ID: 927736654

View in Genome Browser
Species Human (GRCh38)
Location 2:25529541-25529563
Sequence TGTGCTATGGAACACTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927736654 Original CRISPR TGTGCTATGGAACACTGTGT AGG Intronic
901803613 1:11724058-11724080 TGTTCTATGGAACACACTTTGGG - Exonic
903891644 1:26573975-26573997 TGGGCTGTGGAACACTGAGAGGG + Intronic
904242948 1:29162015-29162037 TGTGCTAGGTTACAATGTGTAGG + Intronic
905367437 1:37461120-37461142 TGTGTGATGGCCCACTGTGTTGG + Intergenic
906898937 1:49811954-49811976 TGTGGCATGTAACACTGTGGAGG - Intronic
907298488 1:53470582-53470604 TGTGCTATGGAACACGAGGATGG - Intergenic
912196636 1:107404906-107404928 TGTGCTTAGGAAAACTGTCTAGG - Intronic
916313714 1:163424614-163424636 TGTGCTATGGAATAAAGTGATGG + Intergenic
917788140 1:178481565-178481587 TGTGCCATGGGAGACTGTGGAGG - Intergenic
924026698 1:239841039-239841061 GGTGCCATGGAACACAGTGTGGG - Intronic
1064361015 10:14664393-14664415 TGTGCCATGTAACAATGTTTTGG + Intronic
1070414512 10:76176992-76177014 TGTGCTCTGGAAGACTCTATTGG - Intronic
1074024031 10:109615307-109615329 TCTGCTATTGAGCACTGTGCTGG - Intergenic
1076620174 10:131782044-131782066 TGTGCTGTGGCACTCTGTCTTGG + Intergenic
1076656372 10:132026464-132026486 TGAGCTGTGGAAAACTGTGCAGG - Intergenic
1078054070 11:7992863-7992885 TGTGAAATGGAACACAGTGGTGG - Intronic
1079899672 11:26166763-26166785 TGTACTGTAGAGCACTGTGTGGG - Intergenic
1080257710 11:30310209-30310231 TGTGCCATGTAACAATGTTTTGG - Intergenic
1081819395 11:45977019-45977041 GGTGCTATACAACACTGTTTTGG + Intronic
1081823570 11:46024029-46024051 TGTTCTAAGGAACACAGTTTGGG + Intronic
1082031562 11:47608288-47608310 TGTGACATGGAACAAAGTGTAGG - Intergenic
1083031383 11:59596121-59596143 TGGGGTATGGCACACTGTTTTGG - Intronic
1086797113 11:91119834-91119856 TTTGCTAAGGGACTCTGTGTTGG + Intergenic
1086898992 11:92345074-92345096 TGTGTCATGGAACACAGTTTGGG + Intergenic
1087903950 11:103674106-103674128 TGTGCCATGGAACCCTGGGAAGG - Intergenic
1088744314 11:112792728-112792750 TGTGCTATGGAATCCCATGTGGG + Intergenic
1089540149 11:119185011-119185033 TATCCTCTGGAAAACTGTGTGGG - Intergenic
1090533149 11:127612156-127612178 TGTGCTAAAAAATACTGTGTAGG - Intergenic
1096543292 12:52320668-52320690 TGAGCAAAGGACCACTGTGTGGG - Intronic
1097163719 12:57069760-57069782 TTTGCTACAGAACACTGTGCTGG + Intronic
1097614655 12:61869626-61869648 TGTGCTCTGTTACACTGTGGAGG - Intronic
1101081235 12:101187034-101187056 TGTACTATAGAACATTTTGTGGG - Intronic
1107387332 13:39926195-39926217 TGAGGTATAGAGCACTGTGTGGG + Intergenic
1109832334 13:67807456-67807478 TAAGCTATGGAAAACTGTGTTGG - Intergenic
1110773481 13:79377976-79377998 TGTGCCATGGCACACTGGTTGGG - Intronic
1115949481 14:38703816-38703838 TGTGCTATGGTCAACTGTGGAGG - Intergenic
1117437410 14:55729883-55729905 TGTTCTATGGAACACACTTTGGG - Intergenic
1118322733 14:64762885-64762907 TTTGCTAGGGCTCACTGTGTGGG - Intronic
1121120204 14:91371722-91371744 TGGGACATGGGACACTGTGTGGG - Intronic
1121743835 14:96272453-96272475 TTTTCTAGGGAGCACTGTGTTGG - Intergenic
1122432705 14:101666058-101666080 TTTGCTATGGAACCCTGAGGTGG - Intergenic
1202886026 14_KI270722v1_random:108008-108030 AGTGTTCTGGAATACTGTGTGGG + Intergenic
1125371902 15:38986560-38986582 TGTTCCGTGGAACACTGTCTTGG + Intergenic
1129568869 15:76656633-76656655 TGTTTTATGGCTCACTGTGTGGG - Intronic
1132629357 16:909387-909409 TGTGCTTTGGTGCACTGTGAGGG - Intronic
1134108615 16:11500919-11500941 TGTGGGACGGAGCACTGTGTGGG - Exonic
1135174132 16:20213016-20213038 TGCGCCATGGCCCACTGTGTGGG - Intergenic
1137271664 16:46906402-46906424 AGTCCTATGGAACCATGTGTAGG + Intronic
1138053606 16:53809484-53809506 TTTGCTCTGGAAAACTGTGTTGG + Intronic
1139658620 16:68404827-68404849 AGTGACTTGGAACACTGTGTGGG + Intronic
1145414165 17:22700792-22700814 TATGCTATGGAAGAATGTGTGGG + Intergenic
1147661264 17:42118271-42118293 TGTGCCATGGTACGCTCTGTAGG - Intronic
1147850988 17:43442515-43442537 TGTGCAATGGAACACTATGCAGG + Intergenic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1151036548 17:70807031-70807053 TGTGATTTTAAACACTGTGTGGG - Intergenic
1152841319 17:82570553-82570575 TGTGCTATGGAAGCCCATGTGGG + Intronic
1153640447 18:7152532-7152554 TGTGCCTTGGAACAGTCTGTTGG + Intergenic
1154491714 18:14927303-14927325 TGGGGTATGGAAAATTGTGTAGG - Intergenic
1155351840 18:24914717-24914739 TGTCCTATGGCACACTGTTTTGG + Intergenic
1155367980 18:25067827-25067849 TGTGCTTTGTAACACTCTGTTGG + Intronic
1155667545 18:28329276-28329298 TGTGTTATGAAACAGTATGTAGG + Intergenic
1162056807 19:8069389-8069411 TGTTTTAGGGAGCACTGTGTTGG + Intronic
1162617302 19:11812636-11812658 GGTGCTATGAAAAACTATGTTGG - Intergenic
1163930562 19:20386801-20386823 TATGATATGGAGCACTGTGCTGG - Intergenic
1164605552 19:29595450-29595472 TGTGTGATGTATCACTGTGTAGG - Intergenic
1164667249 19:30049402-30049424 TGTGCTCTGAAAGGCTGTGTGGG - Intergenic
1202661410 1_KI270708v1_random:74840-74862 AGTGTTCTGGAATACTGTGTGGG + Intergenic
925831756 2:7903213-7903235 TGTGAGATGGAAGACTCTGTGGG - Intergenic
927736654 2:25529541-25529563 TGTGCTATGGAACACTGTGTAGG + Intronic
937951659 2:127392699-127392721 TGTGCTAAGGAATACTGGTTAGG + Intergenic
941674467 2:168328929-168328951 TGTGCTCTGGCACAGTGTGTTGG - Intergenic
942500004 2:176579383-176579405 TGTCCTGTGGAAAACTCTGTTGG - Intergenic
943679711 2:190755429-190755451 TTTGGTCTGGAACACTGTTTTGG - Intergenic
944557349 2:200900511-200900533 TGTGCTATATAACAAAGTGTGGG - Intronic
945172148 2:207007978-207008000 AGTGTTATGAAATACTGTGTGGG + Intergenic
945328123 2:208506801-208506823 TGTGCCATGGAATACTATGTAGG - Intronic
948317946 2:237044064-237044086 TGCCCCATGGAACACTGTGGAGG + Intergenic
1173544721 20:43886523-43886545 TGTACTGTGGAAAACTGTGCTGG - Intergenic
1173695999 20:45013123-45013145 TCTACTATGCAACACTGTATTGG - Intronic
1174539309 20:51276465-51276487 TCTGCTATTAAACCCTGTGTCGG - Intergenic
1178070878 21:28965444-28965466 TCTACTCTGGAACACTATGTAGG - Intronic
1178249938 21:30993373-30993395 TGTTCTGGGGAACACTGTCTAGG + Intergenic
1180920462 22:19519043-19519065 TGTGCTTGGGAAAAATGTGTTGG - Intronic
1182792589 22:32965472-32965494 AGTGCTATGGTAGACTGTGGTGG - Intronic
949621071 3:5812083-5812105 TGTGCTGTGGAACACGGAGGAGG + Intergenic
950715131 3:14842434-14842456 TGGGCTCTGGAACCCTGTCTAGG - Intronic
955439216 3:58937423-58937445 TGTGCTTTGTAACACAGTTTTGG + Intronic
955796427 3:62642150-62642172 TGTGCTATGGCACAATGTTAGGG + Intronic
956346951 3:68290280-68290302 TGTTCTATGGAACAATCTTTGGG + Intronic
959657748 3:108829276-108829298 TGTGCTATGTAACAATGTTTTGG + Intronic
962833549 3:139165707-139165729 TGTTCTGTGGAATACTGTGTTGG + Intronic
963331641 3:143922215-143922237 TGTTATATGGAATACTGTGACGG + Intergenic
964546944 3:157844859-157844881 TATGCTATGGAGTACTGAGTTGG - Intergenic
967669217 3:192212418-192212440 TGTGTTATGTAAAACGGTGTGGG + Intronic
968431849 4:563689-563711 TTTGGTATGGAGCCCTGTGTTGG + Intergenic
968431887 4:563911-563933 GTTGCTATGGAACCCTGAGTTGG + Intergenic
968431916 4:564058-564080 GTTGCTATGGAACCCTGAGTTGG + Intergenic
968432097 4:565060-565082 GTTGCTATGGAACCCTGAGTTGG + Intergenic
971525669 4:27614482-27614504 TGTGCTTTGGAAGACTGAGGTGG + Intergenic
971803462 4:31322868-31322890 TCTTCTATTCAACACTGTGTTGG + Intergenic
974603883 4:64123245-64123267 GGTGCTCAGTAACACTGTGTAGG + Intergenic
975813183 4:78190650-78190672 TGTGCTATGGGAAACTGGGAAGG - Intronic
976533199 4:86179904-86179926 TATGCTTTGGAACACTGTTCTGG + Intronic
976601224 4:86939316-86939338 TCTACTATGGTACACTGTGTTGG + Intronic
982435741 4:155382471-155382493 TGTGCTATGGGACCCTTTGGTGG + Intergenic
983869645 4:172810530-172810552 TTTGCTATTGACTACTGTGTAGG + Intronic
985310501 4:188592669-188592691 TGTGTTCTGGAAGAATGTGTAGG + Intergenic
987656237 5:20810382-20810404 TCTGCCATGGAAAGCTGTGTTGG + Intergenic
988410833 5:30883901-30883923 AATGTTATGGAGCACTGTGTTGG - Intergenic
988767316 5:34393558-34393580 TCTGCCATGGAAAGCTGTGTTGG - Intergenic
989121642 5:38010217-38010239 TTTACTATTGAACACTCTGTTGG + Intergenic
989832431 5:45937364-45937386 AGTAGTTTGGAACACTGTGTTGG + Intergenic
990855740 5:60264924-60264946 AGTGCCAGGGAACACTGTGCTGG + Intronic
993650847 5:90520448-90520470 TGAGAAATGGAACACTGTGGAGG + Intronic
996659299 5:125981246-125981268 TGTGTTTTGGCACACTGTGTTGG - Intergenic
999621924 5:153482506-153482528 TGTAGAATGGAACAGTGTGTAGG - Intergenic
999628665 5:153546726-153546748 TGTGCAATAGGACAATGTGTTGG - Intronic
1003659495 6:8046665-8046687 TGAGGTATGGAACATTGTGGAGG - Intronic
1006875051 6:37288294-37288316 TGAGCCATGGAAAACTGTATGGG - Intronic
1010170390 6:72968280-72968302 TGTTCTATGGAAAACAGTCTGGG + Intronic
1015696143 6:135982067-135982089 TGTGCTGTGTAAGACCGTGTGGG - Intronic
1018000258 6:159572556-159572578 TGAGCTATGGAATATTGTTTTGG + Intergenic
1024528796 7:50373281-50373303 TGTGCTGTTGATCAGTGTGTGGG - Intronic
1029974822 7:104823101-104823123 TATGCTATGGAACACAGGGAAGG + Intronic
1030383088 7:108835639-108835661 TGTGCTAAAGAAAATTGTGTAGG - Intergenic
1030861605 7:114638393-114638415 TGTTCCATAGAACACTGTTTTGG + Intronic
1031900965 7:127410164-127410186 AGTGCTTTGGAACTCTGTGGAGG + Intronic
1033146991 7:138879772-138879794 TGTGCTATGGAATAATTTTTTGG - Intronic
1033296364 7:140140800-140140822 TGTTCTAGTGAACACTGTGCTGG + Intronic
1033718408 7:144028146-144028168 TGTGCTTTGGAAAATTGTGTTGG + Intergenic
1041131020 8:54700517-54700539 TGTGCTATGAACTACAGTGTAGG - Intergenic
1041570799 8:59335057-59335079 TGTGGTAATGAACACTGTGGGGG - Intergenic
1042312263 8:67390814-67390836 TGTGCTAAGGAATGTTGTGTTGG + Intergenic
1043109638 8:76164035-76164057 TGTTCTATGGTACACTATCTTGG - Intergenic
1044011390 8:86998338-86998360 TGTGCTGAGGAACACTAGGTAGG + Intronic
1048266573 8:132992536-132992558 AGTGCTATGAAACACTGTGCAGG - Intronic
1048982981 8:139713110-139713132 TGAGGTATGGAACACCTTGTTGG + Intergenic
1054702212 9:68424199-68424221 TGTTCCATGAAACACTTTGTGGG - Intronic
1055720740 9:79171299-79171321 TTTGCGATGTAACACTGTGAAGG + Intergenic
1055781385 9:79825016-79825038 TGTGTAATGGAAAACGGTGTTGG + Intergenic
1055865203 9:80804954-80804976 TGTTCTATATAATACTGTGTGGG + Intergenic
1056437784 9:86589909-86589931 AGTCCTATGGAACATTGTGAAGG + Intergenic
1056668987 9:88607334-88607356 TGTGCTTTGGACAACTGGGTTGG + Intergenic
1059588746 9:115634357-115634379 TGTAATATGGAACCCTGTATAGG - Intergenic
1062724115 9:138061646-138061668 TGTTATATGGAATCCTGTGTTGG + Intronic
1186831243 X:13392617-13392639 TGTACTATGGAACAATGTGATGG - Intergenic
1190482308 X:50889645-50889667 TGGGTTTTAGAACACTGTGTGGG - Intergenic
1193596629 X:83453715-83453737 TGTGCATTGGAACATTGAGTAGG + Intergenic
1197887961 X:131237944-131237966 AGAGCTATGGAGCACTTTGTAGG - Intergenic
1199417086 X:147597762-147597784 TGTGCTATAAAACAGTGTGACGG - Intergenic