ID: 927745075

View in Genome Browser
Species Human (GRCh38)
Location 2:25611555-25611577
Sequence CTGCAGATACAGAGGGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 2, 1: 0, 2: 7, 3: 22, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927745062_927745075 30 Left 927745062 2:25611502-25611524 CCTCTAGAGTTGGCCCTCCATAT 0: 1
1: 0
2: 2
3: 20
4: 80
Right 927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG 0: 2
1: 0
2: 7
3: 22
4: 227
927745066_927745075 16 Left 927745066 2:25611516-25611538 CCTCCATATCCATGGGTGTCTGA 0: 1
1: 0
2: 1
3: 31
4: 212
Right 927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG 0: 2
1: 0
2: 7
3: 22
4: 227
927745065_927745075 17 Left 927745065 2:25611515-25611537 CCCTCCATATCCATGGGTGTCTG 0: 1
1: 0
2: 6
3: 38
4: 306
Right 927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG 0: 2
1: 0
2: 7
3: 22
4: 227
927745071_927745075 -9 Left 927745071 2:25611541-25611563 CCACACATGGGAATCTGCAGATA 0: 1
1: 0
2: 1
3: 16
4: 169
Right 927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG 0: 2
1: 0
2: 7
3: 22
4: 227
927745068_927745075 7 Left 927745068 2:25611525-25611547 CCATGGGTGTCTGAATCCACACA 0: 1
1: 0
2: 8
3: 30
4: 275
Right 927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG 0: 2
1: 0
2: 7
3: 22
4: 227
927745067_927745075 13 Left 927745067 2:25611519-25611541 CCATATCCATGGGTGTCTGAATC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG 0: 2
1: 0
2: 7
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927745075 Original CRISPR CTGCAGATACAGAGGGCCAA GGG Intronic
900534654 1:3170857-3170879 CTGCAGACAGAGAAGGCCATGGG - Intronic
900830092 1:4959736-4959758 ATACACATACAGAGGGCCCAAGG - Intergenic
901196997 1:7445794-7445816 CTGCTGCTACAGAGGGCCAGGGG + Intronic
902192783 1:14775181-14775203 ATGCAGAGAGTGAGGGCCAAAGG + Intronic
902327998 1:15715200-15715222 CTGCATATACTAAGGGCCGATGG - Intronic
904329773 1:29751003-29751025 TTTCAGATGCAGAGGGCCCATGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
905028849 1:34868350-34868372 CTGCAGACACTGCAGGCCAAAGG - Intronic
905280173 1:36844071-36844093 CTGCTGGGAGAGAGGGCCAAAGG - Intronic
907221427 1:52909826-52909848 CTGCAGATGCAGAGGGCTGACGG + Intronic
907976509 1:59436179-59436201 GTGCAGATAGAAAGGGGCAAGGG - Intronic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
909372108 1:74895963-74895985 CTGCCGAAACAGAAAGCCAATGG - Intergenic
909990525 1:82217807-82217829 GTGCAGATGGAGAGGGGCAAGGG - Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
912736402 1:112153013-112153035 CTCCAGATACAGAGGGGACAGGG + Intergenic
913529258 1:119721898-119721920 CTGCAGAAACACAGGGGCAGAGG + Intronic
914505652 1:148286902-148286924 CTGCAGATACAGTGGGAAAATGG + Intergenic
916194288 1:162209147-162209169 TTGCAAATACAGAGGCCCCATGG - Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
918674599 1:187267253-187267275 CTGCACATTCTGAGGGCCTAAGG + Intergenic
920097054 1:203493045-203493067 CCACAGATACAGAGGGCCAACGG - Intergenic
920329036 1:205191657-205191679 CTGCAGTTATAGTGGTCCAAGGG - Intronic
920340137 1:205270487-205270509 CTGCAGAGGCACAGAGCCAAGGG - Intronic
921982753 1:221275886-221275908 CTGCACATAGAAAAGGCCAAAGG - Intergenic
1067057868 10:43062823-43062845 CTGCAGACACAGAAGTCCCAGGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1069519367 10:69106318-69106340 CTGTAGATTCAGAGGTTCAAAGG - Intergenic
1069566387 10:69466086-69466108 CTGCAGCTCCAGAGAGCCAGTGG - Intronic
1071808595 10:89152658-89152680 CCACAGATGCAGAGGGACAAAGG - Intergenic
1073942438 10:108713876-108713898 CTGAAAAGACACAGGGCCAAAGG + Intergenic
1075679536 10:124322517-124322539 TTGCAGAGATAGAGAGCCAAGGG - Intergenic
1077523116 11:3048002-3048024 CTGCAAAGACAGAGGGCACATGG + Intronic
1078466164 11:11552163-11552185 CTGCATTTCCAGAGGGCCTATGG - Intronic
1079133030 11:17760600-17760622 CAGCAGGTACAGAGGGCCCTAGG - Intronic
1079495465 11:21038445-21038467 ATACAGAAACAGAAGGCCAAGGG + Intronic
1084424127 11:69075260-69075282 CTGCAGATACCGAGGGGCAACGG - Intronic
1084534368 11:69748038-69748060 CTGCAGAAGCAAAGGGCCTAGGG - Intergenic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1087464362 11:98486289-98486311 CCATAGATACAGAGGGCTAATGG - Intergenic
1088507573 11:110541410-110541432 CTTCAGCTACAGAAGGGCAAAGG + Intergenic
1089169911 11:116504752-116504774 CTGCAGACACACAGCGCCCAGGG - Intergenic
1094846160 12:34362284-34362306 CCGCACATGCACAGGGCCAAGGG - Intergenic
1097757282 12:63420518-63420540 CTCCAAATACAGAGTTCCAAAGG + Intergenic
1098129445 12:67333674-67333696 CAACAGATACAAATGGCCAATGG - Intergenic
1098634086 12:72759120-72759142 TTGCAGAAACAAAAGGCCAAAGG + Intergenic
1099829456 12:87821886-87821908 TGGCAGATTCAGAAGGCCAAGGG + Intergenic
1102785569 12:115601495-115601517 CTGCACATGCAGAGGTCCCAGGG - Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104509297 12:129361454-129361476 CTGCAGAAATAAAGGGCAAATGG + Intronic
1105349758 13:19604408-19604430 CTGCACCCACAGAGGACCAAAGG - Intergenic
1106590464 13:31094112-31094134 CTGCAGATACCCAGATCCAAGGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1108915027 13:55597926-55597948 CTCCAGATACAGAGAGACAATGG - Intergenic
1110275365 13:73636007-73636029 CTGCACATGCAGACAGCCAAAGG + Intergenic
1111515631 13:89327311-89327333 CTTGAGATCCAGAGAGCCAATGG + Intergenic
1111531308 13:89541232-89541254 CTAGAGATACAGTGGGTCAAGGG + Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114459337 14:22876898-22876920 CCTCAGAGTCAGAGGGCCAAAGG - Intronic
1114624885 14:24122536-24122558 CTGCAGATACAAGGAGCCTAAGG + Intronic
1117056746 14:51919973-51919995 CAACAGATACAGAGGGACAACGG - Intronic
1118147655 14:63157609-63157631 CTGGAGAAATCGAGGGCCAAGGG + Intergenic
1118246930 14:64120206-64120228 CTGCAGATACATAGGCCATATGG + Intronic
1119427511 14:74545457-74545479 CTGGAGATACAGAGGGCCCTGGG + Intronic
1122388860 14:101366687-101366709 TTGCAGACACAGAGGGCGATTGG + Intergenic
1122878322 14:104678887-104678909 CTGCAGAAACTGAGGCTCAAAGG + Intergenic
1122996248 14:105266611-105266633 CCGCAGATACATAGAGCGAAGGG + Intronic
1123029593 14:105445406-105445428 TTGCTGTTACAGACGGCCAATGG + Exonic
1123095620 14:105765782-105765804 CTGCAAAGACAGAGAGCCATGGG + Intergenic
1126156063 15:45566641-45566663 CTTCAGACCCAGAGGGCCAAGGG - Intergenic
1127209310 15:56756686-56756708 TTGCAGATATTGAGGGACAATGG - Intronic
1129066920 15:72912839-72912861 CTTCAGAAACCGAGGGCCATTGG - Intergenic
1129767685 15:78180738-78180760 CGGCAGGTACAGAGGGCCCACGG - Exonic
1132170676 15:99650853-99650875 CTGCAGATTCAGAAGGTCTAAGG - Intronic
1132246051 15:100297160-100297182 CAGCATATACACAGGGCCCAGGG + Intronic
1137710305 16:50562297-50562319 CTGCAGATACACAGTGACACAGG - Intronic
1140739988 16:77932917-77932939 CTACAGAAACAGAGGGACATTGG + Intronic
1143081303 17:4383360-4383382 ATGCAGATACACAGGGATAAAGG + Intergenic
1143796838 17:9343760-9343782 CGGCAGATGGGGAGGGCCAAGGG - Intronic
1144297850 17:13896124-13896146 CCACAGATACGGAGGGCCCATGG + Intergenic
1144578241 17:16443388-16443410 GGGCAGATGCAGAGGACCAACGG + Exonic
1144864850 17:18328883-18328905 CTGCAGATCCAGAGCGACACTGG - Exonic
1145065991 17:19761854-19761876 CTGCAGCTGCAGAGGCCCACGGG - Intergenic
1147768325 17:42851460-42851482 TGGGAGATACAGAGGGGCAATGG - Exonic
1148720020 17:49745121-49745143 CCACAGATACAGAGGGCTGATGG + Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1157498501 18:48172871-48172893 CTGCAGAGACAGAGGAGCACAGG + Intronic
1158998782 18:62951536-62951558 CTTCAGATCCTGAGGGCAAAGGG + Intronic
1159831669 18:73284931-73284953 CTTCAGAGAAACAGGGCCAATGG + Intergenic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1165996434 19:39847089-39847111 CTGCAGATGCAGAGGCCCTGAGG + Intergenic
1167221737 19:48203859-48203881 CAGGAGATACAGGTGGCCAATGG - Intronic
925846917 2:8043039-8043061 CTGCAGGGACAGAGGGGCCATGG + Intergenic
925923228 2:8652146-8652168 CTGCATATGCAGAGGGCCTCAGG + Intergenic
926502066 2:13668052-13668074 ACGCAGATACAGATGGACAATGG + Intergenic
927024481 2:19051366-19051388 CTGCTGACACACAGAGCCAAGGG - Intergenic
927355864 2:22172354-22172376 CCACAGATACAGAGGGCCAATGG + Intergenic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
928368714 2:30723255-30723277 GTGCAAATGCAGAGGGCCAAGGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929049101 2:37819446-37819468 CAGCAGATACAGCTGCCCAATGG - Intergenic
929367140 2:41173419-41173441 TTGCAGAAACAGAGATCCAAAGG + Intergenic
929997908 2:46840523-46840545 CAGCACATGCAAAGGGCCAAAGG - Intronic
930023130 2:47013335-47013357 CTTCAGATACAGGTGGCCCATGG + Intronic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935623290 2:105147112-105147134 ATGCAGATACAGAGGGTTAGGGG + Intergenic
936041032 2:109149651-109149673 CTGCTGCCACAGAGAGCCAAAGG - Intronic
936610057 2:113993540-113993562 CTACAGAGACAGAGGTCCAGTGG - Intergenic
937145303 2:119639142-119639164 CTGCAGCAGCAGTGGGCCAAGGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938307108 2:130263851-130263873 CTGCAATTACAGTGGGCCAGTGG + Intergenic
941686901 2:168456575-168456597 ATGAAGATACAGAAGGCCAGGGG - Exonic
942684832 2:178520278-178520300 CTGCAGAGACCTAGGGGCAAAGG - Intergenic
943304721 2:186245890-186245912 CTGCAGCTAGAGATGGCTAAAGG - Intergenic
943959963 2:194251550-194251572 CTTCAGATCCAGAGGGCCTTTGG + Intergenic
944994398 2:205277623-205277645 CGGCAGATGCAGAGACCCAATGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947153372 2:227136453-227136475 CTGCAGCTGGAGAGGGTCAAAGG + Intronic
948084004 2:235231281-235231303 CTAAAGATTCAGATGGCCAAGGG - Intergenic
948634899 2:239328760-239328782 CTGGAGATAAAGAGGGCCAGCGG - Intronic
1169717235 20:8633529-8633551 CTGTAGATAGAGATGTCCAAGGG + Intronic
1169734212 20:8820167-8820189 CAGCAGATACAGAGAACCCATGG + Intronic
1169854687 20:10089966-10089988 CTGCAGAGCCAGGGGGCCTAGGG + Intergenic
1170052927 20:12166503-12166525 CTGCAGAAACTGCTGGCCAATGG - Intergenic
1170283014 20:14672500-14672522 CTGCAGAGTCATATGGCCAAGGG + Intronic
1171299274 20:24045534-24045556 CTGCAGATGCAGTAGTCCAATGG - Intergenic
1172637967 20:36422735-36422757 CTGCAGACACAGAGGCACCATGG + Intronic
1172991332 20:39039109-39039131 CTGCAGATAAACAGGGACAAGGG - Exonic
1174044500 20:47723983-47724005 CTGCACATACAAAGGGCCTGGGG + Intronic
1175015888 20:55790264-55790286 CTGCAGAGAAAGAGGGCAATAGG + Intergenic
1175548067 20:59792521-59792543 GTGCAGATCCAGTTGGCCAAGGG + Intronic
1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG + Intronic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177732658 21:25048399-25048421 ATAGAGATACAAAGGGCCAATGG + Intergenic
1177760574 21:25398577-25398599 CAGCAGACACAGAGGGCCTGAGG + Intergenic
1179026443 21:37682842-37682864 CTGCAGGGACAGATGGCCCAGGG - Intronic
1180704493 22:17800753-17800775 ATGCAGGCACAGAGGGGCAAGGG + Intronic
1180928383 22:19572053-19572075 TTGCAGAGACAGAGGGGCCAAGG - Intergenic
1181508092 22:23375232-23375254 CTGCAGATACGGACCCCCAATGG - Intergenic
1182774263 22:32819256-32819278 CTGCAGATCCCCAGGACCAAAGG + Intronic
1183892651 22:40942798-40942820 CCACAGATACAGAGGACCAGAGG + Intergenic
1184372083 22:44089091-44089113 CTCCAGAGACAGTGTGCCAAGGG + Intronic
1184428873 22:44429362-44429384 CCGCTGATGCAGAGGGACAAAGG - Intergenic
1185144475 22:49123569-49123591 GAGCAGATACAGAGGGTGAACGG - Intergenic
950887087 3:16372034-16372056 CTGCAGCTACCGAGGGCAAGAGG + Intronic
951867387 3:27323350-27323372 CTGCAGGCACAGAGAGCCAGTGG - Intronic
954292944 3:49659290-49659312 CTGCAGGCACAGAGGTCCCATGG + Intronic
954749591 3:52806080-52806102 CTGCAGATACAAAGGGAGAGAGG - Intronic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
958428960 3:94015174-94015196 CTACAGAAACAGAGGAACAAGGG - Exonic
959749008 3:109811188-109811210 CTGCATATATGGAGGGCCAGAGG + Intergenic
961071722 3:123936038-123936060 CTGCAGATACAGAAGATAAAGGG - Intronic
962767373 3:138578126-138578148 CTGCAGATAAGGAGGGCCAACGG - Intronic
966627369 3:182032864-182032886 CTTCTGATGCAGATGGCCAATGG - Intergenic
966802027 3:183773166-183773188 CCACAGATACAGAGGGCCAATGG + Intronic
969609023 4:8216812-8216834 CTGCAGGCACAGAGACCCAAAGG - Intronic
969694603 4:8727599-8727621 CTGCAGAGTCAGAGGGCTCAGGG + Intergenic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
970318725 4:14854857-14854879 CCACAGATACAGAGGGCCAATGG + Intergenic
970859373 4:20684122-20684144 CTGAAGATAAAGAAGGCTAAGGG + Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
971876322 4:32313571-32313593 TTGCAGACACAGAAGGACAATGG + Intergenic
973012990 4:45100654-45100676 CTGGAGAGTCAGAGAGCCAATGG - Intergenic
975450909 4:74525497-74525519 GTGCAGATACAGAGATCCAGAGG - Intergenic
976468211 4:85395855-85395877 GTGCAGATAGAGAGGCCAAAAGG - Intergenic
977525415 4:98140171-98140193 CAGCAGATACAGAGGCACAGAGG + Intronic
978555393 4:109973915-109973937 CTGTAGATAAACAGGGCCAATGG - Intronic
978844976 4:113262551-113262573 CTACTGATACAGAGGGCCGATGG - Intronic
985255026 4:188061358-188061380 CTGCAGAAACAGAGGCCCGCTGG - Intergenic
985780803 5:1869789-1869811 CTGCACCTACAGAGGGCCCCGGG - Intergenic
985911179 5:2884520-2884542 GTGCGGATACAGAGGGGCATAGG - Intergenic
986314527 5:6577665-6577687 ATGCATATTCAGAGGGCCCATGG - Intergenic
986920213 5:12671255-12671277 CTGGAAATACAGAGGGCCGTCGG - Intergenic
988684049 5:33511103-33511125 ATGCAGATACAGATGGTCCAAGG - Intergenic
990193823 5:53290585-53290607 CTGCAAGGGCAGAGGGCCAATGG - Intergenic
990976332 5:61564777-61564799 CTGCAGCCACAGAGGGCCATGGG + Intergenic
991569063 5:68035490-68035512 CCGCAGCTACAGAGAGCCAGAGG + Intergenic
991581898 5:68164333-68164355 CTGCAGATACAGTGTGACAACGG + Intergenic
993884556 5:93400300-93400322 CTGCAGACACAGACGGCCACTGG - Intergenic
994043916 5:95286486-95286508 CAGCAGATACAGAGGTCCTGAGG + Intergenic
994728739 5:103466654-103466676 CTCAAGATACACAGTGCCAAGGG + Intergenic
995215407 5:109589301-109589323 CTGCAGATGGAGAAGGTCAATGG + Intergenic
997147945 5:131457780-131457802 CCACAGATACTGAGGGACAATGG + Intronic
998565788 5:143214794-143214816 CTGCTGACCCAGAAGGCCAAGGG - Intronic
998906101 5:146906998-146907020 CTGCAGGGACAGAGGCCTAAAGG + Intronic
999257011 5:150215343-150215365 CAGCAGATTCAGAGGGGCCATGG - Intronic
999666478 5:153917737-153917759 CAGGAGAGACAGAGAGCCAAGGG - Intergenic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
1000416044 5:160984771-160984793 CTGCAGCTACACAGTGCCAAAGG - Intergenic
1001094817 5:168767991-168768013 ATGCAGATACAGAGGGAAATGGG - Intronic
1001651675 5:173320334-173320356 CTGGAGAGAGAGAGGGCCAAGGG - Intronic
1002407467 5:179047054-179047076 CTGCAGAGACAGAGATCCAGGGG - Intergenic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1004248717 6:14004515-14004537 ATGCAGACACAGAGAGCAAAGGG - Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1004878727 6:19984076-19984098 CTGTGGATAGAGAGGGTCAAAGG - Intergenic
1008826699 6:55703138-55703160 CTGCAGATAGAGAAGGACTAGGG - Intergenic
1008920476 6:56839097-56839119 CTGCAGATAGAGATGGCCCCTGG + Intronic
1010122849 6:72399030-72399052 CTGCTGATACAAAGGATCAAGGG - Exonic
1013918603 6:115371755-115371777 CTGATGATCCACAGGGCCAAAGG + Intergenic
1014400322 6:120981045-120981067 CTGCAGATTCCAAGGGACAATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018360800 6:163065553-163065575 CTGCAGCCACAGGGGGCCATGGG + Intronic
1018661050 6:166087699-166087721 CTGCAGATACAGGGGGTCTCAGG + Intergenic
1020985020 7:15122345-15122367 CTGCAGATACAGAAGTACACAGG - Intergenic
1020989750 7:15182264-15182286 CTGCAGATAGACAGTGCTAATGG + Intergenic
1021311301 7:19101150-19101172 CTGCACATTCAAAGGTCCAAGGG - Intronic
1021530979 7:21644659-21644681 CTGCAGGTAAATAGAGCCAATGG - Intronic
1022236516 7:28467005-28467027 CTGGAGGGACAGGGGGCCAAGGG + Intronic
1023490053 7:40730024-40730046 CTGCTAATACAGAGGGTCCAGGG + Intronic
1023530431 7:41147991-41148013 GTGCAGTTACATATGGCCAAGGG - Intergenic
1024709093 7:51995540-51995562 CTGGTGATACTGTGGGCCAAGGG + Intergenic
1026921961 7:74162345-74162367 CTGCAGAGACAGAGGGGCACTGG + Intergenic
1027736588 7:81939962-81939984 CCTGAGATACAGAGGGCAAAAGG + Intergenic
1027892193 7:83991591-83991613 CAGCATATAAAGAGAGCCAAAGG - Intronic
1028481169 7:91306981-91307003 TTTCAGATACAGAGGGCTATGGG - Intergenic
1029147759 7:98458772-98458794 ATGCAGAGACAGAGAGGCAAAGG - Intergenic
1033482854 7:141759429-141759451 CTGTGGATACGGAGGGCCAGTGG - Intronic
1035090258 7:156304556-156304578 CTGCAGATACAGAGCGAGAACGG - Intergenic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035207242 7:157301828-157301850 GTGAGGACACAGAGGGCCAAGGG - Intergenic
1035974527 8:4292991-4293013 CTTCAGGTGCAGAGGGGCAAGGG + Intronic
1037922098 8:22814679-22814701 CTGCAGACAGAGAGGGACCATGG - Intronic
1038047573 8:23778998-23779020 CTTCAGATAAAGAGGGACGACGG + Intergenic
1041081368 8:54218141-54218163 CAGCAGACCCAGTGGGCCAATGG + Intergenic
1042706738 8:71671284-71671306 CTGCAGAAACAGAGTGCCTCTGG - Intergenic
1045439648 8:102197033-102197055 CTCCACATACCCAGGGCCAAAGG + Intergenic
1046143988 8:110133290-110133312 CTGCAGAGAAAGAGAGTCAAAGG + Intergenic
1046283219 8:112060928-112060950 AGGCAGAAACAGAGGGGCAAAGG - Intergenic
1047830156 8:128620811-128620833 CCACAGATACAGAGGGACAATGG - Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1048962371 8:139591169-139591191 TTGCAGATGCAGAGGTACAAAGG + Intergenic
1049339852 8:142106261-142106283 ATGCAGAAACAGAGGGACACAGG + Intergenic
1051507959 9:17846201-17846223 CTGCAGAAAGAGAGGGGGAAAGG - Intergenic
1053161807 9:35818622-35818644 CTGCAGATACAGGGGCCCTCTGG - Intronic
1054931301 9:70638130-70638152 CAGAAGAGACAGAGGGCAAAAGG - Intronic
1057215994 9:93229107-93229129 GTGCAGACACAGTGGCCCAAGGG + Intronic
1058473477 9:105305447-105305469 CTTAAGATACAGAGGGCTATTGG - Intronic
1059426146 9:114222200-114222222 CTGCAGATAGAGAGAGACCAAGG - Intronic
1060188381 9:121577463-121577485 CTGCCGAGACAGAGGCCCACTGG - Intronic
1061375162 9:130219816-130219838 CTGCTGCCACACAGGGCCAAGGG - Intronic
1186991110 X:15069162-15069184 CCTCAGCTACACAGGGCCAAAGG + Intergenic
1187084440 X:16027560-16027582 CCACAAATACAGAAGGCCAACGG - Intergenic
1187313920 X:18174187-18174209 CTGCAGATAGAAATGACCAAAGG - Exonic
1188024179 X:25191509-25191531 TTGCAGATGCAGGGGACCAAAGG + Intergenic
1188451850 X:30315766-30315788 CTGCAGATATACAAGCCCAACGG + Intergenic
1192227286 X:69238140-69238162 CTGCAGAAACGGAGGCCAAATGG + Intergenic
1195495378 X:105525884-105525906 CTGCAGATGCAGGGTGCCATGGG - Intronic
1196409847 X:115406785-115406807 CTGCAGAAACAGAGCCACAAAGG - Intergenic
1198521868 X:137461195-137461217 CTGCAGATTCAGTAGGCAAAAGG + Intergenic
1198577485 X:138026033-138026055 CTGGTGATGCAGAGGGTCAAGGG - Intergenic
1199155017 X:144536784-144536806 CTGCAGAGGCAGAGGCCCCATGG - Intergenic
1199713977 X:150492820-150492842 CTGTAGATGAAGAGGCCCAATGG - Intronic
1200353718 X:155526250-155526272 CTGCTGAGACACAGAGCCAAAGG - Intronic
1200834889 Y:7723778-7723800 CTGCAGCTACCGAGGGCAAGAGG + Intergenic
1200931754 Y:8703225-8703247 CTGCAGAAACACACAGCCAAGGG - Intergenic
1202193622 Y:22272526-22272548 CTGAAGATCCAGAGGGCACATGG + Intergenic