ID: 927735176

View in Genome Browser
Species Human (GRCh38)
Location 2:25514281-25514303
Sequence CAGTAGTTGCAAAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2901
Summary {0: 2, 1: 15, 2: 139, 3: 868, 4: 1877}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927735169_927735176 19 Left 927735169 2:25514239-25514261 CCATGTGAGTATGAGGATGAGGG 0: 1
1: 0
2: 3
3: 29
4: 190
Right 927735176 2:25514281-25514303 CAGTAGTTGCAAAGGCCCTGAGG 0: 2
1: 15
2: 139
3: 868
4: 1877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927735176 Original CRISPR CAGTAGTTGCAAAGGCCCTG AGG Intronic
Too many off-targets to display for this crispr