ID: 927745330

View in Genome Browser
Species Human (GRCh38)
Location 2:25614653-25614675
Sequence TACTATGTTCATAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927745330 Original CRISPR TACTATGTTCATAAAATGGA AGG Intronic
900754002 1:4420868-4420890 TACAATGTTAATCAAATGGGGGG + Intergenic
901393115 1:8960443-8960465 AACTATGTTCAAAGAATTGAAGG + Intronic
903379700 1:22887977-22887999 TCCCATGTTCATTAAATGGATGG - Intronic
903937382 1:26905841-26905863 TTCTTTGTCTATAAAATGGATGG + Intronic
906549374 1:46649961-46649983 TACCATGTTCATGGATTGGATGG - Intronic
907662648 1:56407429-56407451 GACTATGCTCATAAGATTGAAGG - Intergenic
907947474 1:59148430-59148452 TACTATTTTCATAAGTTGGTGGG + Intergenic
908371498 1:63484100-63484122 TACTTTGTTTAAAAAAAGGATGG + Intronic
909495820 1:76277447-76277469 TTCTATATTCAAAAAATAGATGG + Intronic
910240164 1:85077978-85078000 TACTATGTGCACACAATAGAAGG - Intronic
910246923 1:85148890-85148912 TACCATTTCCATAAAAGGGAGGG + Intergenic
910296294 1:85648901-85648923 TACCATGTTCATGAATTGAAAGG + Intergenic
911441473 1:97932108-97932130 TACTATTATCATAAAAGGCAGGG - Intergenic
911924178 1:103806686-103806708 TACTATCTTTAAAAAATGAATGG - Intergenic
917058387 1:171009326-171009348 CACTATGTTCATAAGCTGCATGG - Intronic
918777259 1:188649614-188649636 TACTATTTTTACAAAATGAAAGG - Intergenic
918827680 1:189346870-189346892 TGCTATATTTATAAACTGGAAGG + Intergenic
918903848 1:190464330-190464352 TACTTTGTTCAAAAAATTTAAGG - Intronic
921327510 1:214001109-214001131 TACTTTGTTCAAAAAACAGATGG - Intronic
921711957 1:218381714-218381736 TGCGATGTTCCTAAAAGGGAAGG + Intronic
922437791 1:225623538-225623560 TACTATGTTCACAACTTGGGGGG - Intronic
922780338 1:228247319-228247341 TTCCATGTCCATAAAAAGGAGGG - Intronic
922954450 1:229587416-229587438 TACAATCATCATAAAAGGGAGGG - Intergenic
923062944 1:230493125-230493147 TACTATGTTTATGAATTAGAAGG + Intergenic
923239333 1:232065936-232065958 TACGATTTTCATAAAGTGGAAGG + Intergenic
923813886 1:237352469-237352491 TACCATGTTCATATATTGGGAGG + Intronic
924126459 1:240858111-240858133 TGGTATATTCATACAATGGAAGG - Intronic
924768639 1:247058447-247058469 TTCTAGTTTCTTAAAATGGAAGG - Intronic
1063531962 10:6841781-6841803 AACTATATTCATATCATGGAGGG + Intergenic
1064850563 10:19704788-19704810 TACTTTGGTGGTAAAATGGAAGG + Intronic
1065351749 10:24802000-24802022 TACTTTGTTCATAATTTGGCTGG + Intergenic
1066173550 10:32878955-32878977 TATTTTATTCATAAAATGTATGG + Intronic
1067491219 10:46705407-46705429 TATTATTCTTATAAAATGGAAGG + Intergenic
1067603447 10:47634973-47634995 TATTATTCTTATAAAATGGAAGG - Intergenic
1068627118 10:59261558-59261580 TACTATGTGCAGAAAAGGGGAGG + Intronic
1068800022 10:61130193-61130215 TTCTTTGTGTATAAAATGGAAGG - Intergenic
1069235168 10:66062087-66062109 TTCTTTATTAATAAAATGGAGGG + Intronic
1070072909 10:73107001-73107023 TCCCATGTTCATAAATTGGAAGG - Intergenic
1070644569 10:78192711-78192733 TACTTTGCTTATAAAATGAAAGG - Intergenic
1071323888 10:84492323-84492345 TACTAAGTTCACAAAATACAAGG - Intronic
1073283421 10:102371447-102371469 TACTATGTTCATGGATTGGAAGG + Intronic
1076045252 10:127287974-127287996 AACTTTTTTCATAAAATAGATGG + Intronic
1076160462 10:128240531-128240553 TGCTCTGTTCATCAAATGTATGG + Intergenic
1077449345 11:2627038-2627060 TCCTATGTTCATGGATTGGAAGG - Intronic
1077792202 11:5453240-5453262 TTCCTTGTTCATAAAATAGAGGG + Intronic
1078058376 11:8026874-8026896 TACCATGTTCATGAATTGGAAGG - Intronic
1079816374 11:25064633-25064655 GGCTATTTTCATGAAATGGATGG - Intronic
1081790838 11:45783074-45783096 TGATATGTCCATACAATGGAAGG - Intergenic
1085443795 11:76586619-76586641 TACCATGTTCATGAACAGGAAGG - Intergenic
1086546743 11:88005004-88005026 TACAATTTTCATGAATTGGAAGG + Intergenic
1087377374 11:97361521-97361543 TATTTTGTTCATAATATTGATGG + Intergenic
1089193577 11:116676519-116676541 TTCCATGTTCATAGATTGGAAGG + Intergenic
1090222734 11:125044177-125044199 TCCTATGTTCATAAGTTAGATGG - Intergenic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1091040312 11:132272491-132272513 TCCCATGTTCATGAATTGGAAGG - Intronic
1092474001 12:8803707-8803729 TACTAATTTCATATAATGTAGGG - Intergenic
1093258026 12:16896583-16896605 TTCTATTTTCATAATAAGGAAGG - Intergenic
1093431949 12:19094489-19094511 TACTATCTTCATAAAATCTAGGG - Intergenic
1093881704 12:24411804-24411826 TACTACTTTCATAAAATGAATGG + Intergenic
1095565237 12:43615350-43615372 TACCATGTTCAGAGATTGGAAGG - Intergenic
1096346852 12:50856095-50856117 TACTATGCTCATTACATGGGTGG + Intronic
1098379924 12:69857507-69857529 TACCATGTTCATAGATTGGAAGG - Intronic
1098397756 12:70040116-70040138 TAATGTTTTCATAAAATGGGTGG + Intergenic
1099950641 12:89298636-89298658 TTCTATGTTCATGGATTGGAAGG + Intergenic
1100071332 12:90722660-90722682 TACCATATTCATGAATTGGAAGG - Intergenic
1101311000 12:103579211-103579233 TACTATGAGGAGAAAATGGAGGG + Intergenic
1101541277 12:105667736-105667758 TACCGTGTTATTAAAATGGATGG - Intergenic
1103554270 12:121756586-121756608 GTCTATCTTCATAAAAGGGAGGG + Intronic
1105370573 13:19798413-19798435 TTCCATGTTCATAGATTGGAAGG + Intergenic
1106146085 13:27050985-27051007 TACTATGTTCATAAATTTTCTGG - Intergenic
1106610758 13:31277971-31277993 TACTTTTTTCATAATATGGAAGG + Intronic
1107843651 13:44487550-44487572 TACATTGTTCATAAAAGGAATGG - Intronic
1108327273 13:49346215-49346237 TATTATGTACATAAATTTGAGGG - Intronic
1108884816 13:55166469-55166491 TGCTCTTTTCATAAAATGGCCGG - Intergenic
1108886768 13:55195160-55195182 GTCTATGTTCGTAAATTGGAAGG - Intergenic
1109208287 13:59505779-59505801 TGTTTTCTTCATAAAATGGAAGG - Intergenic
1109766639 13:66909319-66909341 TCCCATGTTCATAGATTGGAAGG + Intronic
1110219384 13:73057907-73057929 TACTATGTTGTTATAATGGGAGG - Intronic
1110399154 13:75069444-75069466 TACAATGTTGATGAGATGGAAGG - Intergenic
1110654645 13:77983192-77983214 TACCATGTTCATGAATTGGAAGG - Intergenic
1110680618 13:78307968-78307990 AACTATGAACAGAAAATGGAAGG + Intergenic
1111146583 13:84189861-84189883 TTCTATTTCCATAAAATGTAAGG - Intergenic
1111603851 13:90510878-90510900 TGGTATGTCCATACAATGGAAGG + Intergenic
1112689405 13:101873408-101873430 AACTTTTGTCATAAAATGGATGG + Intronic
1113057915 13:106289410-106289432 TACTATGTTCCTATAATAAATGG + Intergenic
1114924981 14:27384515-27384537 TAATATAGTCATAAAATAGAAGG - Intergenic
1115040992 14:28927256-28927278 TACAATGTTCATAAATTGGAAGG - Intergenic
1115817952 14:37183198-37183220 TTCTATGTTCATGAATAGGAAGG + Intergenic
1116108839 14:40549519-40549541 TAGTATGTTGACAAGATGGATGG - Intergenic
1117786924 14:59295699-59295721 TACTTTGTGTAGAAAATGGATGG - Intronic
1117825653 14:59700256-59700278 TCTTATGTTCATGAATTGGAAGG + Intronic
1117929519 14:60825591-60825613 TTATATCTTCATAAAATAGATGG + Intronic
1117980944 14:61341220-61341242 TACTTAGCTCATAAACTGGAAGG - Intronic
1118119431 14:62822147-62822169 TACCATGTTAATAAATTGGAAGG + Intronic
1119370865 14:74141255-74141277 TACTATGTACAGAAAATGTCTGG - Intronic
1119955306 14:78791830-78791852 GAATATGTTCAGGAAATGGAGGG - Intronic
1120335989 14:83155599-83155621 TAATATGTTAATAAAAAGAAAGG + Intergenic
1124455498 15:29838950-29838972 TACTATTCTGATAAAAAGGAAGG - Intronic
1125478562 15:40064096-40064118 TGCCATGTTTGTAAAATGGATGG - Intergenic
1125845440 15:42848389-42848411 TACCATATTCATTAATTGGAAGG - Intronic
1126575259 15:50190326-50190348 TACTCTGATCATGAAATGGTTGG - Intronic
1126667656 15:51089745-51089767 TACTATGTCCATAAAATCCCAGG + Intronic
1127149499 15:56058864-56058886 TTCTATCTTCATACGATGGAAGG + Intergenic
1127182382 15:56435807-56435829 TACTATCTTCATAAAATGAATGG - Intronic
1128487011 15:68102560-68102582 TACCATGTTCATATACTGGAAGG - Intronic
1131896083 15:97030908-97030930 TACTAAGTTCTTAAGATGGGAGG - Intergenic
1133686213 16:8167843-8167865 TGCTAAGAGCATAAAATGGAGGG - Intergenic
1134899434 16:17923145-17923167 TACAATGTTCGTACATTGGAAGG + Intergenic
1138863548 16:60789409-60789431 TACTAAGTTAAAAAAAAGGAAGG - Intergenic
1139031275 16:62884099-62884121 TGCTATGTTCTAAAAATGAATGG - Intergenic
1140234068 16:73142827-73142849 TACTATGTCCATTTCATGGATGG + Intronic
1140582567 16:76249090-76249112 TAGTATGTTCACAAAATAGATGG + Intergenic
1140679691 16:77373022-77373044 TACTAGGTTCAAAAAGTGAAAGG - Intronic
1141402167 16:83758911-83758933 TACCATGTTCATGGATTGGAAGG + Intronic
1145985646 17:29044230-29044252 TTCCTTGTTCATAAAATGAAGGG + Intronic
1146293103 17:31626433-31626455 TACCATGTTCATGGATTGGAAGG + Intergenic
1146741761 17:35291042-35291064 TTCCATGTTCATGAATTGGAAGG + Intergenic
1149136631 17:53373999-53374021 TACCATATTCATAACATTGAAGG - Intergenic
1149328227 17:55555249-55555271 TTCTATGTTTATCATATGGAAGG + Intergenic
1150223914 17:63512478-63512500 TAAAATGTCTATAAAATGGAAGG - Intronic
1151442644 17:74142429-74142451 TATCATGTTCATAGATTGGAAGG + Intergenic
1151464083 17:74273402-74273424 TACTGTGTTCATTGAATGAATGG - Intergenic
1151650626 17:75466867-75466889 TACAATGTTCATGGATTGGAAGG - Intronic
1155240839 18:23862364-23862386 TTCTGTCCTCATAAAATGGATGG - Intronic
1155430683 18:25753390-25753412 TCCTATGTTCATGAATTGGAAGG + Intergenic
1155581313 18:27310512-27310534 TACTATATTCATGAATTGTAAGG - Intergenic
1155716514 18:28951111-28951133 TACTGTGGTCATAAATTGGAAGG + Intergenic
1155738330 18:29252618-29252640 TAATATGTTCATAAATTGGCGGG - Intergenic
1156621863 18:38862189-38862211 GTCTATATTCATAAACTGGAAGG + Intergenic
1156874306 18:41988793-41988815 TCCTATATACATAAACTGGAAGG + Intronic
1157714971 18:49878263-49878285 TACTATTTTCATAAAATTTGAGG - Intronic
1157798738 18:50601060-50601082 TACTATGTTCAAAACCTGAATGG - Intronic
1158450669 18:57561597-57561619 GTCTCTGTTCATAAAATGAAAGG - Intronic
1158731511 18:60029409-60029431 TGGTATATTCATAAAATGGATGG - Intergenic
1160611553 18:80091640-80091662 TATCCTGTTAATAAAATGGAGGG + Intronic
1164439994 19:28269589-28269611 TACTATATTAATAAAATGAAAGG - Intergenic
1165864387 19:38927310-38927332 TACAATGTACATAATATGGGAGG + Intronic
924975443 2:169976-169998 TATTGTATTCATAAAATGAAGGG + Intergenic
925456497 2:4020921-4020943 TCCTGTGTTCAGAAACTGGAAGG - Intergenic
926396181 2:12445162-12445184 TACTATGTAGATAAAAAGAATGG + Intergenic
927348447 2:22075906-22075928 AACTATATTCATAAAATGGGTGG + Intergenic
927734636 2:25508436-25508458 TACCATATTTATAAATTGGAAGG - Intronic
927745330 2:25614653-25614675 TACTATGTTCATAAAATGGAAGG + Intronic
928014981 2:27647751-27647773 AACTATGATCATAAACTGGCAGG - Intronic
928026602 2:27744537-27744559 TACTATGTTTATATGAGGGAGGG - Intergenic
928107229 2:28478365-28478387 TATGATGTTCATGAAATAGAAGG - Intronic
928594019 2:32843450-32843472 TTCTCTGTTCATAAAATGAGGGG - Intergenic
930791057 2:55329232-55329254 TACTTTTTTCACAAAAAGGATGG + Intronic
931384870 2:61789362-61789384 TATTTTATTCATAAAATGAAGGG + Intergenic
933120938 2:78537250-78537272 TATTATGTTCATGAATTAGAAGG + Intergenic
934958572 2:98646876-98646898 TACTATGTTCACCATTTGGATGG - Intronic
935939574 2:108223880-108223902 AACTTTGTCCATGAAATGGAAGG + Intergenic
938185008 2:129223680-129223702 TAAAAAGTTCTTAAAATGGATGG + Intergenic
938793482 2:134697690-134697712 TACCATGTTCATAAAAGGTCAGG - Intronic
939319960 2:140606392-140606414 AACAATGTTCATGGAATGGAAGG + Intronic
939550708 2:143611875-143611897 CCCTATGTTCATTAAATGGATGG + Intronic
941429502 2:165396065-165396087 AAATATATTCATAAAATTGAAGG - Intergenic
942568193 2:177287489-177287511 TACATTCTTCATAATATGGAAGG - Intronic
943491915 2:188564592-188564614 TACCATGTTTATAGATTGGAAGG + Intronic
943561052 2:189462838-189462860 AATTATTTTTATAAAATGGAAGG + Intronic
944341818 2:198610359-198610381 TAAGATGTTCAGAAATTGGAGGG - Intergenic
944462229 2:199961954-199961976 TCCTTTCTTCAGAAAATGGAAGG + Intronic
945334543 2:208577005-208577027 TTCTATGTTCATGGATTGGAAGG + Intronic
945516266 2:210766654-210766676 TACTCTGCACATAAACTGGAGGG - Intergenic
945625572 2:212201205-212201227 TAATATATTCATAAGAAGGATGG - Intronic
945802740 2:214453591-214453613 TACCATATTCATGAATTGGAAGG - Intronic
945867510 2:215193196-215193218 CACTATGTTCTTATAATGGGAGG + Intergenic
946284150 2:218690167-218690189 CACCATGGTCCTAAAATGGAAGG + Intronic
947376882 2:229505040-229505062 TGATATGTTCATAACATGAAGGG + Intronic
1173179381 20:40791936-40791958 TACTGGCTTCATAAAATGGTTGG + Intergenic
1173884613 20:46446254-46446276 TACTAGCTTCATAAAATAAATGG + Intergenic
1174523352 20:51151598-51151620 TACTATATTCATGAATTGGAAGG + Intergenic
1176006872 20:62870004-62870026 TACTATGTTCATGGATTGGAAGG + Intergenic
1177239571 21:18439279-18439301 TTCTATGATCATATAATTGATGG + Intronic
1177876584 21:26639837-26639859 TACTCTGTTCATGGAATTGAAGG - Intergenic
1178000519 21:28157741-28157763 AAGTATGTTCAAAACATGGAAGG - Intergenic
1178204784 21:30452371-30452393 TAATATATACATATAATGGAAGG + Intergenic
1178762221 21:35413903-35413925 TACTGTGTTCATAAATTTGTTGG - Intronic
1178773763 21:35529466-35529488 TACTGTGTTCATTAAAGTGAAGG - Intronic
1179638237 21:42728694-42728716 TACCAACTTCATAAAATGAATGG + Intronic
1180966665 22:19792250-19792272 AACTATGTTCAAAAAATGAAAGG + Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
949294065 3:2499848-2499870 TACCAGGTTCATGAACTGGAAGG - Intronic
950071859 3:10159081-10159103 TACTATGCTCATATAATGACAGG + Intergenic
951556339 3:23924344-23924366 TGCTATATTAATAAATTGGAAGG + Intronic
951990749 3:28673828-28673850 AACTATGTTCATGAAATTGGTGG + Intergenic
952140905 3:30478118-30478140 TATTATATTGATAAAATGGCTGG - Intergenic
952415632 3:33088661-33088683 TCCTATGTTCATGGAGTGGAAGG + Intronic
952829031 3:37547972-37547994 TACTATTTGCATAAAATAAAAGG - Intronic
953580626 3:44152119-44152141 TACTGTGTTCATGGATTGGAAGG - Intergenic
955568132 3:60271738-60271760 AACTATCTTCATAACATGGAAGG - Intronic
957856996 3:85892369-85892391 TAATATGTTCATGATATGGTTGG + Intronic
958570780 3:95879555-95879577 AACTATGTTGATTAAATGCATGG + Intergenic
960206986 3:114914193-114914215 TTCCATGTTCATGAATTGGAAGG - Intronic
960475714 3:118124306-118124328 TACTATGTTCATAGATTGGATGG - Intergenic
960874735 3:122285178-122285200 TAGTGAATTCATAAAATGGAAGG + Exonic
961247273 3:125465994-125466016 AACTATGTTCATGGATTGGAAGG - Intronic
963439879 3:145325500-145325522 TATCATGTTAATAAAATGAAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965242461 3:166220013-166220035 TAATATGTTCTGAAAATGTATGG - Intergenic
966034747 3:175397921-175397943 TACTGTGTTAATAACATGGCAGG - Intronic
968108742 3:196024194-196024216 TATTGTGTTCGTAAAATGAAGGG + Intergenic
968219052 3:196920180-196920202 TACCATGTTCATACACTGAAAGG - Intronic
969144515 4:5110126-5110148 TCCTATGCTCATGAATTGGAAGG + Intronic
970046558 4:11861160-11861182 TAACATGTTCTTAATATGGATGG + Intergenic
970072234 4:12173816-12173838 TGCTCTGATTATAAAATGGAAGG - Intergenic
970688634 4:18596849-18596871 ATCAATGTTTATAAAATGGATGG + Intergenic
970950279 4:21747654-21747676 AACTATGTTCATTAATTTGATGG + Intronic
972513194 4:39788759-39788781 TACTGTGCTCTTAACATGGAAGG + Intergenic
973039668 4:45454628-45454650 TAGTATATTCATACAATGGGAGG - Intergenic
974892935 4:67903351-67903373 TTCCATGTTCATAGATTGGAAGG - Intergenic
975097832 4:70477718-70477740 TATTATCTTCATTATATGGATGG - Intronic
976641705 4:87346140-87346162 TACCATTTTAATAAAATGAAGGG + Intronic
976657207 4:87501596-87501618 TACTATGTTCATAAAAACATTGG - Intronic
977312815 4:95408249-95408271 TACTATGTGCTTTAAATGGCTGG + Intronic
977477679 4:97533738-97533760 TAGTAAGTTCACACAATGGAGGG - Intronic
977596639 4:98889368-98889390 TACTAATGTCATAAAATGAATGG + Intronic
977775240 4:100911338-100911360 TACTATTTTCTTAAGATAGAAGG + Intergenic
978428437 4:108606266-108606288 TAATATGTTCCTGAATTGGAAGG + Intergenic
978684278 4:111420569-111420591 CACTGTTTTCATAAAATGAATGG + Intergenic
979221097 4:118226199-118226221 TACTTTGTTCTTAAAATGAAGGG + Intronic
979425455 4:120559272-120559294 TACCATGTTTATAGATTGGAAGG + Intergenic
979738727 4:124122634-124122656 TAATATGTTCATACAATTTAAGG + Intergenic
981039019 4:140204032-140204054 ACCAATGTTCATAAATTGGAAGG + Intergenic
982079996 4:151779987-151780009 TTCTATCTTCTAAAAATGGAAGG + Intergenic
983142549 4:164170176-164170198 TACTATTTTCATCAAATTTATGG - Intronic
983200146 4:164852573-164852595 TCCTATCTTGAAAAAATGGAAGG + Intergenic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
983976364 4:173939281-173939303 TTCTATTTTTATAAAATGTATGG + Intergenic
983989022 4:174095948-174095970 TACTATGTTCATGTATTGGAAGG + Intergenic
985470509 5:40422-40444 TATTGTGTTCGTAAAATGAAGGG + Intergenic
986373727 5:7108364-7108386 TAGAATATTAATAAAATGGAGGG + Intergenic
986458370 5:7943111-7943133 TCCTGTCTTCACAAAATGGAAGG + Intergenic
986618626 5:9646383-9646405 TACTTTGTTCAAAAGATGCATGG + Intronic
986723991 5:10580852-10580874 AAATATGTTCATGAAAAGGAGGG - Intronic
986936685 5:12896986-12897008 TACTACATTTCTAAAATGGAAGG + Intergenic
987093516 5:14528128-14528150 TACTGTGTTCATAGATTGAATGG + Intronic
987390661 5:17372196-17372218 TAATATATTTAAAAAATGGATGG + Intergenic
987697533 5:21351523-21351545 TACTGTGTTCATAAAAAACAAGG + Intergenic
988754704 5:34235168-34235190 TACTGTGTTCATAAAAAACAAGG - Intergenic
988955801 5:36317244-36317266 TTCCATGTTCATGAACTGGAAGG - Intergenic
988959143 5:36351583-36351605 GACTATGTGCAAAAAATGCAAGG - Intergenic
990182431 5:53176273-53176295 TACAATGTTTATAAAATCTATGG + Intergenic
990790767 5:59476101-59476123 TATTTTCTTCATAAAATAGAGGG - Intronic
991054933 5:62310017-62310039 TACTATGTTTTTAAACTGCATGG + Intronic
991356051 5:65769571-65769593 TAATTTGTTGATTAAATGGATGG + Intronic
991537255 5:67683637-67683659 TTCTATGTTCAGGAATTGGAAGG - Intergenic
991742918 5:69700856-69700878 TACTGTGTTCATAAAAAACAAGG - Intergenic
991754778 5:69854348-69854370 TACTGTGTTCATAAAAAACAAGG + Intergenic
991794491 5:70280594-70280616 TACTGTGTTCATAAAAAACAAGG - Intergenic
991822305 5:70576168-70576190 TACTGTGTTCATAAAAAACAAGG - Intergenic
991834105 5:70729496-70729518 TACTGTGTTCATAAAAAACAAGG + Intergenic
991886871 5:71280136-71280158 TACTGTGTTCATAAAAAACAAGG - Intergenic
993026776 5:82655835-82655857 TATTCTGTACATAAAATGTACGG - Intergenic
993788362 5:92173578-92173600 TATCATGTTAATAAAATGAAAGG + Intergenic
993806172 5:92412639-92412661 CTCTATCTTCATAAAGTGGATGG - Intergenic
995951799 5:117723143-117723165 TTCTATATTCATGAATTGGAAGG - Intergenic
996605678 5:125318868-125318890 TACTATGATTTTTAAATGGAGGG + Intergenic
997034950 5:130178581-130178603 TACTATCTTCAGAAAAGTGAGGG - Intronic
997125502 5:131223016-131223038 TGCTATTTTAAGAAAATGGATGG - Intergenic
997324842 5:133011703-133011725 TACCATGTTCATAGACTGGAAGG + Intronic
997489267 5:134259502-134259524 TACTATGTCCAGATAATGGTTGG - Intergenic
1000858359 5:166428201-166428223 TAATTGGTTCATTAAATGGAAGG + Intergenic
1003081799 6:3027330-3027352 TACTAAGATCATAAAAATGAAGG + Intergenic
1003275777 6:4650496-4650518 TACTGGCCTCATAAAATGGATGG - Intergenic
1004156645 6:13174852-13174874 TACTAACTTCATAGGATGGATGG + Intronic
1004859314 6:19784945-19784967 TACCATGTTCACAAACTGGAAGG + Intergenic
1005553324 6:26946884-26946906 TACTGTGTTCATAAAAAACAAGG - Intergenic
1005799170 6:29402076-29402098 TACTATTTTAATTAAATGGAAGG - Intronic
1007364391 6:41381051-41381073 TACCATGTTCACAAATGGGAAGG + Intergenic
1008345795 6:50424750-50424772 GACTATGTGCAAAAAATGCAAGG + Intergenic
1008873397 6:56299822-56299844 TAATATGTTCCTAAAATAAAAGG + Intronic
1009462747 6:63933702-63933724 TTCTATGTTCATGAGATGGCTGG - Intronic
1010040847 6:71381093-71381115 CAATATGTTCATAAAATTTATGG + Intergenic
1011211429 6:84960001-84960023 CATTATGTTCTTAAGATGGAGGG + Intergenic
1012860215 6:104550687-104550709 TACTGTGCTAATACAATGGAGGG - Intergenic
1013138857 6:107310666-107310688 TACTCTCTTCATAGAAAGGAAGG - Intronic
1014226757 6:118857036-118857058 TCCTATGTTCTAAAAATGTAAGG + Intronic
1014287837 6:119521664-119521686 TACTAAGATAACAAAATGGAAGG - Intergenic
1016075887 6:139795066-139795088 TTCTATGTTCATGGATTGGAAGG - Intergenic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1019182302 6:170197530-170197552 TACCATGTTCATAGATTGGAAGG + Intergenic
1020743653 7:12054097-12054119 TATTGTCTTCATAAAATTGATGG + Intergenic
1020809080 7:12829462-12829484 TACAATGTACATTAATTGGAAGG - Intergenic
1022084424 7:27052724-27052746 TACTTTTTTTAGAAAATGGAAGG + Intergenic
1022211075 7:28210072-28210094 TACTACTTTCATAAAATGCAAGG - Intergenic
1022567531 7:31418120-31418142 TAATATCTTCAGAAAATGCAAGG - Intergenic
1022637195 7:32147668-32147690 TTCCAAGTTCCTAAAATGGAAGG - Intronic
1026293838 7:69033068-69033090 TACTGTCTTCATAAAATTGAAGG - Intergenic
1027401210 7:77809702-77809724 TACTATGATCATATATTGAATGG + Intronic
1027599713 7:80224677-80224699 TCCTATGTTTGTGAAATGGAGGG - Intergenic
1028345904 7:89781752-89781774 TTCTATGTTCATGTATTGGAAGG - Intergenic
1028715906 7:93968009-93968031 TATTACGTTAAGAAAATGGAAGG - Intronic
1029206456 7:98871832-98871854 TGCTATGTTCAGGGAATGGAGGG + Intergenic
1029648919 7:101877328-101877350 GACTATGTGCATACAAAGGAGGG - Intronic
1029901400 7:104044114-104044136 TACTATGCTCATTACCTGGATGG + Intergenic
1030950474 7:115785059-115785081 TATTATGTTGATAAAATCAATGG + Intergenic
1031213674 7:118862460-118862482 TCCATTGTTCATAAAGTGGATGG - Intergenic
1031465326 7:122102978-122103000 TAATATGTTCAAAAAATAAAAGG + Intronic
1031486667 7:122335102-122335124 TACTATGTGTAAAAAATGGTGGG - Intronic
1031565715 7:123294870-123294892 TACTATGTGAATAAAATAGAGGG - Intergenic
1033487521 7:141805570-141805592 TACTATATTAATAAAATAAAGGG + Intergenic
1035119418 7:156553516-156553538 TACTGTGATCATGAACTGGAGGG + Intergenic
1035142657 7:156778533-156778555 AAATATGTTCATTAAATGCAAGG + Intronic
1036541188 8:9713357-9713379 TACTATTTTCCCAAAATGAAGGG - Intronic
1037299574 8:17436544-17436566 TAATAGTCTCATAAAATGGAGGG + Intergenic
1037964295 8:23121468-23121490 TACCATGTTCATAGAAAAGAAGG - Intergenic
1037976419 8:23216967-23216989 TACCATGTTCATAGAAGAGAAGG + Intronic
1038944534 8:32343388-32343410 TACTAGGTTTATAAATTTGAAGG - Intronic
1039237821 8:35522118-35522140 TACTATCTTCATAAAATATCTGG + Intronic
1039588016 8:38722922-38722944 TACTGTGTTCATATAAGAGATGG + Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1040444564 8:47480448-47480470 TACTATTTTGTTAAAATGTAAGG + Intronic
1040510954 8:48094164-48094186 TTCCATGTTCATGAATTGGAAGG - Intergenic
1041276929 8:56170121-56170143 TACTATGTTAATAAAGTGAGTGG - Intronic
1041567444 8:59295705-59295727 TACTATGATTATAAAAAGAAAGG - Intergenic
1041568517 8:59308952-59308974 CATTATGTTCATATTATGGAAGG - Intergenic
1041668558 8:60469321-60469343 TACTATGTTGATAAAGAAGAAGG + Intergenic
1041969751 8:63726104-63726126 TACAATGTTGAAAAGATGGATGG - Intergenic
1042053904 8:64741873-64741895 AACTATGTTCGTTAATTGGAAGG + Intronic
1043189182 8:77195454-77195476 TACTATGTTCATTACCTGGTTGG + Intergenic
1043743992 8:83850664-83850686 TGCCATGTTCATAAAGTAGAAGG - Intergenic
1044165525 8:88978213-88978235 TACTATGTTAAAAAAATCTAAGG - Intergenic
1045144437 8:99324924-99324946 TAATATGATTATACAATGGAAGG - Intronic
1046173960 8:110550385-110550407 TATTCTGTTCATAAAAGAGAAGG - Intergenic
1046683958 8:117203899-117203921 TACTATTTTCAGAGAAAGGATGG + Intergenic
1047329965 8:123878013-123878035 TTCTATTCTAATAAAATGGAGGG + Intronic
1049950324 9:637329-637351 TACTTTGTTTAGAAAATGGAGGG + Intronic
1051025263 9:12602502-12602524 CACTATGTTTATAAAATAAATGG - Intergenic
1051897401 9:22002525-22002547 TAATATTTTCAAAAAAGGGAGGG + Intronic
1052841327 9:33293490-33293512 TACTATCTTCATTACATGTAAGG + Intronic
1054859985 9:69940893-69940915 TTCTATTTTGTTAAAATGGAAGG - Intergenic
1055396909 9:75885576-75885598 TACAATGTTCTTACACTGGATGG + Intergenic
1055467586 9:76580783-76580805 TACTATTGTAATAACATGGATGG - Intergenic
1055633759 9:78253287-78253309 TACCATGTTTATAATATGTAGGG + Intronic
1056679847 9:88707192-88707214 TCCTATGGTCCTATAATGGAAGG - Intergenic
1056850761 9:90081792-90081814 AAAAATGTTCATAACATGGATGG - Intergenic
1057970169 9:99547691-99547713 TACCATGTTCATAGATTAGAAGG - Intergenic
1058425655 9:104873690-104873712 TACAATCATCATAAAATGCAGGG - Intronic
1058641656 9:107092556-107092578 TACTAGTTTTATAAAATGAATGG - Intergenic
1059590989 9:115661801-115661823 TATTGTGTTTATTAAATGGAAGG - Intergenic
1060099412 9:120825538-120825560 TCCTATGTTCATGGATTGGAAGG - Intronic
1060145279 9:121247437-121247459 TACTATGTCACTAGAATGGAAGG - Intronic
1060160899 9:121362379-121362401 AAAAATGTTCATAACATGGATGG - Intronic
1060183413 9:121549465-121549487 TAAAATGTTCTTAAATTGGACGG + Intergenic
1060571872 9:124648976-124648998 TCCCATGTTCATAAAGTGAAAGG + Intronic
1061344520 9:130011790-130011812 TACCATGTTCATGGATTGGAAGG + Intronic
1203692718 Un_GL000214v1:60483-60505 AAATATGTTGATAAAATAGAGGG - Intergenic
1203643577 Un_KI270751v1:43708-43730 AAATATGTTGATAAAATAGAGGG + Intergenic
1187537189 X:20152747-20152769 TTATATGTTCACAAAATGGAAGG - Exonic
1191926171 X:66312394-66312416 CACTATATTCATATGATGGATGG - Intergenic
1192343251 X:70281158-70281180 TTCTATCGTCATAACATGGAGGG - Intronic
1194297973 X:92150655-92150677 TACTATGTTCATGGATTGGAAGG - Intronic
1196009149 X:110867949-110867971 TTCTGTGTTCATGTAATGGAAGG + Intergenic
1196027756 X:111059553-111059575 TCCTATGTTCATGGATTGGAAGG - Intronic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198379152 X:136068068-136068090 TGCTTTGTTCATAAAATGCCTGG + Intergenic
1199006321 X:142701486-142701508 AAATATGTTCATGAAATGTAAGG - Intergenic
1199205151 X:145139894-145139916 AACTGGGTTCATAAAATGGCAGG + Intergenic
1199940059 X:152616576-152616598 TACTATATTCATAGATTGAAAGG - Intergenic
1200615582 Y:5375626-5375648 TACTATGTTCATGGATTGGAAGG - Intronic