ID: 927741154

View in Genome Browser
Species Human (GRCh38)
Location 2:25570709-25570731
Sequence GATCCTGCCTCCAGTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927741154_927741162 20 Left 927741154 2:25570709-25570731 CCCACCTCACTGGAGGCAGGATC 0: 1
1: 0
2: 1
3: 13
4: 166
Right 927741162 2:25570752-25570774 CTCATATTGAAGAGCTTCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 169
927741154_927741161 19 Left 927741154 2:25570709-25570731 CCCACCTCACTGGAGGCAGGATC 0: 1
1: 0
2: 1
3: 13
4: 166
Right 927741161 2:25570751-25570773 CCTCATATTGAAGAGCTTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927741154 Original CRISPR GATCCTGCCTCCAGTGAGGT GGG (reversed) Intronic
900327404 1:2115440-2115462 GTTTCTGCCTCCAGTTATGTGGG + Intronic
901365533 1:8744960-8744982 TATCCTACCTCCAGTCAAGTGGG + Intronic
902383612 1:16064278-16064300 GATCCTGGACCCAGTGAGGGAGG - Intronic
902639558 1:17758143-17758165 GAGGCTGCCTCCATTGAGATGGG + Intronic
905872037 1:41409984-41410006 GTTCCTGCCTCCAGTGGGTCAGG + Intergenic
905922329 1:41727886-41727908 GATCCTTCCAGCAGTGTGGTGGG - Intronic
906054493 1:42904589-42904611 GCTCCTCCCTCCAGGGAGGTAGG - Intergenic
911044477 1:93617247-93617269 GATCAGGCTCCCAGTGAGGTAGG + Intronic
911189585 1:94934179-94934201 GACCCTGCTTTCAGTTAGGTTGG - Intergenic
915631383 1:157155852-157155874 GAGCCAGCCTCCAGGGAGGACGG + Intergenic
916384168 1:164249067-164249089 CAGCCTCCCTGCAGTGAGGTGGG - Intergenic
916418055 1:164610889-164610911 AATTCTGTCTCCAGTGAGGCTGG + Intronic
918675420 1:187279079-187279101 GAACCTGGCTACAGTGAAGTTGG - Intergenic
922683722 1:227622715-227622737 CCTCCTGCCTCCATTGAGGTGGG + Intronic
924861092 1:247923295-247923317 CATCATTCCTCCAGTGAAGTGGG - Intergenic
1064371132 10:14752310-14752332 GAGCCTCCCTCCAGGGAGGAAGG + Intronic
1065893709 10:30142665-30142687 GGTCCTGTCTCCTGTGAAGTAGG - Intergenic
1066371242 10:34819919-34819941 AATCCTGCCTCCAGTCAAGGTGG - Intergenic
1067247607 10:44559505-44559527 GATCCTCTCTGCAGTGAGGAGGG + Intergenic
1067531379 10:47076414-47076436 GTTCCTGCTTTCAGTCAGGTTGG + Intergenic
1069659184 10:70112453-70112475 GGTCCTGCCTCCAGGAAGGTGGG + Exonic
1072608340 10:97001401-97001423 GCTGCTGCCTCCAGGGAGGCAGG + Intronic
1072797262 10:98365601-98365623 GATCCTGCCTCCTGGGTTGTTGG + Intergenic
1074695781 10:116049258-116049280 CCTCCTGCAACCAGTGAGGTTGG + Intergenic
1075045071 10:119140168-119140190 GATCCTGTCTCTAATGAGGCAGG + Intergenic
1075510232 10:123066597-123066619 ATTCTTGCCTCCATTGAGGTTGG + Intergenic
1075702411 10:124478042-124478064 GATCTTGGCTCCACTGTGGTTGG + Intronic
1076640774 10:131915558-131915580 GACAGTGCCTCCAGTGAGGAAGG - Intronic
1076687378 10:132204213-132204235 GATCCAGCCTCAGGGGAGGTGGG + Intronic
1077369342 11:2174274-2174296 GCTCCTGCCTCCAGAGAGCCTGG - Intergenic
1077442432 11:2574929-2574951 GAGCCTGCCTGCAGTGAGTGTGG + Intronic
1080311241 11:30895254-30895276 GTTCCTGCCTCAAGTTTGGTCGG + Intronic
1082910333 11:58366022-58366044 GATGATGACTGCAGTGAGGTGGG + Intergenic
1083201395 11:61123111-61123133 GGTCATGCCTCCAGAGAGCTGGG + Intronic
1083454499 11:62769674-62769696 GTTCCTGCCTCCACTCAGATTGG + Intergenic
1083582329 11:63832849-63832871 GCACCTGGCTCCAGGGAGGTAGG - Intergenic
1083661449 11:64253281-64253303 GGTCCTGGCTCCAGTGATCTCGG + Intronic
1084098588 11:66930035-66930057 GATCTTACCCCCAGTGAAGTTGG + Intronic
1084460159 11:69292736-69292758 GATGGTGACACCAGTGAGGTGGG - Intergenic
1085130429 11:74033504-74033526 GAAGCTGCCACCAGTGAGCTCGG - Exonic
1085729142 11:78981784-78981806 GACTCTGTCTACAGTGAGGTAGG - Intronic
1086091392 11:83008324-83008346 TCTCCTGCTTCCAGTGAGGAGGG - Intronic
1090618255 11:128537028-128537050 GATACTGCATACAGTGAGGCTGG - Intronic
1090825257 11:130380715-130380737 TTTCCTGCTTTCAGTGAGGTGGG + Intergenic
1091795585 12:3295847-3295869 AATCCTGCCTCCAGTCAGGCTGG + Intergenic
1092375272 12:7950431-7950453 GCTCCTGGCTCAAGCGAGGTCGG + Intergenic
1092940230 12:13401269-13401291 GATCCTGCCTAGAGTGGGGGAGG + Intergenic
1096522616 12:52192746-52192768 CATGCTACCTCCTGTGAGGTGGG - Intergenic
1098081355 12:66788728-66788750 GATCCTGCCTGCAGCTACGTTGG + Intronic
1102412336 12:112730750-112730772 GAGCCTGCTTCCAATGACGTTGG - Intronic
1105977334 13:25483449-25483471 GCTCCTTCCTCCAGCAAGGTAGG + Intronic
1107272590 13:38637921-38637943 GATCCTTCCTCAAGTGTTGTTGG - Intergenic
1108423319 13:50272523-50272545 GAAGCTGCCTACAGTGAGCTGGG + Intronic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1113825844 13:113252469-113252491 GATCCAGCCTGCAGTAAGCTAGG + Intronic
1113848728 13:113406145-113406167 GATGATGCCGCCAGTGACGTGGG + Intergenic
1117981988 14:61350699-61350721 GATCCTGCCCCCAGGGATGCTGG - Intronic
1118473002 14:66092945-66092967 CATGCTGGCTCCAGTGGGGTGGG + Intergenic
1118839863 14:69501998-69502020 GCTCCTGCCTTCAGTCATGTTGG - Intronic
1118864105 14:69689121-69689143 GATCCTACTTCCCGTGAAGTTGG + Intronic
1119773163 14:77234083-77234105 GATATGGCCTCCAGTCAGGTTGG - Intronic
1122278224 14:100606117-100606139 GTTCGTGCCTCCAGAGACGTTGG - Intergenic
1122651051 14:103227300-103227322 GATCCTGCCTCAACTCAGGCTGG - Intergenic
1122958870 14:105085440-105085462 GCTGCTGCCTCCAGTGCAGTGGG - Intergenic
1125182643 15:36895142-36895164 GATCCGGCCTGCAGGTAGGTTGG - Exonic
1125346622 15:38725123-38725145 GATTCTCCCTCCAGAGTGGTGGG + Intergenic
1125693259 15:41614086-41614108 GATTCAGGCTGCAGTGAGGTAGG - Intergenic
1128335852 15:66785422-66785444 GTTCCTTCCTCCAGAGAGGTTGG - Intergenic
1128525154 15:68407262-68407284 AATCCTGTCCCCAGTGAGGTTGG - Intronic
1128637706 15:69313828-69313850 GTTCCTGCCAACAGTGAGGGTGG + Intronic
1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG + Intronic
1131059753 15:89397469-89397491 GACCCTGCCCCCAGGGAGGGTGG - Intergenic
1131668858 15:94598196-94598218 GAGCCTGACTCCAGTGGTGTAGG + Intergenic
1132994386 16:2815405-2815427 GTTCTTGCCTCCAGTGAGGCTGG - Intergenic
1132996638 16:2827023-2827045 GTTCCTGCCTCCAGTGAGGCTGG + Intergenic
1133786220 16:8975430-8975452 GATCCAGCCTTCAGTGAGCCGGG - Intergenic
1134124610 16:11607962-11607984 GATCCTGCCTTCAGGGAGCTGGG - Intronic
1135405685 16:22196060-22196082 GATCCTGCCTACAGCCACGTAGG + Intergenic
1138597840 16:58038598-58038620 GCCCCTGCCTGCAGGGAGGTGGG - Intronic
1140521948 16:75589359-75589381 GATCCTGCCTGTTGTCAGGTTGG + Intergenic
1141528412 16:84628625-84628647 GCTTCAGCCTCCAGTGAGGAAGG + Intergenic
1143722510 17:8822717-8822739 GCTCCTGCCCTCAGAGAGGTGGG - Intronic
1143777015 17:9206207-9206229 TCTCCTGCCTCCAGTCAGGAGGG + Intronic
1144751264 17:17649767-17649789 GATCATGCCTACAGTGAGCTAGG + Intergenic
1148857467 17:50586564-50586586 GGTCCTGCCTTCTGTGAGCTTGG + Intronic
1150307465 17:64098432-64098454 GATCCTGCCTGCAGACAGGCAGG + Intronic
1152892857 17:82892250-82892272 GCTCCTGCCTGCTGTGATGTGGG + Intronic
1154197638 18:12278298-12278320 GATTCTGCCTGCAGCCAGGTGGG + Intergenic
1158893003 18:61890508-61890530 CATGCTGCATCCAGTGTGGTTGG - Intronic
1160898577 19:1415204-1415226 GTTCCTTCTGCCAGTGAGGTGGG + Intronic
1161519015 19:4713336-4713358 GGGCCTGGCTCCCGTGAGGTGGG - Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167523991 19:49972490-49972512 GGTCCTGCATCCAGGGATGTAGG + Intergenic
1167642863 19:50691377-50691399 GAGGTTGCCTCCAGTGAGGAAGG - Intronic
1167716750 19:51147042-51147064 GCTCCTGCCTCCTGGGTGGTGGG - Intronic
1168280271 19:55302010-55302032 CATCCTGCCCCCGGTGGGGTGGG + Intronic
926215082 2:10901327-10901349 CATCCTGCCTGCAGGCAGGTGGG - Intergenic
926314673 2:11700572-11700594 GATACTGCCTCCAGAGAGGCAGG - Intronic
927400365 2:22703865-22703887 GCTACTGCTTCCAGGGAGGTAGG + Intergenic
927495685 2:23550100-23550122 GCTCCTGCCTTCAGGGAGGGAGG - Intronic
927643258 2:24859372-24859394 TATCCTGGCAACAGTGAGGTCGG - Intronic
927741154 2:25570709-25570731 GATCCTGCCTCCAGTGAGGTGGG - Intronic
929787054 2:45000774-45000796 GAGCCGGCCTGCGGTGAGGTCGG + Intergenic
932400779 2:71479654-71479676 GTGCCTGTCCCCAGTGAGGTGGG - Intronic
935735984 2:106107038-106107060 GATACTCACTACAGTGAGGTTGG - Intronic
936261241 2:110961109-110961131 GAGCCTGCCTCCCATGTGGTTGG + Intronic
936918030 2:117660019-117660041 GAGACAGCCTCCAGTGCGGTGGG - Intergenic
939015921 2:136903729-136903751 GCTAGTGCCTCCAGGGAGGTTGG + Intronic
942208539 2:173647802-173647824 GTTCCTGCCTCCTGAGAGCTGGG + Intergenic
944683930 2:202101271-202101293 GGTCCTGCTGCCAGTGAGGGAGG + Intronic
948706879 2:239800121-239800143 CATTCTGCCTCCAGTGAGTGGGG - Exonic
1170665916 20:18385774-18385796 GACCTTGGCTCCAGTGAGTTGGG + Intronic
1170880531 20:20293016-20293038 AAATCTGCCACCAGTGAGGTGGG + Intronic
1172053118 20:32134478-32134500 GTTCTTGCCTTCAGTGAGCTTGG - Intronic
1172100262 20:32481025-32481047 GAGAATGCCTCCAGTGTGGTAGG - Intronic
1173141843 20:40491617-40491639 AATCCTGCCACCAGTGAGTGGGG - Intergenic
1174583594 20:51590737-51590759 GAACCTGCCTCCAGTATGCTGGG - Intergenic
1179942809 21:44650729-44650751 GCTCCAGCCCCCAGTGAGGGTGG + Intronic
1180709594 22:17830852-17830874 GATGTTGGCCCCAGTGAGGTGGG - Intronic
1182826719 22:33271829-33271851 GCTCCAGCCTTCAGTGAGATTGG + Intronic
1183487749 22:38098363-38098385 GGTCCTGCCTGCAGTGAGTTGGG + Intronic
1184249520 22:43252279-43252301 GATTGTGGCTCCAGTGAGGGAGG - Intronic
1184388406 22:44189100-44189122 TCTCCTGCCTCCAGAGAGGCTGG + Exonic
1184686099 22:46097026-46097048 CATCCTGCCTCAAGTCAGGCTGG - Intronic
1184723352 22:46328872-46328894 GATGCAGCCCCTAGTGAGGTGGG + Exonic
952491343 3:33876556-33876578 GATCCTGGCTCCAGTGGCTTCGG + Intergenic
952884987 3:38006683-38006705 GACCCTGCCCGCAGGGAGGTGGG + Exonic
952920750 3:38282362-38282384 GGTCCTGCCTACAGGGAGGCAGG + Intronic
954747025 3:52793161-52793183 GTGCCTGCTGCCAGTGAGGTTGG + Intergenic
955363683 3:58293843-58293865 GATCCTGCCCCAAATGCGGTCGG + Exonic
959095991 3:101956438-101956460 GCTCCTTTCCCCAGTGAGGTTGG - Intergenic
960254915 3:115501655-115501677 TCCCCTGCCTCCAGTTAGGTGGG + Intergenic
961471429 3:127115619-127115641 GACCCTGCTTCCACTGTGGTTGG - Intergenic
964796779 3:160506621-160506643 GGTCTTACCTCCAGTGAGGTAGG + Intronic
970925923 4:21452293-21452315 GACCCTGCCTTCATGGAGGTGGG + Intronic
976002261 4:80386981-80387003 GAACCTGCCCCCACTGCGGTGGG + Intronic
979275526 4:118810889-118810911 GACACAGCCTCCAGTGGGGTAGG + Intronic
988475588 5:31582366-31582388 GCCCCTGCATCCAGGGAGGTGGG - Intergenic
992892827 5:81219585-81219607 GTCCCTTCCTCCAGTGAGGCGGG - Intronic
996552463 5:124744769-124744791 GGTCCGGCCTCCAGTGGGGCTGG - Exonic
997512489 5:134463220-134463242 CATCCTGTCTCCAGTAAGTTGGG + Intergenic
999972945 5:156883165-156883187 GAGTCTGCCTTCAGTGAGGGGGG + Intergenic
1001120885 5:168979006-168979028 CATCCTACCTCCAGTCAGGCTGG - Intronic
1007083496 6:39126207-39126229 GAACCTGGCTTCAGAGAGGTGGG + Intergenic
1007276603 6:40678775-40678797 GCTTCTGCCTCCAGAGAGGATGG + Intergenic
1007552232 6:42738874-42738896 GATCAAGCCTCCAGTGAGCCAGG + Intergenic
1008415914 6:51239745-51239767 GATCCTGCATCCAAGAAGGTAGG - Intergenic
1008592869 6:53011231-53011253 GGTCCAGCCTCCAGGGAGGGAGG - Intronic
1010938499 6:81888307-81888329 GATGCTGCCACCACTGAGGGTGG + Intergenic
1013188126 6:107779475-107779497 GATCCTGCTTCCAGTTGGGCTGG - Intronic
1014066613 6:117134388-117134410 GGTGCTGGCTCCAGTGAGCTGGG + Intergenic
1015501638 6:133939978-133940000 GATCCTCCTGACAGTGAGGTAGG - Intergenic
1017184522 6:151587615-151587637 CATCATGCCTGCATTGAGGTTGG + Intronic
1019716401 7:2541381-2541403 GCCCCTGCCTCCAGTGTGGGGGG - Exonic
1022422057 7:30232575-30232597 CTCCCTGCCTCCAGTGAGGCTGG - Intergenic
1024045573 7:45583330-45583352 GATGCTGCCAGCAGTGTGGTGGG + Intronic
1024219079 7:47273744-47273766 CATCCTGTCCCCAGGGAGGTAGG - Intergenic
1031991315 7:128201092-128201114 GAGCCTCCCTTCACTGAGGTAGG + Intergenic
1033595160 7:142854229-142854251 GAACCTCCCTGCAGTGAGGAGGG - Intergenic
1034896146 7:154877757-154877779 GAACCTGCCACCAGTGAGACAGG + Intronic
1035710278 8:1708542-1708564 GATCCTGGCTCCAGTGAGACAGG + Intergenic
1038135237 8:24778254-24778276 TATCCTGCCTGAAGTGAGATGGG + Intergenic
1038536882 8:28359892-28359914 GATCCTGGCTCCTGGGACGTGGG - Intronic
1040486683 8:47879605-47879627 CAGACTGCCTCCAGTGAGGCTGG + Exonic
1041936225 8:63334937-63334959 GATCCTGTATCCAGTGATCTTGG - Intergenic
1046128958 8:109943836-109943858 GATGCTGCCTCTACTGAGGATGG + Intergenic
1054768516 9:69063077-69063099 GTCCCTGCCTCCAGAGAGCTGGG - Intronic
1055424418 9:76179604-76179626 GACCCTGAGTGCAGTGAGGTTGG + Exonic
1056820314 9:89836951-89836973 GATCCTGCCTCTGGCGGGGTGGG + Intergenic
1056932989 9:90893967-90893989 GATGCTGCCTCCAGGAAGCTGGG - Intronic
1057424779 9:94939422-94939444 GATCCTGCCTCGTGTTAGGGAGG + Intronic
1059913549 9:119074016-119074038 GATTCTGCCTCCAGGAAGTTTGG + Intergenic
1060887151 9:127162560-127162582 CCTCCTGGCTCCAGTGATGTGGG - Intronic
1061962624 9:133995760-133995782 GATTTTACCTCCAGTGAGGCGGG - Intergenic
1062229339 9:135472763-135472785 GATGGTGGCTCCAGTGAGGAGGG - Intergenic
1189144577 X:38642840-38642862 AATCCTACCTCCCATGAGGTAGG + Intronic
1189803563 X:44714088-44714110 GGTCCTGCCTGCACTGAGCTAGG - Intergenic
1197724415 X:129767267-129767289 GATTCTGCCTCCAGTAGGTTTGG + Intronic
1199568986 X:149248264-149248286 CATCCTGTCTCCTGTGATGTGGG + Intergenic
1199761896 X:150911288-150911310 GAGCCTGTCACCAGTGAGGCTGG - Intergenic
1199808662 X:151327595-151327617 GCTCCTGGCTCCAGAGAGATGGG + Intergenic