ID: 927739129

View in Genome Browser
Species Human (GRCh38)
Location 2:25551467-25551489
Sequence TTCAGCCAAGGATCCCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927739129_927739133 11 Left 927739129 2:25551467-25551489 CCGGCTGGGGATCCTTGGCTGAA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 927739133 2:25551501-25551523 GGAGTTGGCTGAGCAGCTTCAGG 0: 1
1: 0
2: 3
3: 19
4: 200
927739129_927739132 -4 Left 927739129 2:25551467-25551489 CCGGCTGGGGATCCTTGGCTGAA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 927739132 2:25551486-25551508 TGAATCTGTTCTGAAGGAGTTGG 0: 1
1: 0
2: 0
3: 22
4: 213
927739129_927739131 -10 Left 927739129 2:25551467-25551489 CCGGCTGGGGATCCTTGGCTGAA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 927739131 2:25551480-25551502 CTTGGCTGAATCTGTTCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 171
927739129_927739134 12 Left 927739129 2:25551467-25551489 CCGGCTGGGGATCCTTGGCTGAA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 927739134 2:25551502-25551524 GAGTTGGCTGAGCAGCTTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927739129 Original CRISPR TTCAGCCAAGGATCCCCAGC CGG (reversed) Intronic
900378814 1:2373639-2373661 TCCATCCCAGGATCCCCTGCAGG + Intronic
901210290 1:7520645-7520667 TGCAGCCAGTGCTCCCCAGCTGG - Intronic
901786078 1:11625905-11625927 TTGAGCCACGAAGCCCCAGCTGG - Intergenic
904534233 1:31188549-31188571 CTCTTCCAAGGATCCCCATCTGG + Intronic
905485059 1:38290006-38290028 TTAATCCAGGCATCCCCAGCTGG + Intergenic
905920362 1:41715120-41715142 TTCAGCTGCGGAACCCCAGCCGG + Intronic
912712237 1:111958272-111958294 ATTAGCCATGGAACCCCAGCGGG - Intronic
915142737 1:153777189-153777211 TGCAGCCCACGATGCCCAGCAGG - Exonic
919653119 1:200169972-200169994 TTTAGCAAAAGACCCCCAGCTGG - Intronic
920346675 1:205310231-205310253 CTCAGCCAGGCATCCCCAGGAGG - Intronic
920730697 1:208481256-208481278 ATCACCCAAGGTTACCCAGCTGG + Intergenic
920836649 1:209517273-209517295 TGCTCCCAAGGATGCCCAGCGGG + Intergenic
921076139 1:211701555-211701577 ATCAGGGAAGGATCCCCAGGAGG - Intergenic
923402547 1:233629147-233629169 TTCAGTCGAGTCTCCCCAGCTGG - Intronic
1065957507 10:30706242-30706264 GTCAGACAAGGACCCCCAGTGGG + Intergenic
1067016033 10:42756772-42756794 TCCAGGCCAGGACCCCCAGCTGG - Intergenic
1069043854 10:63722383-63722405 TGAAGCCAGGGGTCCCCAGCAGG - Intergenic
1069601432 10:69710704-69710726 TTCAGCCCAGAATTCCCAGAGGG + Intergenic
1069909247 10:71749729-71749751 TACAGCCAGGGAACCCCACCTGG - Exonic
1070346576 10:75548557-75548579 TTCAGCACAGGAGCCCCAGATGG + Intronic
1078170309 11:8924618-8924640 TTCAACCAGGGACCCCCAGTGGG + Intronic
1080311885 11:30904172-30904194 TTCACCCAGGGATCCACAGCTGG - Intronic
1080987515 11:37486995-37487017 TTCAGCCAAGTATGGCCAGTGGG - Intergenic
1085455434 11:76662812-76662834 TGAAGTCCAGGATCCCCAGCAGG + Intronic
1086402630 11:86473165-86473187 TCCAGCCAAGGATAGCGAGCAGG + Intronic
1089730190 11:120514407-120514429 CTCATCCAAGGCTCCACAGCTGG + Intronic
1089846276 11:121460984-121461006 CTCAGCCAAGGAGCCCGAGATGG + Intronic
1102045689 12:109828781-109828803 TTTACCCAGGGATGCCCAGCTGG - Intronic
1103895296 12:124269203-124269225 GTAAGCCAAGGATCCTCAGATGG + Intronic
1111661460 13:91217541-91217563 ATCTGCCAAAGATCCCCTGCAGG + Intergenic
1115279706 14:31647760-31647782 TTCTGCCAAGGAACCCAAGATGG + Intronic
1119715747 14:76857977-76857999 TTCAGGCAAGAGTTCCCAGCAGG - Intronic
1120841295 14:89087377-89087399 TTCAGCCCATGACACCCAGCTGG + Intergenic
1121594158 14:95146768-95146790 ACCAGCCAAAGGTCCCCAGCTGG + Intronic
1123476472 15:20595118-20595140 TTCAGCCAGAGATTCCCAGGAGG + Intergenic
1123641539 15:22405246-22405268 TTCAGCCAGAGATTCCCAGGAGG - Intergenic
1124098178 15:26668909-26668931 TTCACCCAAGGGTACCCTGCAGG - Intronic
1126105511 15:45144510-45144532 TTCTTCCAAGGACACCCAGCTGG - Intronic
1128672839 15:69587138-69587160 TTCAGCCAAGGGTCCCCTTGGGG - Intergenic
1129655989 15:77526137-77526159 CTCACCCCAGGCTCCCCAGCAGG - Intergenic
1133246787 16:4454560-4454582 TTCAATCAAGGACCCACAGCAGG - Intronic
1133475985 16:6122416-6122438 TTCATTCAAGAATTCCCAGCAGG - Intronic
1133866419 16:9648036-9648058 CCCAGCCAGGGATCCCCACCTGG - Intergenic
1136102125 16:28004038-28004060 GTCAGCCCAGCAGCCCCAGCAGG - Intronic
1137772128 16:51024884-51024906 TTGAGCCACGGGTCCCCAGCAGG - Intergenic
1138322884 16:56132914-56132936 TTAAGCCAATGAAACCCAGCAGG + Intergenic
1139644657 16:68319539-68319561 TTCAGCTAAGCATCCATAGCTGG + Intronic
1141329503 16:83096347-83096369 CTCAGTCAAGGATCTGCAGCTGG + Intronic
1142131062 16:88431676-88431698 CTCAGCCAGGGATGCCCCGCCGG + Exonic
1144720018 17:17462646-17462668 GGCTGCCAAGGCTCCCCAGCTGG - Intergenic
1145296024 17:21593223-21593245 TCCAGCCGAGTATCCACAGCTGG - Intergenic
1146275233 17:31512145-31512167 TACAGCCATGGGTCCCCGGCTGG - Intronic
1146891668 17:36510371-36510393 TTCAGCCAAGGATCTGAAGCAGG + Intronic
1148628379 17:49087901-49087923 TTCCTCAAAGGATCCCCAGTGGG + Intergenic
1149481300 17:57005480-57005502 TTCTGCCAAGAGTCCCCAGGAGG - Intronic
1151804419 17:76396738-76396760 TTCATCCGAGGATGCCCCGCTGG + Exonic
1152735934 17:81996771-81996793 GTCGGGCCAGGATCCCCAGCAGG + Exonic
1152785541 17:82246111-82246133 TTGAGGCAAGGATGCCCATCTGG - Intronic
1203171253 17_GL000205v2_random:149325-149347 TACAGCCAAGGACCAGCAGCAGG - Intergenic
1157428922 18:47607278-47607300 CTCACCCAAGGATCCACAGCTGG - Intergenic
1157605462 18:48923330-48923352 TTCCGCCATGGACCCCCTGCAGG - Intronic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1158158737 18:54455604-54455626 TTCATCCAAGCATCACCAGCTGG - Intergenic
1158665604 18:59429953-59429975 TTTTGCCAAAAATCCCCAGCAGG + Intergenic
1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG + Exonic
1163617718 19:18339843-18339865 TTCAGCCAAGGAGGGCCAGAAGG + Intergenic
1165334668 19:35161025-35161047 TTCAGCAAAGGATCCCCAAGGGG + Intronic
1165423739 19:35734448-35734470 TTCAGCTAAGGATCGGGAGCGGG + Intronic
925038950 2:715288-715310 CTCAGCCAAGGATGCACTGCAGG - Intergenic
927739129 2:25551467-25551489 TTCAGCCAAGGATCCCCAGCCGG - Intronic
929874587 2:45786111-45786133 TTCAAATAAAGATCCCCAGCAGG - Intronic
929932518 2:46269827-46269849 TTCAGCTACGGATTCCCAGTAGG - Intergenic
932882639 2:75518158-75518180 TTCAGCCAAGCACCTCCAGGAGG - Exonic
935090043 2:99886311-99886333 TAAAGACAAGGTTCCCCAGCAGG - Intronic
939089005 2:137757315-137757337 TTCAGCCTTGGATGCCCAACTGG + Intergenic
939323461 2:140654959-140654981 TTCACCCAAGGTTTCCTAGCTGG + Intronic
939836484 2:147135620-147135642 GTCAGCCAACGAATCCCAGCTGG + Intergenic
941046367 2:160680176-160680198 TTCATCCATGCATCCCCAGATGG - Intergenic
942413956 2:175738939-175738961 TTTAACCAAAGAACCCCAGCGGG + Intergenic
946408368 2:219504659-219504681 TTAAGGCAAGGATCCCTAGAAGG - Intronic
946767090 2:223050825-223050847 TTCATCCATAAATCCCCAGCTGG - Intergenic
948149309 2:235732623-235732645 TTATGCAAAGGCTCCCCAGCAGG - Intronic
1170159269 20:13295883-13295905 GTCAGCAAAGCATCCACAGCAGG + Intronic
1170829862 20:19830779-19830801 TTCAGCCAAGGTACCCCTGCAGG - Intergenic
1172645773 20:36468391-36468413 TGCAGCCAGGAATCCCCAGTGGG + Intronic
1173190057 20:40869357-40869379 TTCAGCCAATGTATCCCAGCTGG - Intergenic
1174342207 20:49905080-49905102 TAAACACAAGGATCCCCAGCTGG - Exonic
1174858573 20:54069195-54069217 ATCAGCTCAGGATCCCCAGGAGG + Intronic
1181040965 22:20192465-20192487 TCCAACCAAGGCTCCCCATCTGG - Intergenic
1182964495 22:34508569-34508591 TTCAGCTAAGGTGACCCAGCAGG + Intergenic
949258776 3:2081783-2081805 GCAAGCCAAGAATCCCCAGCTGG - Intergenic
950109267 3:10408119-10408141 TTCGGTCAAAGATCCCCAACAGG - Intronic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
962497953 3:135961761-135961783 TCCTGCCAAGGATCCCAAGATGG + Intergenic
963010063 3:140760457-140760479 ATAAGCCAAGGAGCCCCAGCAGG + Intergenic
964069499 3:152614531-152614553 TTCAGCCATGCAGCCCCACCTGG - Intergenic
967153300 3:186669275-186669297 TTTACCCAAGGACCCACAGCTGG - Intronic
976822891 4:89226894-89226916 TTCAGCCCAGCTTCCCGAGCAGG - Intergenic
977427009 4:96879458-96879480 GTCAGTGAAGGATGCCCAGCAGG + Intergenic
981042329 4:140234569-140234591 TTCATCCCAGTCTCCCCAGCAGG + Intergenic
981824798 4:148927420-148927442 TTCAACCAAGGAGGCCCAGTAGG - Intergenic
981873958 4:149518759-149518781 TTCAGCCAAGGAGCCAGACCAGG + Intergenic
984870881 4:184324050-184324072 TTCAGCCAAAGACCCCCAGGCGG - Intergenic
985101196 4:186460205-186460227 GCCAGCCGAGGATCCCCAGCAGG + Intronic
986331236 5:6717378-6717400 TTCAGCCAATGCTCCACAGCAGG - Intronic
989361544 5:40607055-40607077 TTCAGCCCAGGATCCCAAAAAGG - Intergenic
996709641 5:126531612-126531634 TTCAGCCAAGGATCCTTTGCTGG + Intergenic
1001435077 5:171693745-171693767 TCCAGCCCAGGTCCCCCAGCAGG - Intergenic
1006019947 6:31112006-31112028 ATCTGCCAAGGATCCTCAGGGGG + Exonic
1007712536 6:43833822-43833844 CCCAACCAAGGATGCCCAGCTGG + Intergenic
1008148658 6:47922881-47922903 TTCAGCAAAGGAATCCCAGTAGG - Intronic
1011424278 6:87209479-87209501 TTCATCAAAGGCTCCTCAGCGGG + Intronic
1014957728 6:127641843-127641865 TTCTGCCAAGGAACCCAAGATGG - Intergenic
1016259161 6:142147141-142147163 GTCAACTACGGATCCCCAGCTGG - Intronic
1019044392 6:169132009-169132031 TTCAGCATAGCCTCCCCAGCTGG - Intergenic
1019315434 7:381947-381969 ATCAACCAAGGATACCCAGACGG + Intergenic
1019411266 7:907849-907871 GTCTGCCAAGCATCCCCAGTGGG + Intronic
1020362206 7:7339506-7339528 GTCTGCCGAGGATCCCCAGAGGG - Intergenic
1021629437 7:22629958-22629980 TGCCCCCATGGATCCCCAGCAGG - Intronic
1022845900 7:34209525-34209547 CTCAGCCAAAGAACCCCAGAAGG - Intergenic
1024889650 7:54185506-54185528 GACAGACAAGGATCCCCAGAAGG + Intergenic
1028347298 7:89798551-89798573 TGCAGCCTTGGATGCCCAGCTGG - Intergenic
1032405079 7:131650023-131650045 CACAGCCAGGGATCCCCGGCAGG - Intergenic
1034256905 7:149729703-149729725 TTCAGCAAAGGCATCCCAGCAGG - Intronic
1039357470 8:36836797-36836819 ATCTGCCAAAGATTCCCAGCTGG + Exonic
1039424900 8:37477643-37477665 CTCAGAAAAGGAACCCCAGCTGG - Intergenic
1039533753 8:38288581-38288603 TTCTGACAACGATCTCCAGCTGG + Exonic
1043077119 8:75715953-75715975 TCCAGCCAGGGGTCACCAGCTGG + Intergenic
1043968304 8:86504051-86504073 TTCTGACAATGATGCCCAGCTGG - Intronic
1050148211 9:2592312-2592334 TTCAGGCAAGGAACACAAGCAGG - Intergenic
1052062851 9:23982482-23982504 TTCAGACAAGGAGCTCCACCGGG - Intergenic
1058532969 9:105925174-105925196 TTCAGACCAGGATCCCCTCCCGG - Intergenic
1058704745 9:107628930-107628952 AGCAGCCAAGGCTCTCCAGCAGG - Intergenic
1059287757 9:113190827-113190849 TTCAATCAAGTCTCCCCAGCAGG + Intronic
1188346418 X:29072101-29072123 TCCATCCAATGATTCCCAGCAGG + Intronic
1189251783 X:39606008-39606030 TGCAGCCAACCATCCCCAACAGG - Intergenic
1189260132 X:39672633-39672655 GTCTTCCAAAGATCCCCAGCAGG + Intergenic
1191016834 X:55818435-55818457 TACAACCAAGGATCCTCAGGGGG - Intergenic
1191976886 X:66882427-66882449 TTCAGCCATTGAACACCAGCTGG - Intergenic
1192339689 X:70253488-70253510 TTCATCCAACAATCCCCAGCTGG - Intergenic
1195553943 X:106200042-106200064 TTTAGGCATGGATCCCCAACTGG - Intronic
1195554891 X:106210613-106210635 TGCAGCCCAGGATCCCCATGAGG - Intergenic
1196141604 X:112268774-112268796 TTCAGGCAGTGATGCCCAGCAGG - Intergenic