ID: 927729860

View in Genome Browser
Species Human (GRCh38)
Location 2:25461661-25461683
Sequence CAATGTACGGAGCACCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927729856_927729860 22 Left 927729856 2:25461616-25461638 CCAATAGTTCTAACAGCATTACT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG 0: 1
1: 0
2: 0
3: 21
4: 133
927729855_927729860 23 Left 927729855 2:25461615-25461637 CCCAATAGTTCTAACAGCATTAC 0: 1
1: 0
2: 0
3: 7
4: 131
Right 927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG 0: 1
1: 0
2: 0
3: 21
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927729860 Original CRISPR CAATGTACGGAGCACCTACT AGG Intronic
901804479 1:11729511-11729533 AAGTTTACTGAGCACCTACTAGG + Intergenic
902770880 1:18644905-18644927 AAATTTTTGGAGCACCTACTAGG + Intronic
902774900 1:18668376-18668398 GCATTTACTGAGCACCTACTAGG - Intronic
903032367 1:20472994-20473016 CTATTTATTGAGCACCTACTAGG + Intergenic
903392384 1:22973459-22973481 AAATTTATGGAGCACTTACTAGG - Intergenic
904211408 1:28888505-28888527 AAGTCTAAGGAGCACCTACTGGG + Intronic
904463199 1:30692619-30692641 CAGTGTAGGCAGCACCTCCTTGG - Intergenic
904839199 1:33360617-33360639 CCATTTACTGAGCATCTACTAGG - Intronic
906082648 1:43103513-43103535 CCATTTACTGAGCACTTACTTGG + Intergenic
908420427 1:63953633-63953655 CCATTTATTGAGCACCTACTAGG - Intronic
912422181 1:109550421-109550443 ATATTTAAGGAGCACCTACTAGG - Intronic
912516411 1:110219289-110219311 CATTTTATGGAGCACCTATTGGG + Intronic
916330309 1:163608726-163608748 CTATGTATTGAGCACCTGCTAGG + Intergenic
916527201 1:165621794-165621816 TAATTTATTGAGCACCTACTAGG - Intergenic
918629931 1:186704692-186704714 AAATTTGCTGAGCACCTACTTGG - Intergenic
920797336 1:209152529-209152551 ACATTTACTGAGCACCTACTAGG - Intergenic
1064037339 10:11925482-11925504 ATATTTACTGAGCACCTACTAGG + Intronic
1067553121 10:47248886-47248908 AAATGTAGGGAGCACCTGCAAGG + Intergenic
1070736440 10:78866678-78866700 ATATTTACTGAGCACCTACTGGG - Intergenic
1072072057 10:91927599-91927621 AAATGTACTGAACACCCACTAGG - Intronic
1075728036 10:124620585-124620607 CAATGTGGGGGGCACCTCCTAGG + Exonic
1075743568 10:124710727-124710749 CTATCTACTGAGCACCTACTAGG + Intronic
1078358790 11:10652513-10652535 CCACTTACTGAGCACCTACTGGG + Intronic
1078469186 11:11573422-11573444 CAATTAACTGAGCACTTACTTGG + Intronic
1079372543 11:19863872-19863894 CTATTTACTCAGCACCTACTGGG - Intronic
1079927740 11:26516388-26516410 CATTTTACTGAGTACCTACTAGG - Intronic
1080127390 11:28752925-28752947 CCATTTACAGAGCACCTACTGGG - Intergenic
1081174864 11:39914787-39914809 GAAAATACTGAGCACCTACTGGG + Intergenic
1082080659 11:48010153-48010175 TAAATTACTGAGCACCTACTGGG - Intronic
1082080709 11:48010474-48010496 CAAATTACTGAGCACCTAATGGG - Intronic
1084270618 11:68027336-68027358 CACTGCACATAGCACCTACTGGG + Intronic
1086226944 11:84523210-84523232 CCATTTACTGAGCAACTACTAGG + Intronic
1086295064 11:85357065-85357087 CAATTTATTGAGCACCTACTTGG - Intronic
1087976956 11:104562374-104562396 AAATTTACTGAGCACCTATTGGG - Intergenic
1088040904 11:105380556-105380578 ATATGTATTGAGCACCTACTTGG + Intergenic
1089312707 11:117570562-117570584 AAATGTATTCAGCACCTACTAGG - Intronic
1090439831 11:126716283-126716305 ATATGTATGGAGCACCTGCTAGG + Intronic
1092104416 12:5911242-5911264 ACATTTACTGAGCACCTACTAGG - Intronic
1092551381 12:9505111-9505133 CAATTTATTGAGCACTTACTAGG + Intergenic
1093960868 12:25271461-25271483 ATATTTACTGAGCACCTACTTGG + Intergenic
1094520427 12:31181223-31181245 CAATTTATTGAGCACTTACTAGG - Intergenic
1095962745 12:47845636-47845658 CAATTTATTGAGCACCTATTAGG - Intronic
1096105281 12:48994073-48994095 GCATGTACTGAGCACCTACTGGG - Intergenic
1098938445 12:76507296-76507318 AAAAGGAAGGAGCACCTACTAGG + Intronic
1099951749 12:89311548-89311570 ATATGTATGGAGCACCTATTGGG - Intergenic
1100812976 12:98358228-98358250 CTATTTACTGAGCACCTACTAGG - Intergenic
1102644793 12:114396851-114396873 GAATTTACAGAGCACCTCCTGGG + Intronic
1103167974 12:118786872-118786894 CAATTTACAGAGCACTTACTAGG - Intergenic
1103178349 12:118884983-118885005 CCATTTACTGAGCACTTACTAGG + Intergenic
1103213045 12:119180399-119180421 TGATTTACTGAGCACCTACTAGG + Intronic
1105486013 13:20833498-20833520 CAATGTACATAGCACTTACATGG - Intronic
1105551717 13:21403437-21403459 AAATGTATGGAACACCTGCTAGG + Intronic
1108068118 13:46599783-46599805 AAATGAACTGAGCACCTACTAGG - Intronic
1113037358 13:106065200-106065222 CTATGTAAAGAGCAGCTACTTGG + Intergenic
1115727015 14:36228161-36228183 CAGTGTATGGAGCACATAGTAGG - Intergenic
1117658855 14:57983929-57983951 TGATGTACGGGGCACCTACTTGG + Intergenic
1120292243 14:82590205-82590227 CACTGTAGTGAGCCCCTACTAGG + Intergenic
1121241022 14:92430268-92430290 GCATGTACAGAGCACCCACTTGG - Intronic
1121380903 14:93465146-93465168 CAATTTATTGAGTACCTACTAGG + Intronic
1121951776 14:98177299-98177321 CAATGTACTGTGTACCTACTGGG + Intergenic
1122289356 14:100671687-100671709 CATTTTATTGAGCACCTACTAGG + Intergenic
1128321401 15:66697220-66697242 CAAATTACGGAGCTCCTACTGGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128564781 15:68693695-68693717 TCATGGACTGAGCACCTACTGGG + Intronic
1129162879 15:73756804-73756826 CCATTTACAGAGCACCTACCAGG - Intergenic
1129329299 15:74818781-74818803 CAGAGCACGGATCACCTACTGGG + Exonic
1129688344 15:77698921-77698943 CACTGCACGGGGCACCCACTAGG - Intronic
1131473518 15:92716540-92716562 CTATATACTGAGCACCTGCTTGG - Intronic
1131643648 15:94318732-94318754 CAGTGTACTGACCATCTACTCGG - Intronic
1134386348 16:13776968-13776990 CCATTTACTGAGCATCTACTTGG + Intergenic
1136688152 16:32008191-32008213 ACATTTACTGAGCACCTACTAGG + Intergenic
1136788756 16:32951746-32951768 ACATTTACTGAGCACCTACTAGG + Intergenic
1136881057 16:33902188-33902210 ACATTTACTGAGCACCTACTAGG - Intergenic
1137593589 16:49708860-49708882 ATATTTACTGAGCACCTACTAGG - Intronic
1141510326 16:84507661-84507683 AAATGTACGGCTCACCCACTAGG + Intronic
1141871085 16:86786553-86786575 CACTGTGCTGAGCACCTCCTGGG + Intergenic
1142241220 16:88947158-88947180 CAATGTAGGGACCCCCCACTAGG + Intronic
1203090953 16_KI270728v1_random:1213235-1213257 ACATTTACTGAGCACCTACTAGG + Intergenic
1144083672 17:11787378-11787400 CAATGTACAGAGCAACTTTTAGG + Intronic
1145760507 17:27422808-27422830 CCATGGACGGAGCACCTCCCAGG + Intergenic
1147149143 17:38503894-38503916 ACATTTACTGAGCACCTACTAGG + Intronic
1148087730 17:45004602-45004624 CCAGGTACTGAGCACCTATTGGG - Intergenic
1150316057 17:64170278-64170300 ACATGTACTGAGCACCTACTAGG + Intronic
1153528430 18:6019562-6019584 CTATCTACTGAGCATCTACTAGG + Intronic
1154055568 18:11010164-11010186 CCATGTACCAAACACCTACTAGG + Intronic
1157743616 18:50115447-50115469 TTATGTACGGAGCACCTACCAGG + Intronic
1159107476 18:64019654-64019676 AAATGTACTGACCACTTACTGGG - Intergenic
1163378336 19:16948170-16948192 GCATATATGGAGCACCTACTGGG + Intronic
1167566234 19:50259032-50259054 TAATTTACTGAGCACCTACTAGG - Intronic
1168450489 19:56462700-56462722 GTATTTACTGAGCACCTACTGGG + Intronic
1168510726 19:56971554-56971576 CGATGTCCGGGGCACTTACTTGG + Intergenic
926043745 2:9694626-9694648 CAATGTTCAGAGCACCCAGTGGG + Intergenic
927286677 2:21363932-21363954 CAATGTAAATTGCACCTACTTGG + Intergenic
927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG + Intronic
928380428 2:30813146-30813168 AAATTTATTGAGCACCTACTAGG - Intronic
942783329 2:179671885-179671907 CACTGCACAGAGCCCCTACTAGG + Intronic
948022866 2:234750928-234750950 TAATTTACTGAGCACTTACTAGG - Intergenic
948247917 2:236502004-236502026 CAATTTACTGAGCATCTTCTTGG - Intronic
1170344157 20:15364774-15364796 CAATGAAGGGAGCCCCTACTGGG + Intronic
1171010097 20:21504859-21504881 CCACGTACTGAGCACCTTCTAGG - Intergenic
1173926600 20:46785636-46785658 CTATTGACTGAGCACCTACTAGG - Intergenic
1174352196 20:49976435-49976457 CTATTTACTGAGCACCTGCTGGG - Intergenic
1174604636 20:51751930-51751952 GTATTTACTGAGCACCTACTAGG + Intronic
1175148443 20:56913870-56913892 CAATTTAGTGAGCACCTGCTGGG + Intergenic
1182046390 22:27277615-27277637 CCATTTATTGAGCACCTACTAGG + Intergenic
1182117440 22:27765229-27765251 GCATGGACTGAGCACCTACTGGG - Intronic
1183165248 22:36142729-36142751 CAATGTACAGAGCTCTTTCTGGG - Intronic
949687935 3:6599503-6599525 AAATTTACTAAGCACCTACTAGG + Intergenic
950171601 3:10842710-10842732 ACATTTACTGAGCACCTACTAGG - Intronic
950432712 3:12960166-12960188 CCATTTACTGAACACCTACTAGG + Intronic
954624789 3:52016538-52016560 CCACGTGCGGGGCACCTACTGGG - Intergenic
955318288 3:57956863-57956885 GAATGGATGGAGCACCTGCTGGG + Intergenic
956499089 3:69862336-69862358 CAATTTAAGAAGCATCTACTTGG - Intronic
956519083 3:70083897-70083919 TTATTTACGGAGCTCCTACTTGG - Intergenic
957577002 3:82021091-82021113 CAATGAAAGGAGAACCTAGTTGG - Intergenic
962987569 3:140549508-140549530 CAATTTATGGAGCACCCACTGGG + Intronic
962987730 3:140550963-140550985 CAATTTATGGAGCACCCACTGGG + Intronic
967299329 3:187997165-187997187 CCATTTATGGAGCACCCACTGGG - Intergenic
967923142 3:194627570-194627592 CTATGTATTGGGCACCTACTAGG + Intronic
968340193 3:197949354-197949376 GTATCTACGGAGGACCTACTAGG + Intronic
969359981 4:6657425-6657447 AAATGTACCGAGCCCCTGCTGGG + Intergenic
969711483 4:8846729-8846751 CCATACACGGAGCTCCTACTGGG + Intronic
970671874 4:18406012-18406034 CATTGTACGTAGCACATAGTGGG - Intergenic
971059144 4:22947565-22947587 ACATCTACCGAGCACCTACTAGG - Intergenic
971381416 4:26101889-26101911 CAATATACGAAGCACCTACAGGG + Intergenic
972319128 4:37956468-37956490 ATATGTATTGAGCACCTACTGGG - Intronic
972681279 4:41309230-41309252 GAAATTACTGAGCACCTACTGGG + Intergenic
981100816 4:140827321-140827343 CCATTTACTGAGCACCTACTAGG + Intergenic
996499970 5:124205662-124205684 CTATGTACCAAGCACTTACTAGG + Intergenic
997849093 5:137314818-137314840 TAATTTATGGAGCACCTGCTTGG - Intronic
1000826600 5:166052894-166052916 CAATTTTCTGAGCACCTATTAGG + Intergenic
1008868244 6:56241039-56241061 GAATGGACAGAGCTCCTACTTGG - Intronic
1010170787 6:72972729-72972751 CAATTTATTGAACACCTACTAGG - Intronic
1013371388 6:109473706-109473728 ACATGTACTGAGCACTTACTGGG - Intronic
1015710369 6:136132606-136132628 CAAAATATTGAGCACCTACTAGG - Intronic
1017801967 6:157904981-157905003 AAATGTACTGAGTACATACTAGG + Intronic
1018327634 6:162690202-162690224 AAATTTACTGAGCACTTACTAGG + Intronic
1024005599 7:45223213-45223235 CATTTTAATGAGCACCTACTAGG - Intergenic
1027934388 7:84584957-84584979 AAATGTATGGAGTACCTACTGGG - Intergenic
1029695258 7:102208773-102208795 CAATGGAGGGAGCATCTTCTGGG - Intronic
1032948215 7:136876093-136876115 GAATATACTGAGCACCTAGTGGG - Intronic
1036550692 8:9812898-9812920 CATTTTAGGAAGCACCTACTGGG - Intergenic
1038420822 8:27433155-27433177 CTATTTATTGAGCACCTACTAGG + Intronic
1047373074 8:124272138-124272160 CAATGTAAAGAGCACACACTAGG + Intergenic
1047509933 8:125508278-125508300 ACATTTACTGAGCACCTACTAGG + Intergenic
1050472941 9:6011052-6011074 CAATTTATTGAGCACTTACTAGG + Exonic
1056993228 9:91430298-91430320 CCATTTATGGAGCACCTGCTGGG + Intergenic
1058668777 9:107343174-107343196 AAATGTATTGAGCACCTACTAGG - Intergenic
1058800416 9:108540033-108540055 CCATGTACTGAGTTCCTACTGGG + Intergenic
1060175118 9:121492003-121492025 GAATTTACTGAGCACCTACTAGG - Intergenic
1061805605 9:133136082-133136104 GAATTTACTGAACACCTACTAGG + Intronic
1061976567 9:134070929-134070951 CTATGTATTGAGCACCCACTAGG - Intergenic
1189751355 X:44226062-44226084 CCATGTATTGAGCACTTACTGGG - Intronic
1192588285 X:72338250-72338272 ATAGGTACTGAGCACCTACTAGG - Intronic
1193512158 X:82416396-82416418 AAATGTATGGAACACTTACTAGG - Intergenic