663192-173663214 CTTTTTCAGGAGAAGGAAGGGGG + Intergenic
1004794404 6:19064969-19064991 CTTTTGTTGTAAAAGGAAGAAGG + Intergenic
1005410668 6:25542285-25542307 CTTTCTTAGGAAAGGGCAGAAGG + Intronic
1005680056 6:28197666-28197688 TGTACTTAGTAGAAGGAACAGGG + Intergenic
1005814497 6:29539765-29539787 CTTTCTTTGTAGAATCATGAGGG + Intergenic
1007138118 6:39542550-39542572 CTTTCTTTGTAGAACCCAGAAGG - Intronic
1007771259 6:44194301-44194323 CTCTCTTATTAAGAGGAAGATGG + Intergenic
1007954350 6:45902650-45902672 CTTTCTAAGAAGGATGAAGATGG + Exonic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1010307908 6:74346271-74346293 CTTTCTAAGAAAGAGGAAGAAGG + Intergenic
1011474614 6:87739097-87739119 CTATCTCAGCAGAAGAAAGAGGG - Intergenic
1011475599 6:87748116-87748138 CTCTCTTCCTAGAAGGAAGGTGG - Intergenic
1013744098 6:113323998-113324020 ATTTGTTAGTAGAATCAAGAAGG + Intergenic
1014548184 6:122756379-122756401 CTTCATTAATAGAATGAAGAGGG - Intergenic
1014788223 6:125642018-125642040 GATTCTTAGGAGAAGGCAGAAGG + Intergenic
1015073843 6:129130992-129131014 CTTTCTTAGCAAAAAGAAAAGGG - Intronic
1015717491 6:136207356-136207378 CTGTCATTGTAGGAGGAAGAAGG - Intergenic
1015726553 6:136305497-136305519 CTCTCCTGGAAGAAGGAAGAAGG - Intergenic
1015753231 6:136582100-136582122 CATTCTTATTAGGTGGAAGAGGG + Intronic
1015868086 6:137747970-137747992 TTTTCTTAGAAGAGGGAAGCAGG + Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016164698 6:140926169-140926191 TTTTCTTAGTTGAAAGAAGAAGG + Intergenic
1016417273 6:143845926-143845948 CTTTCCAAGTAGGAGGCAGATGG - Intronic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1017634189 6:156427418-156427440 CTTTCTTACAAGAAGGAAGGAGG - Intergenic
1018394158 6:163364512-163364534 CTTTTTTAGCAAAAGGAAAATGG + Intergenic
1018660794 6:166085708-166085730 CTTTTTTTGTGGAAGAAAGAAGG + Intergenic
1018923640 6:168192392-168192414 CATTCTTAGTGGAAGGGAGTTGG - Intergenic
1019398945 7:840090-840112 CTTTCTCTCGAGAAGGAAGACGG + Intronic
1021043143 7:15888594-15888616 CTTCCTCAATAGTAGGAAGAGGG - Intergenic
1022891278 7:34702395-34702417 CTTCCTTAGGAAAAGGAAGCTGG - Intronic
1023650636 7:42365258-42365280 CTTTATTAGCAGAATGAAAAGGG - Intergenic
1024544899 7:50508924-50508946 CTTTCTTGTTGGAGGGAAGAGGG - Intronic
1027369770 7:77495665-77495687 CTTTCTTAATAAATAGAAGAGGG + Intergenic
1028435944 7:90803783-90803805 CTTGATTAGTAAAATGAAGATGG - Intronic
1028435949 7:90803837-90803859 CTTGATTAGTAAAATGAAGATGG - Intronic
1028471583 7:91212200-91212222 AGCTCTTAGTAGAAGAAAGAAGG + Intergenic
1028809062 7:95062841-95062863 CTTTCATAATAGAAGAAACATGG - Intronic
1028839873 7:95417339-95417361 CTTTCTGAGGAGCAGGCAGATGG - Intronic
1030606734 7:111645669-111645691 TTTTCTTAGGGGAAGGGAGATGG + Intergenic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1033668810 7:143469782-143469804 CTTACATTGTAGAAGGCAGAAGG - Intergenic
1033990800 7:147283939-147283961 GTATCTTAGTAAAGGGAAGATGG - Intronic
1034954255 7:155324452-155324474 CATTCTTAGTTGAAGGTAAATGG + Intergenic
1037184615 8:16047700-16047722 CTTTATTAGTAGCAAGAAAATGG - Intergenic
1039373572 8:37011301-37011323 CTTTCTTAGAGAAAGGAAAATGG - Intergenic
1039698639 8:39940113-39940135 CTTTCTTACTAAGAGGAAGTTGG - Intronic
1042225907 8:66514146-66514168 CTGTCTTGGTACAAGGCAGAAGG - Intronic
1043238574 8:77901012-77901034 ATTTCTTATTAGATAGAAGATGG + Intergenic
1044920305 8:97162999-97163021 CTTTCTAGCAAGAAGGAAGATGG - Intergenic
1045680674 8:104656497-104656519 TTTTCCTAGGAGATGGAAGAGGG + Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1045825224 8:106389035-106389057 TCTTCTTATTAGAAGGATGAGGG - Intronic
1046353951 8:113054199-113054221 TTTTCTGAATAGAAGGAAAATGG - Intronic
1046598933 8:116295452-116295474 CTTATTTAGTAGCAGGAAGCTGG + Intergenic
1047025682 8:120821344-120821366 CTTTCTTACTAAAAGGAATCAGG - Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1049252356 8:141596150-141596172 CTCTCTAAGTAGAAGGAAGCAGG + Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1050254057 9:3775698-3775720 TTTTCTTAGTTGAATGAAGTTGG - Intergenic
1050801013 9:9614969-9614991 CTTTCTCAGTAGAAGGCACTGGG + Intronic
1051762865 9:20487560-20487582 CTTTCTTACAACAAGAAAGATGG + Intronic
1051877252 9:21805688-21805710 CTCACTTAGTAGAGGGAATAAGG - Intronic
1052151383 9:25120956-25120978 ATCTCTTAGTAGATGAAAGAAGG - Intergenic
1052155256 9:25179500-25179522 CTTTCACAGCAGAAGGGAGAGGG + Intergenic
1052602604 9:30655110-30655132 ATATCTCAGTAGAAGAAAGAAGG - Intergenic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1056667343 9:88591113-88591135 CTCTCTTGGGAGCAGGAAGAGGG + Intergenic
1058111981 9:101040782-101040804 CTTACATAGTAGAAGGAGGCCGG - Intronic
1060690090 9:125650132-125650154 CTTGCTTGTTAGAATGAAGATGG - Intronic
1061732554 9:132627381-132627403 GTTTCTTAGGAAGAGGAAGAAGG - Intronic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188985271 X:36763363-36763385 ATGTCTTAGTAGAAGAAAAATGG - Intergenic
1189192829 X:39125594-39125616 TTTTCATTGTAGAAGAAAGAAGG + Intergenic
1189883949 X:45520565-45520587 CTTTTTTAATAGAAAGTAGATGG - Intergenic
1190389107 X:49914088-49914110 TTTTCTTAGCAGGAGGAATAGGG - Intergenic
1191688480 X:63916328-63916350 ATTTCTAATTAGAAGGAAGCTGG + Intergenic
1194685716 X:96911568-96911590 CTTTCCAAGTAGAAGGATTAAGG - Intronic
1195076825 X:101335271-101335293 CTTTCATAGAAGAAGGTAAATGG + Intergenic
1197019756 X:121672585-121672607 CTTTCTTATTATATGGAACATGG + Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1201928511 Y:19316031-19316053 CAATCTTGGTAGAAGGAAAAAGG + Intergenic