ID: 927742250

View in Genome Browser
Species Human (GRCh38)
Location 2:25582016-25582038
Sequence CTTCACATTAAGAAAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927742250_927742254 -1 Left 927742250 2:25582016-25582038 CCCACCACTTTCTTAATGTGAAG 0: 1
1: 0
2: 2
3: 19
4: 185
Right 927742254 2:25582038-25582060 GAACAGGATATAAAAAATATAGG 0: 1
1: 0
2: 1
3: 46
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927742250 Original CRISPR CTTCACATTAAGAAAGTGGT GGG (reversed) Intronic
905757357 1:40522267-40522289 CTTCACAATCTCAAAGTGGTAGG - Intergenic
908854482 1:68409164-68409186 CTCCACATACAGACAGTGGTGGG - Intergenic
910443524 1:87277540-87277562 ATTCAGATTCAGCAAGTGGTTGG + Intergenic
914459706 1:147872114-147872136 TTTCACAATAAGAACCTGGTGGG - Intergenic
920866522 1:209758175-209758197 CTTTAAATAAAGAAAGTGGCAGG + Intronic
922654793 1:227372587-227372609 CTTTTCATTAAGAAAGTATTAGG - Intergenic
922890458 1:229058036-229058058 CATCACATAAAAAAAGTGTTGGG - Intergenic
1063455698 10:6181342-6181364 ATTCACAGTAACAAAGAGGTGGG + Intronic
1064639941 10:17405581-17405603 CTTAACCTTAAGAAAGTTATTGG + Intronic
1067287283 10:44915740-44915762 CTTGAGATTTAGAAAGTGTTTGG - Intronic
1069026435 10:63547451-63547473 CTTCACACCAAAAAAGGGGTGGG + Intronic
1070183259 10:74035070-74035092 CATTACATTAAAAATGTGGTAGG - Intronic
1070837305 10:79457528-79457550 CTTCTCACTAACAAAGTGGTAGG - Intergenic
1071131258 10:82396174-82396196 CTTCACATTAAGAAAACTCTTGG - Intronic
1072132804 10:92512963-92512985 TTTCACATTTGTAAAGTGGTGGG - Intronic
1079692036 11:23431138-23431160 CTTTACATAAAGAAACTGCTAGG + Intergenic
1081090155 11:38854778-38854800 GATGACATTAAGAAAGTGGAAGG - Intergenic
1081197321 11:40177332-40177354 TTTTACCTTAAGTAAGTGGTGGG - Intronic
1081379483 11:42397158-42397180 CTACAGAATAAGAATGTGGTTGG - Intergenic
1082217766 11:49595502-49595524 CATCACATGACGAAAGTGTTTGG - Intergenic
1087548166 11:99611060-99611082 CATCACATTAAAAAAGTGAATGG - Intronic
1090038296 11:123267806-123267828 CAAAACATTAAGAAAGTGTTAGG + Intergenic
1090242111 11:125191490-125191512 TTTCACTCTAAGAAAGTGGTGGG + Intronic
1092463107 12:8703720-8703742 AGTCACAATTAGAAAGTGGTAGG - Intronic
1093188258 12:16046909-16046931 CTGCACACTTAGTAAGTGGTGGG + Intergenic
1093830158 12:23746245-23746267 CTTGACTTTAAAAAAGTGGAAGG + Intronic
1094431314 12:30372941-30372963 CTTCTCATTATGAAAGAGCTTGG - Intergenic
1095680705 12:44972068-44972090 TTCCAGATTAAGAAAGAGGTGGG - Intergenic
1096212304 12:49776115-49776137 CTGCAAATTAACAACGTGGTTGG + Intergenic
1096552618 12:52383265-52383287 ACCCACATTAAGAAAGTGGAAGG - Intronic
1097649075 12:62273401-62273423 CTTCATATGAATAAAGTGGTTGG - Intronic
1098382064 12:69879907-69879929 CTCCACATGAAAAAAGTTGTCGG + Intronic
1099442381 12:82714076-82714098 TTACACATTTAGAAAGTGGTGGG + Intronic
1106728142 13:32507575-32507597 CTAAACATTAAGAAAATGCTAGG + Intronic
1108246137 13:48516234-48516256 CTTCAGTTTAAGGAATTGGTGGG + Intronic
1108897778 13:55356204-55356226 CTTCAAATAAATAAAGTAGTAGG + Intergenic
1109014103 13:56986370-56986392 CTTCACACTATCAAAGTGTTGGG + Intergenic
1109991858 13:70068899-70068921 CTTCACAGTAAGAACCTTGTAGG - Intronic
1110348705 13:74480259-74480281 CTTCACATTAAAAAATTCTTGGG + Intergenic
1110360190 13:74616001-74616023 TTTCACAGTAAGAACCTGGTAGG - Intergenic
1110526917 13:76548959-76548981 TTTCACTTTGAGACAGTGGTTGG - Intergenic
1111173036 13:84554787-84554809 GTTCACATTAAAAAGCTGGTTGG + Intergenic
1115877283 14:37874884-37874906 CTTCACAGAAAGGAAGTGGTGGG - Intronic
1118185842 14:63538004-63538026 CTTCATATTAAAAACGTGTTGGG + Intronic
1118228355 14:63924999-63925021 CATCACATTAAGAAAGTTTTCGG + Intronic
1118778152 14:68987145-68987167 GTTCAAATAGAGAAAGTGGTAGG - Intergenic
1119342188 14:73888413-73888435 CTTCCCAGTAAGCAACTGGTAGG - Intronic
1119828170 14:77675548-77675570 TTTAACTTTAAAAAAGTGGTTGG - Intronic
1120482519 14:85069810-85069832 CTCTACATTATGAAAGTGGTTGG + Intergenic
1121887254 14:97554897-97554919 TGTCTCTTTAAGAAAGTGGTTGG - Intergenic
1121969497 14:98343472-98343494 CTTCACATTTAAAAAATGATTGG - Intergenic
1124643471 15:31416257-31416279 TCTCACATTAAAAAAGGGGTGGG + Intronic
1126994886 15:54430274-54430296 CTTCAAATTATGAAAGTGTCTGG + Intronic
1134476374 16:14577582-14577604 CCTCACCTTCACAAAGTGGTGGG + Intronic
1135017514 16:18936215-18936237 CTTCAGATTCACAAAGTGTTGGG + Intergenic
1141147031 16:81538167-81538189 CTCCAGATTAGGGAAGTGGTAGG + Intronic
1144492663 17:15727786-15727808 CTTCTCTTTAAGAAAGAGCTTGG - Intergenic
1144658978 17:17056217-17056239 CTTCCCATTCAGAAACAGGTAGG - Intronic
1144907588 17:18648872-18648894 CTTCTCTTTAAGAAAGAGCTTGG + Intronic
1146749576 17:35366103-35366125 CTTCAAATTAAAAAGGTAGTCGG + Intronic
1151887166 17:76929946-76929968 CTTCAGCTTCAGAGAGTGGTGGG + Intronic
1156668799 18:39442002-39442024 CTTCACAGTGAGAAAGTGATGGG - Intergenic
1157934807 18:51861136-51861158 CCCCACATTTAGGAAGTGGTGGG + Intergenic
1158938457 18:62385408-62385430 CTTTACATTAAAAAAGAGGGAGG - Exonic
1162923099 19:13915214-13915236 CTTCACATTAACAAATAGATTGG - Intronic
1164991284 19:32686093-32686115 ATTAATATTAACAAAGTGGTAGG + Intergenic
1166130067 19:40740660-40740682 CTTCAGCTTAAGGAAGAGGTAGG - Exonic
1166146959 19:40844674-40844696 CTTCTCATTCAGGAAGTGCTGGG + Exonic
926295941 2:11568648-11568670 CTTTACAGTCACAAAGTGGTGGG - Intronic
926380856 2:12287795-12287817 CTTGACCTTGAGAAAGTTGTGGG + Intergenic
927041095 2:19231063-19231085 CTTCAAAGTAAGACAGGGGTTGG + Intergenic
927742250 2:25582016-25582038 CTTCACATTAAGAAAGTGGTGGG - Intronic
928380472 2:30813521-30813543 TTCCACAATAAGGAAGTGGTGGG - Intronic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
929727124 2:44441669-44441691 TTTCAAATTTAGAAAGTGCTTGG + Intronic
930286771 2:49439699-49439721 CTTAACATAAAGTATGTGGTAGG - Intergenic
930942974 2:57035842-57035864 GTTCACACTTACAAAGTGGTTGG + Intergenic
932670137 2:73729994-73730016 CTTCACAAGAAGAAAGTATTGGG - Exonic
936266009 2:111007367-111007389 CTTCCCATTAATAAAGTGGTAGG - Intronic
937652786 2:124339137-124339159 CTTTACATAAAGAAAGTTCTTGG + Intronic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
939201869 2:139045839-139045861 CCTCACATTAAGAACTTGGTAGG - Intergenic
939555963 2:143673596-143673618 TTTTACATTAAGATTGTGGTAGG - Intronic
939626443 2:144483249-144483271 TTTCACATTAAGCAAGTAATAGG + Intronic
939807926 2:146796314-146796336 CTGGACATTAAGACAGAGGTAGG + Intergenic
941087883 2:161139275-161139297 GTTAACATTAAGAATGAGGTTGG + Intronic
941489880 2:166130103-166130125 CTCAACATCAAGAAAGTGTTTGG - Intergenic
941704011 2:168638341-168638363 ATTCACATTAAGAAACTGGTTGG + Intronic
942691927 2:178594684-178594706 TGTCACATTAAGAATGTAGTAGG + Intronic
944288927 2:197982340-197982362 CTTAACATTTGGAAAGTGTTTGG - Intronic
946559399 2:220896067-220896089 CTTCATATAGAGAAGGTGGTAGG + Intergenic
948438266 2:237968008-237968030 CTTCCCCTTAAGGAAGGGGTAGG + Intronic
1170435230 20:16319748-16319770 CTTCACAGTGAGAACCTGGTGGG - Intronic
1171011245 20:21510524-21510546 CCTCACGCTAAGAAAGTGGGTGG - Intergenic
1172188837 20:33049383-33049405 CTTTACAGTAAGGAAGGGGTTGG + Intergenic
1173680254 20:44874349-44874371 CTTCACTGTGAGAAACTGGTGGG - Intergenic
949109844 3:246279-246301 CTTGACATTATGAAAATGGATGG + Intronic
951791355 3:26488211-26488233 CTTTAAATTAAGAAACTGGAGGG + Intergenic
958659282 3:97044464-97044486 TTTCACCTTAAGAAAGTTGTAGG - Intronic
960009649 3:112819627-112819649 CTTCACATTAAAGAAGGGGCTGG + Intronic
961302866 3:125933459-125933481 CTTCTCATTGAGACTGTGGTGGG + Intronic
962281154 3:134052947-134052969 CTACACTTTAATAAAGTGGTTGG + Intergenic
962391308 3:134975036-134975058 GTTCTCATTAAGAGAGAGGTGGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964389774 3:156185048-156185070 CCACACAGAAAGAAAGTGGTGGG + Intronic
966691091 3:182742418-182742440 CTTCACATTCCCAAAGTGCTGGG - Intergenic
969065469 4:4476756-4476778 CTTCACAATAAGACAGGGGGAGG + Intronic
970150999 4:13089859-13089881 CATCACTTTAAGTAAGTGGTTGG - Intergenic
971120154 4:23695435-23695457 CTTAACATTAATAAAGAGTTTGG - Intergenic
971908707 4:32764817-32764839 CTTCAGATTAAGAAATGAGTAGG + Intergenic
978014098 4:103722592-103722614 TTTCACATTAAGAAATAGGAAGG + Intergenic
978434204 4:108665856-108665878 ATCCACATTAAGAAAGGGTTGGG - Intronic
979040301 4:115782773-115782795 CTTCACCTTAAGAATGCTGTAGG + Intergenic
979234255 4:118381877-118381899 CTGCTCATTAAGAAAATTGTGGG - Intergenic
980342824 4:131572557-131572579 CTTTACATTAAGAAAATGGGTGG + Intergenic
980896049 4:138861502-138861524 ATTCACATTTAGAAATTAGTTGG - Intergenic
981219846 4:142218890-142218912 CTTCAATTTCATAAAGTGGTTGG + Intronic
981225969 4:142294669-142294691 TTTCACCTTTAGAAAGTGTTAGG + Intronic
981464728 4:145055157-145055179 ATTCACATTAGGCAAGAGGTGGG + Intronic
981505690 4:145496816-145496838 CTTCAAAGGGAGAAAGTGGTAGG - Intronic
983335096 4:166381024-166381046 CTTCCCATTAAGTAAGTCTTTGG + Intergenic
985277723 4:188254782-188254804 CTTCAGATTCACAAAGTGCTGGG - Intergenic
989733631 5:44676601-44676623 CATCACATTTAGAAAGGTGTGGG + Intergenic
991084611 5:62637041-62637063 CTTCACAATGAGAAACTGGTGGG + Intergenic
993521776 5:88911555-88911577 CTTCATATTAATAAACTGTTTGG - Intergenic
995191885 5:109326634-109326656 CTTCACAGCTAGAACGTGGTAGG + Intergenic
1002120994 5:177004901-177004923 CTCCAAATAAAGAAAGTGCTAGG - Intronic
1003712918 6:8613707-8613729 GTTCAGATTAAGAAGTTGGTAGG + Intergenic
1004494774 6:16153263-16153285 CTTCAGATGAAGAAAACGGTAGG + Intergenic
1004855953 6:19750185-19750207 CTGCCCATTCAGAAAGGGGTGGG + Intergenic
1005099428 6:22154096-22154118 CTGCACATTTAGAAAGTTCTAGG - Intergenic
1005466487 6:26120960-26120982 TTTGACTTTAAGAAAGTGTTAGG - Intronic
1008417019 6:51253450-51253472 CTTCCCATTAAGTAAGTTGCTGG + Intergenic
1010021725 6:71168029-71168051 TTACACATTTAGAAAGTGTTAGG + Intergenic
1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG + Intergenic
1011468318 6:87681801-87681823 TTTCACATTAAAAAAGAGGTTGG + Intronic
1011491751 6:87900341-87900363 CTTCCCATTAGGTAATTGGTAGG + Intergenic
1011520316 6:88197235-88197257 TTTCACTTGAAGAAAGTAGTTGG + Intergenic
1012345763 6:98183719-98183741 CTTCACCATAAGAAACTGCTAGG + Intergenic
1012356115 6:98316485-98316507 CTTCACATTTAGAAACATGTTGG + Intergenic
1013166830 6:107601969-107601991 TTGCACATTAAGAAAGTTATTGG + Intronic
1013631060 6:111986421-111986443 CAGCACATTAATAAAGTGGCAGG - Intergenic
1013969155 6:115995259-115995281 TTTCAGATTAAGATAGTGGCTGG - Intronic
1015436150 6:133191410-133191432 CTTCACTTTGAGAAAGTTTTTGG - Intergenic
1016083254 6:139881149-139881171 CTTGACATTGAGAGAGTGTTAGG - Intergenic
1018801928 6:167229647-167229669 CTTCACATTACGAGAGAGCTTGG + Intergenic
1019845852 7:3500065-3500087 CTTCAGGTTAAAAAGGTGGTTGG + Intronic
1019892910 7:3960852-3960874 CTTCACATTCACAGAGTTGTTGG - Intronic
1021314595 7:19131579-19131601 TTTCAGCTTAAGAAAGTCGTTGG - Intergenic
1022002915 7:26243113-26243135 ATTCATATTCAGAAAGTTGTAGG - Intergenic
1022974352 7:35543955-35543977 CTTCACTATCAGAACGTGGTAGG - Intergenic
1024370375 7:48576398-48576420 CTTCACATGGAGAATCTGGTAGG - Intronic
1026094120 7:67328132-67328154 CTTCATATTAAGAAACTGTTTGG + Intergenic
1026799775 7:73392603-73392625 CTTTACATTAAGAAAATCTTGGG - Intergenic
1027502731 7:78974079-78974101 TTTCAAATTTAGAAAGAGGTAGG - Intronic
1029498853 7:100915090-100915112 CTCCACTTAAAGAAAGTGGTGGG - Intergenic
1029859601 7:103555422-103555444 CTTCTTGTTTAGAAAGTGGTTGG + Intronic
1030008564 7:105142485-105142507 CTTCACCTTAAGAATTTGATGGG + Exonic
1030975844 7:116122139-116122161 CTTGGCATTAAAAAAGTGTTTGG + Intronic
1032810656 7:135412730-135412752 CTTCTCATTTAGAAGGTGGGGGG - Intronic
1033134074 7:138770126-138770148 CTTCCTATTAAGAAAGTGAAAGG - Intronic
1034366519 7:150553933-150553955 CTACAATTTAAGAGAGTGGTTGG - Intergenic
1036121054 8:6018221-6018243 ATTCAGATGAAGAAAGTGGCAGG + Intergenic
1040730582 8:50442347-50442369 CTTCACTTAAAGACAGTGGAGGG - Intronic
1041443838 8:57928495-57928517 CTACATATTAAAATAGTGGTGGG + Intergenic
1042091342 8:65162881-65162903 CTTAACATTTATAAAGTGTTTGG + Intergenic
1042497886 8:69475909-69475931 TCTCAGATTAAGAAAATGGTTGG + Intronic
1042659674 8:71140849-71140871 CCTCACATGATGAAAGGGGTGGG + Intergenic
1043931098 8:86092583-86092605 CTTCTTTTTAAGAAACTGGTGGG - Intronic
1044564899 8:93652440-93652462 CTTCACAGTAAGAACCTAGTTGG + Intergenic
1044931648 8:97257740-97257762 TTGCAGATGAAGAAAGTGGTAGG + Intergenic
1045303627 8:100937170-100937192 TTTCAGATTTAGAAAGAGGTTGG - Intronic
1045333808 8:101180451-101180473 CTTAACATGAAGACAGTGGTGGG - Intronic
1045698596 8:104839580-104839602 TTACACAATAAGAAAGTGATTGG - Intronic
1045707408 8:104942086-104942108 CTTCACATTGGGAACTTGGTGGG + Intronic
1046045539 8:108959987-108960009 CTTCAAATTAAGTAAGTTATGGG - Intergenic
1046925524 8:119783093-119783115 CTTCGCTTTAAAAATGTGGTTGG + Intronic
1047810704 8:128405713-128405735 CTTCACCTTAAGAGAGTGCCGGG - Intergenic
1047978335 8:130153895-130153917 TTAAAAATTAAGAAAGTGGTTGG + Intronic
1049318195 8:141980899-141980921 CATCACTTCTAGAAAGTGGTGGG - Intergenic
1050104851 9:2155107-2155129 CTTCACATTTATAATTTGGTAGG + Intronic
1051671094 9:19511557-19511579 CTTGTCATTAAGAGAGGGGTAGG - Exonic
1053582646 9:39423077-39423099 CTTCACATAAAGAAAATGCCAGG - Intergenic
1053846827 9:42247922-42247944 CTTCACATAAAGAAAATGCCAGG - Intergenic
1054104225 9:60981820-60981842 CTTCACATAAAGAAAATGCCAGG - Intergenic
1054582119 9:66925030-66925052 CTTCACATAAAGAAAATGCCAGG + Intronic
1055527213 9:77147094-77147116 TTTCACATGAACAAAGTTGTAGG - Intergenic
1060842958 9:126809495-126809517 CTTCACAATAAGTAGCTGGTGGG + Intronic
1188165053 X:26852225-26852247 CTTCTCATAAAGAAAGTCATAGG - Intergenic
1188831368 X:34902007-34902029 CTTCACATTATGAATGATGTAGG + Intergenic
1191014457 X:55793405-55793427 CTTCATATTAAGAAATGTGTGGG - Intergenic
1193261526 X:79412188-79412210 ATTCACATGAAGGATGTGGTAGG - Intergenic
1194063363 X:89232471-89232493 ATTCACATAAAGAAAGGGGCAGG - Intergenic
1194184747 X:90762008-90762030 AATCAAATTAAGAAAGAGGTTGG - Intergenic
1194928694 X:99861314-99861336 CTTCACATCACTGAAGTGGTGGG + Intergenic
1195232443 X:102863955-102863977 CATCACAGTAGGAAAGTGGGAGG + Intergenic
1195233890 X:102878088-102878110 CTTCACATTGAGGAAGAGGATGG - Intergenic
1195251292 X:103050835-103050857 CTTCACTGTGAGAAACTGGTAGG + Intergenic
1195287358 X:103398035-103398057 CTTCACATCAAGGAAGAGGACGG - Intergenic
1196695973 X:118612146-118612168 CTTCATATTAAGAACCTTGTGGG + Intronic
1197034375 X:121856015-121856037 CTTCACAGTGAGAACATGGTAGG + Intergenic
1197908871 X:131458379-131458401 CTTCAGAGTAAGAAAATAGTCGG + Intergenic
1198610727 X:138396756-138396778 CTTCACATTAGGAAAGGCGGGGG - Intergenic
1200531352 Y:4344015-4344037 AATCAAATTAAGAAAGAGGTTGG - Intergenic
1200717537 Y:6566583-6566605 ATTCACATAAAGAAAGGGGCAGG - Intergenic
1202019029 Y:20445157-20445179 CTTCATATTAAAAAACTGGTGGG + Intergenic
1202626341 Y:56863010-56863032 CTTCCCATAAAGAAATTTGTAGG + Intergenic