ID: 927740679

View in Genome Browser
Species Human (GRCh38)
Location 2:25566780-25566802
Sequence ATTTCAATGGAGACAGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927740672_927740679 -10 Left 927740672 2:25566767-25566789 CCAGGACAGCCAAATTTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 232
927740669_927740679 21 Left 927740669 2:25566736-25566758 CCTGAAAGGGTTGCAGGGAAGTG 0: 1
1: 0
2: 1
3: 25
4: 215
Right 927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 232
927740668_927740679 24 Left 927740668 2:25566733-25566755 CCACCTGAAAGGGTTGCAGGGAA 0: 1
1: 1
2: 8
3: 41
4: 301
Right 927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927740679 Original CRISPR ATTTCAATGGAGACAGGGGG TGG Intronic
900364497 1:2305565-2305587 ATTTTAATGGGGAGAGTGGGGGG + Intronic
903273596 1:22207357-22207379 ATTTTAATGGTTACAGGGGAAGG - Intergenic
903787308 1:25870044-25870066 CTTTCCATGGAGTCAGGAGGTGG - Intronic
904902437 1:33868061-33868083 ATGACAATGGAGAGAGAGGGAGG + Intronic
905693564 1:39959547-39959569 ATTTCAACCCAGACAGGGGCCGG - Intronic
907403329 1:54238941-54238963 ATTTCATGGGCGGCAGGGGGTGG - Intronic
907700457 1:56781827-56781849 ATTTTAAAGGAGAAAGGGGTTGG - Intronic
907776094 1:57516806-57516828 ATTTCAATAGAGCCAGGTGATGG - Intronic
909925255 1:81430821-81430843 TTTTCCATGGACACAGAGGGAGG - Intronic
910023088 1:82616683-82616705 ATTTCAAGGGAGAAAAGGAGAGG - Intergenic
915692269 1:157701433-157701455 ATTTTCATGGAAAAAGGGGGTGG - Intergenic
917689952 1:177458598-177458620 ATTTAAATGAAGATAGGAGGGGG + Intergenic
919843841 1:201628645-201628667 ATTTAGCTGGAGACAGCGGGCGG + Intronic
920957333 1:210631537-210631559 ATTACACTGGAAACAGGGCGTGG - Intronic
921592564 1:217021591-217021613 ATTTGAATGGAGTCATGGAGAGG - Intronic
922303268 1:224322034-224322056 ATTTCAATGGAGTGAGTGGCGGG + Intronic
924907543 1:248472603-248472625 ATTTCACTGGGGACTGGGAGAGG + Intergenic
1064024018 10:11832633-11832655 ATTTAAATCGGGACATGGGGCGG - Intronic
1064119877 10:12609326-12609348 TTTTCCATGGAGACGGGGTGGGG + Intronic
1064381860 10:14850094-14850116 ATTTTAATAGAGACAGGGTTTGG - Intronic
1064741529 10:18439595-18439617 ATTTCAAAGGTGATAGCGGGAGG - Intronic
1065021576 10:21506261-21506283 ATTTGAAGGGAGGCGGGGGGAGG + Intergenic
1068113037 10:52704111-52704133 ATTTAAAGAGAGACTGGGGGTGG + Intergenic
1069132946 10:64728911-64728933 ATTTCAATGGTCAGAGGTGGAGG + Intergenic
1070494660 10:77010552-77010574 AAGTCAGTGGAAACAGGGGGAGG + Intronic
1071908719 10:90205317-90205339 ATTTGAATGGAGAAAGAGAGAGG + Intergenic
1072754343 10:98008567-98008589 TTTGCAGTGGAGACAGGGAGAGG + Intronic
1072845081 10:98820441-98820463 ATTACAAAGGAGATAGGGGCTGG + Intronic
1074361884 10:112830311-112830333 AGTGGAATGGAGACAGGAGGTGG - Intergenic
1074379765 10:112969745-112969767 AGGTTAATGGAGACAGTGGGAGG - Intronic
1078641758 11:13103448-13103470 ACTTCACTGGGGAAAGGGGGTGG - Intergenic
1080287725 11:30635661-30635683 ATTTGATCGGAGGCAGGGGGTGG + Intergenic
1081953805 11:47071078-47071100 TTTTGAATGGAGGCAGGGGAGGG - Intronic
1082688086 11:56264392-56264414 ATTTCACTGGGGATAGTGGGTGG - Intergenic
1082798079 11:57393000-57393022 AAATCAATGGAGACAGGGGAGGG - Intronic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1083510796 11:63208229-63208251 AGTGCAATGGAGCCAGGGGTGGG + Intronic
1084637252 11:70399940-70399962 ACGTGAATGGAGACAGGGGCAGG - Intronic
1085759621 11:79230749-79230771 ATGACAATGGAGACAGGCAGTGG + Intronic
1085826481 11:79853167-79853189 TTATCAGAGGAGACAGGGGGAGG + Intergenic
1086211838 11:84330140-84330162 ATTACAATGGAAATAGGGAGAGG - Intronic
1086852298 11:91823798-91823820 GTTTTAATGGAGACAGGGATTGG - Intergenic
1088211088 11:107457256-107457278 ATACCAATAGAGACAGGAGGAGG + Intronic
1091217680 11:133913211-133913233 TTTGCAATGGAGATAGGGGAGGG - Intronic
1092000422 12:5027175-5027197 AGCTCATGGGAGACAGGGGGTGG - Intergenic
1093696207 12:22163484-22163506 TTTTTAATGGAGACAGGGTTAGG - Intronic
1094361596 12:29637182-29637204 ATTACACTGGAGATAGGGGGTGG + Intronic
1095104987 12:38222350-38222372 ATTCCAAGGCAGACAGGGGCGGG + Intergenic
1100522214 12:95385953-95385975 TTATCAAAGAAGACAGGGGGAGG + Intergenic
1101841810 12:108333063-108333085 AAGTCAATGGAGAGAGGGTGTGG - Intronic
1102918830 12:116776518-116776540 AATTCCATGGAGACAGGGCAGGG + Intronic
1103825707 12:123736480-123736502 ATTACAATCCAGACCGGGGGCGG - Intronic
1109442480 13:62393919-62393941 ATTTCTAGGCAGACAGGGGTGGG + Intergenic
1109521030 13:63511305-63511327 ATTTCTAGGCAGACAGGGGTGGG + Intergenic
1111759199 13:92440248-92440270 ACTACAATGGAGAGAGAGGGAGG - Intronic
1111847041 13:93524000-93524022 ATTTCAGTGGAAAGAGAGGGGGG + Intronic
1112383304 13:98914441-98914463 ATTTCATTTGAAACAGGAGGAGG + Intronic
1113672948 13:112187488-112187510 ATCTCAAGGGAGACAGAGAGAGG + Intergenic
1115606298 14:35005688-35005710 GTTTCAATGGAGGCTGGGTGTGG - Intronic
1117163515 14:53011781-53011803 AATTCAATGGAGATGGGGGAGGG + Intergenic
1117876193 14:60251859-60251881 ATTTCATGGGAGACAAAGGGTGG + Intronic
1117908817 14:60616738-60616760 ACTTTATTGGAGAAAGGGGGTGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118724313 14:68617898-68617920 ATCCCAAGGGATACAGGGGGAGG + Intronic
1119442010 14:74634832-74634854 ATGTCAATTGAGAGAGGTGGGGG + Intergenic
1123184405 14:106502595-106502617 ATGTCCATGGAGACTGGGGATGG - Intergenic
1124147036 15:27137286-27137308 ATTTCATTGGAGACAGTGGTAGG - Intronic
1126330706 15:47528015-47528037 ATTTCCATCCAGACATGGGGTGG + Intronic
1127152243 15:56087987-56088009 ATTTCTATGGAGAGAAGGGAGGG + Exonic
1127503183 15:59573609-59573631 ATGTAGATGGAGACAGGTGGGGG + Intergenic
1128320499 15:66690456-66690478 ATAGCAGTGGAGAAAGGGGGTGG - Intergenic
1128446988 15:67771468-67771490 AGTTTTATGGAGACAGAGGGAGG + Intronic
1131550202 15:93350720-93350742 ATGTCAATCAAGACAGGAGGTGG - Intergenic
1132071670 15:98783104-98783126 TTTTTAATGGGGGCAGGGGGAGG - Intronic
1134000945 16:10782351-10782373 ATTTCAAAGGAGCAAGGGGCAGG - Intronic
1135812308 16:25599221-25599243 ATTTTAAAGGAGACAGGTGAGGG + Intergenic
1136034970 16:27532280-27532302 ATTTCATTGTTCACAGGGGGAGG - Intronic
1143263709 17:5619827-5619849 ATTTTAATGAAGAAAGGGGCAGG - Intergenic
1143566188 17:7722174-7722196 ATTTTTATAGAGACGGGGGGGGG + Intronic
1143861112 17:9891421-9891443 ATTTGATTGGAGCCAGGGGCAGG + Exonic
1146906623 17:36622200-36622222 ATTTCCATAGGGACAGGAGGGGG - Intergenic
1148486001 17:47991405-47991427 ATTGCCATGGAGATTGGGGGAGG - Intergenic
1148511923 17:48178248-48178270 TTTTCAAAGGAGTCGGGGGGCGG - Intronic
1149468679 17:56899083-56899105 GTTGCCATGGAGACAGGGGTGGG + Intronic
1151383017 17:73738443-73738465 AGTTCCATGGAGAGAGGGGCTGG - Intergenic
1151469327 17:74308220-74308242 ATTGCAATGGAGGAAGGGAGAGG + Intronic
1153749367 18:8212876-8212898 ATTGGAATGGAGACGGGTGGTGG - Intronic
1156088364 18:33436721-33436743 ATTTCAGTGGAGCCTGGGGGAGG + Intronic
1156860497 18:41830362-41830384 TTTCCAGTGGAGACATGGGGAGG - Intergenic
1156905547 18:42348309-42348331 AATTCTAGGCAGACAGGGGGAGG + Intergenic
1157168254 18:45378412-45378434 TTTTCAATAGAGATAGGGGATGG - Intronic
1157582566 18:48782094-48782116 GTTTCCATGGAGGCAGGGGTGGG + Intronic
1157893118 18:51437757-51437779 AGTTCCAGGGAGACAGGGGAAGG + Intergenic
1158847953 18:61464438-61464460 TTTTTAATGGAGACAAAGGGAGG - Intronic
1159539911 18:69761660-69761682 AGTCCAAGGGAGACAGGGGCAGG + Intronic
1160054729 18:75467675-75467697 ATTTCCATGCAGACAGTGTGAGG + Intergenic
1163578897 19:18126460-18126482 CTTTCAATGGGGACAGTGGCAGG - Intronic
1164028882 19:21381967-21381989 ATGTCCATGGAGACAGGCTGAGG - Intergenic
1164822065 19:31257972-31257994 AGTGCAAGGGAGACAGGGAGGGG + Intergenic
1165503906 19:36212441-36212463 ATTTTAGTAGAGACGGGGGGAGG - Intronic
1166823123 19:45592608-45592630 ATTTCAATGGGGGCAGGGGAGGG + Exonic
927572020 2:24168165-24168187 AGTTCAGGGGAGACTGGGGGTGG + Intronic
927607359 2:24498727-24498749 ATTTTAATGGAGGGAGGTGGTGG + Intronic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928775788 2:34761711-34761733 ATTGCAAGGTAGACAGAGGGAGG - Intergenic
929641631 2:43585966-43585988 ATATTAATGGAGAAAGGGGCTGG + Intronic
931895737 2:66727487-66727509 ATTACAATGGAGACCGGGAATGG + Intergenic
935715794 2:105937900-105937922 GTTTCAATGGACACAGGCAGGGG + Intergenic
937332664 2:121042047-121042069 ATTTGAATGCAGCCAGGTGGAGG + Intergenic
937698321 2:124834570-124834592 ATGGCAATGGAGACAGGGGCTGG + Intronic
937715314 2:125025513-125025535 ATTTTAAAGGAGGTAGGGGGTGG - Intergenic
938849447 2:135245628-135245650 TTTTTAATAGAGACAGGGGCTGG + Intronic
939635129 2:144572740-144572762 ACTTCTGTGGAGACAGGGAGAGG + Intergenic
941411890 2:165167981-165168003 ATTTCAAGGGAGAAAGGATGAGG + Intronic
942158623 2:173158330-173158352 TTTTAAAGGGAGAAAGGGGGAGG + Intronic
944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG + Intronic
945250712 2:207764354-207764376 ATATGGATGGAAACAGGGGGTGG + Exonic
945422114 2:209651223-209651245 TTTTCAATGTACACAGGGAGAGG + Intronic
945905732 2:215590735-215590757 ATTTCACTGAACACAGGGTGAGG + Intergenic
946115161 2:217455075-217455097 GTTTCATAGGAGACAGGAGGTGG + Intronic
948044989 2:234936616-234936638 ATTTCAATGCAGAGCGAGGGCGG + Intergenic
948936548 2:241168820-241168842 ATTTCAGGGGAGATGGGGGGAGG + Intronic
948990981 2:241553872-241553894 AAGTCACTGGAGACAGGGAGGGG + Intergenic
1169526243 20:6429013-6429035 ATTTCCATGGACACAGGAAGGGG - Intergenic
1170073936 20:12398504-12398526 TTTTGAATGGAGAGAGGGAGAGG + Intergenic
1170326494 20:15160053-15160075 ATGTAAATGGAGACAGGGCATGG + Intronic
1171327331 20:24306058-24306080 ATTTCCATGGATTCAGAGGGAGG - Intergenic
1171387790 20:24781728-24781750 ATTTCTATGGAAACAGCTGGTGG - Intergenic
1173124569 20:40324890-40324912 ATGACAATGGAGACAGAGGTTGG - Intergenic
1173373187 20:42458552-42458574 AATGCAATGGGGCCAGGGGGAGG - Intronic
1173627274 20:44482393-44482415 TTTTCAGTAGAGACAGGGGGTGG - Intronic
1174418810 20:50385887-50385909 ATTGCAATGAAGTAAGGGGGTGG + Intergenic
1174968889 20:55251534-55251556 ATTACCATGGAGACAGTGGATGG - Intergenic
1175256024 20:57647733-57647755 ATGCTCATGGAGACAGGGGGAGG - Intergenic
1178511453 21:33208054-33208076 ATATCTATGGAGAGATGGGGTGG - Intergenic
1179568088 21:42261541-42261563 GTTTCAGTGGAGAGAGGGGGTGG - Intronic
1182039138 22:27222823-27222845 ATTTTAATGGAGATGGGAGGCGG - Intergenic
1182049044 22:27299297-27299319 ATTACAGGGGAGAGAGGGGGTGG - Intergenic
1184838360 22:47037301-47037323 ATTTCAATGGAGAGAGCGCTTGG - Intronic
949871858 3:8595912-8595934 ATTTTAATGGGGACAGATGGTGG + Intergenic
950373487 3:12551063-12551085 AGTCCAAAGGAGACAGGGGCAGG - Intronic
952053435 3:29414321-29414343 ATGTTAATGGAGAAAGTGGGTGG - Intronic
952614794 3:35257773-35257795 ATTTGAATGAGGGCAGGGGGTGG - Intergenic
955351506 3:58196759-58196781 CCTTCAATGGGGACAGAGGGGGG - Intronic
955599359 3:60628770-60628792 ATTTCATTTGAAACAGTGGGGGG - Intronic
955753562 3:62205969-62205991 TTTTCTATGAAGACAGGTGGTGG + Intronic
956257702 3:67302094-67302116 ATTAGAATGGAGGCTGGGGGGGG - Intergenic
958861231 3:99447133-99447155 ATTTAAATGGAGAAAAGAGGAGG + Intergenic
959544957 3:107584965-107584987 ATTTCAACTGAGGCCGGGGGTGG - Intronic
959920397 3:111862130-111862152 ATTTAAAAGGAGACCGGGTGTGG - Intronic
961227516 3:125265620-125265642 TTATCAATGGATAGAGGGGGAGG - Intronic
961713836 3:128845910-128845932 GTCTCCATGGAGACAGGGGCGGG + Intergenic
962068406 3:132008212-132008234 ATTTCACTCGAGACTGGGTGTGG - Intronic
962964320 3:140339332-140339354 ATTTCCTTGGAGAAAGGAGGTGG - Intronic
964228161 3:154431000-154431022 GTTTAAATGGAAACAGGGGAAGG + Intergenic
965827507 3:172745637-172745659 ATTTTCATGCAGACAGAGGGAGG + Intergenic
968003632 3:195224715-195224737 AGTTCTAGGGAGCCAGGGGGAGG - Intronic
968657021 4:1783084-1783106 AGAGCAATGGAGACAGGTGGGGG + Intergenic
970022430 4:11584154-11584176 ATTTCAAAGAAGAGAAGGGGTGG + Intergenic
971150452 4:24025837-24025859 AATTCAATGGGGAAAGGAGGAGG + Intergenic
974095908 4:57363709-57363731 ATTTTAAAGGAGATAGGGGTGGG - Intergenic
975401995 4:73949409-73949431 ATTTTAAAGGAGAAAGGGAGAGG + Intergenic
976093695 4:81484866-81484888 ATTTCACTAGAGACAGAGGATGG + Intronic
977284216 4:95082171-95082193 AATTCAATGGACACAGGAAGGGG - Intronic
979188055 4:117823920-117823942 AATTCAAGGCAGACAGGGGTGGG + Intergenic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
986477712 5:8152775-8152797 ATTTAAATGGGGCCAGGGGATGG + Intergenic
986808435 5:11330651-11330673 TTTTTAGTAGAGACAGGGGGTGG - Intronic
986842133 5:11710053-11710075 ATTTCAATGTAGTGAGGGAGAGG + Intronic
986926504 5:12759285-12759307 ATTTCAATGTAGACAGTGATAGG + Intergenic
991512923 5:67399682-67399704 ATTTCAATGGTGGAGGGGGGGGG + Intergenic
991582409 5:68170044-68170066 ATTTCCATGGAGACAGAGGTGGG - Intergenic
992657654 5:78926501-78926523 CTTTCAATGGAGTCACTGGGAGG + Intronic
992750208 5:79854476-79854498 ATTTCAATAGAGATGGGGAGTGG + Intergenic
993182556 5:84572955-84572977 ATTTCAATGGATACAGATGAAGG - Intergenic
993744002 5:91573820-91573842 ATCTCACTGGAGACAGAGTGAGG - Intergenic
997136168 5:131328835-131328857 ACTTCAATGGTGCCAGGTGGCGG - Intronic
998472859 5:142396868-142396890 TTTGCAATGCAGAAAGGGGGTGG + Intergenic
999040841 5:148410098-148410120 TTTTCAATGGAGGAAGTGGGAGG + Intronic
1000414417 5:160968274-160968296 CTTTCAATGGAGGAAGGGGTAGG - Intergenic
1001521865 5:172400134-172400156 GTTTCAAAGGAGAAAGGGAGAGG - Intronic
1001563484 5:172684982-172685004 ATTTCAATAGAGTCAAAGGGAGG - Intronic
1005714612 6:28534913-28534935 ATTTTATTGGAGACAGTGGCAGG - Exonic
1006140840 6:31928743-31928765 TTCTCAAAGGAGACAGGGGCTGG - Exonic
1006265765 6:32921892-32921914 ATGTCAATGGAGATGGGGGCGGG + Intergenic
1007287529 6:40758336-40758358 ACTTCAATGGAGCCATGGTGGGG + Intergenic
1011074828 6:83427833-83427855 ATTTTAATAGAGACAGGGTTTGG - Intronic
1012307112 6:97672386-97672408 ATTGCAATGGAGAGAGGGGGAGG - Intergenic
1012467612 6:99532981-99533003 ATTTTAGTAGAGACGGGGGGTGG - Intergenic
1013289606 6:108708863-108708885 GTTACAATGGAGCCGGGGGGAGG - Intergenic
1014173535 6:118306349-118306371 ATTACAATGGAATCAAGGGGTGG - Intronic
1017106187 6:150890399-150890421 GGTTCAAGGGAGACAGGGGCAGG + Intronic
1018439832 6:163801160-163801182 TTTTCAGTAGAGACAGGGGCAGG - Intergenic
1018782469 6:167080636-167080658 ATTTCAACTGAGAAAGGGTGAGG - Intergenic
1019375397 7:688656-688678 ATTTCAGTGGAGACTTGGGGAGG - Intronic
1019853671 7:3583816-3583838 ATTTCACTGGAGAAAGAAGGTGG + Intronic
1020438013 7:8186547-8186569 ATACAAATGGAGACAGGGGATGG + Intronic
1021893740 7:25213107-25213129 AATTGAATGGAGAGAGGGAGAGG + Intergenic
1022087322 7:27081100-27081122 ATATGAAAGGAGACAGGAGGAGG + Intergenic
1023315206 7:38929210-38929232 TTGTCAATGGGGACAGGGGGAGG - Intronic
1023517584 7:41017478-41017500 ATTTCACTGGAGGCCGGGTGCGG + Intergenic
1023985131 7:45089519-45089541 GTTGCCATGGAGACAGGAGGCGG - Intergenic
1024117192 7:46205698-46205720 ATTCCAGTGGGGACAGGGGATGG - Intergenic
1024307743 7:47942445-47942467 ATTTAAATGGAGTGGGGGGGCGG - Intronic
1024655829 7:51450759-51450781 AGTTCAAAGGAAACAGAGGGTGG + Intergenic
1026465588 7:70650958-70650980 ATTTCAATGGACAGAGAGGAAGG + Intronic
1030755771 7:113285977-113285999 ATTCCTATGCAGACAGGGGCTGG - Intergenic
1031053109 7:116965359-116965381 AATTCTATGGACACAGGGAGGGG + Intronic
1032982153 7:137296633-137296655 ATTTCTGTGGTGGCAGGGGGTGG + Intronic
1033143378 7:138848399-138848421 ATTTCAATAGATACAGCAGGTGG - Intronic
1033308867 7:140244881-140244903 TTTGCAATGGAGACAGCTGGTGG + Intergenic
1033681009 7:143596640-143596662 AATTTAATGGAGAAGGGGGGGGG - Intergenic
1033703883 7:143865173-143865195 AATTTAATGGAGAAGGGGGGGGG + Intronic
1036826462 8:11980095-11980117 AATTCAATGTGGACAGGGTGAGG + Intergenic
1036980472 8:13464583-13464605 ATTTCCATGGTGGCGGGGGGTGG - Intronic
1038102380 8:24392698-24392720 AATTCACTGGAGAAAAGGGGTGG - Intronic
1038247028 8:25867982-25868004 ATTTCAGTGGGCAGAGGGGGAGG - Intronic
1041629042 8:60064130-60064152 ACTTCCATGTGGACAGGGGGTGG + Intergenic
1042610614 8:70595908-70595930 ATGTGAAAAGAGACAGGGGGTGG + Intronic
1047966782 8:130050845-130050867 CTTTCAACGGAGTCAGGGGGTGG + Intergenic
1049113111 8:140661926-140661948 AGTACAATGGGGACAGGAGGAGG + Intronic
1050052500 9:1617776-1617798 ATTGCAGTGGAGACAGGCTGGGG - Intergenic
1050094565 9:2050643-2050665 ATTGCAATGGCGACAAGGGCAGG - Intronic
1050429125 9:5543861-5543883 ATTTCAATGGGGTGGGGGGGAGG + Intronic
1050968475 9:11838550-11838572 ATGTCACTGGAGGCAGGGGGCGG - Intergenic
1051451984 9:17207162-17207184 ATTGCAATGGAAACAGGAGAAGG - Intronic
1052869683 9:33491907-33491929 ATTGCAAAGGAGACAGAGTGCGG + Intergenic
1054578620 9:66887644-66887666 ATAACAATGGAGGCAGAGGGCGG - Intronic
1055651064 9:78407574-78407596 ATTTCAGGGGAGAGAGGGAGAGG + Intergenic
1056434838 9:86565903-86565925 ATGTCAATGGAGAGACGAGGTGG - Intergenic
1056684468 9:88748049-88748071 ATCTCAATAAAGCCAGGGGGTGG - Intergenic
1059177951 9:112184526-112184548 TTTTTAATGGAGGCCGGGGGTGG - Intergenic
1060566235 9:124594576-124594598 ATTTCTATGCATACTGGGGGAGG + Intronic
1062195670 9:135272585-135272607 ATTTCATCGAAGACAAGGGGTGG + Intergenic
1186303897 X:8232842-8232864 AATTCAATGCAGGCAGAGGGTGG + Intergenic
1187597962 X:20795928-20795950 ATTCCAATGGAGAAGTGGGGAGG + Intergenic
1188762010 X:34044004-34044026 CTTTCAAGGGAGGCAGAGGGAGG + Intergenic
1191867636 X:65717970-65717992 AGTAGAATGGAGACAGGGGTAGG + Intronic
1193202254 X:78705455-78705477 ATTTGAATTTAGAGAGGGGGAGG + Intergenic
1194285316 X:92003415-92003437 ATTTCAATAAATAGAGGGGGAGG - Intronic
1194398866 X:93419087-93419109 GTTGCAAGGGAGACAGGGGAAGG + Intergenic
1194426770 X:93748400-93748422 ATTTCAGAGGAGACAGGAAGAGG + Intergenic
1195814946 X:108874647-108874669 CTTTCTAAGGAGACAGGAGGAGG - Intergenic
1196695656 X:118608534-118608556 ATTTAAATGAGGGCAGGGGGTGG - Intronic
1200073635 X:153540845-153540867 ACTTTAGTGGAGACATGGGGAGG - Intronic
1200602887 Y:5227957-5227979 ATTTCAATAAATAGAGGGGGAGG - Intronic
1200793295 Y:7318262-7318284 AGATCAATGGAGAGAAGGGGAGG - Intergenic