ID: 927729860

View in Genome Browser
Species Human (GRCh38)
Location 2:25461661-25461683
Sequence CAATGTACGGAGCACCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927729856_927729860 22 Left 927729856 2:25461616-25461638 CCAATAGTTCTAACAGCATTACT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG 0: 1
1: 0
2: 0
3: 21
4: 133
927729855_927729860 23 Left 927729855 2:25461615-25461637 CCCAATAGTTCTAACAGCATTAC 0: 1
1: 0
2: 0
3: 7
4: 131
Right 927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG 0: 1
1: 0
2: 0
3: 21
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927729860 Original CRISPR CAATGTACGGAGCACCTACT AGG Intronic