ID: 927745490

View in Genome Browser
Species Human (GRCh38)
Location 2:25616007-25616029
Sequence TGTTGGCAGTGATAAATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927745487_927745490 26 Left 927745487 2:25615958-25615980 CCACCAACATAGAGCTTTGAATG 0: 1
1: 0
2: 1
3: 6
4: 307
Right 927745490 2:25616007-25616029 TGTTGGCAGTGATAAATCAAAGG 0: 1
1: 0
2: 0
3: 13
4: 191
927745488_927745490 23 Left 927745488 2:25615961-25615983 CCAACATAGAGCTTTGAATGCAA 0: 1
1: 0
2: 1
3: 7
4: 142
Right 927745490 2:25616007-25616029 TGTTGGCAGTGATAAATCAAAGG 0: 1
1: 0
2: 0
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927745490 Original CRISPR TGTTGGCAGTGATAAATCAA AGG Intronic
903076797 1:20775723-20775745 TGTAGGCAGTTATAACACAACGG - Intronic
911584646 1:99677055-99677077 GGTTTGCAGTGAAAAATGAAAGG - Intronic
911878326 1:103198551-103198573 TCTTGACAGTAATAATTCAATGG - Intergenic
914874416 1:151502088-151502110 TTTTGACAGTGCTTAATCAAGGG - Intergenic
916446460 1:164876798-164876820 TGGGGGCTGTGATAAATCACTGG - Intronic
917021192 1:170589941-170589963 TCTTTGCATTGATAATTCAAGGG - Intergenic
919145442 1:193628689-193628711 TGTTTGCACTGAGAAATGAAAGG - Intergenic
921715790 1:218416063-218416085 TGTACACAGTGATAAAACAATGG - Intronic
921827582 1:219691080-219691102 TGTCTGTAGTGATAAAACAAAGG + Intronic
922987908 1:229880573-229880595 TGTTGGCAGTGACAGTTCTAAGG - Intergenic
924407492 1:243765697-243765719 TGTTAGCAGAGATAATTGAAAGG - Intronic
1063240725 10:4166768-4166790 TGTTGTCAGGGCTAAGTCAATGG - Intergenic
1063289304 10:4727103-4727125 TGTTGGCAGTTAAAAATCACAGG + Intergenic
1063904342 10:10766932-10766954 CGTTGGCAGTGAGAAATGAACGG - Intergenic
1066562649 10:36687426-36687448 TCTTGGCATTGATAATTCATAGG + Intergenic
1068542683 10:58312963-58312985 TGCTGGCATTGATGAAGCAAAGG - Intergenic
1068706856 10:60086573-60086595 TGTTGGCATGGATATTTCAAAGG + Intronic
1071489932 10:86129329-86129351 TGTTGCCATTGACAGATCAAGGG - Intronic
1072774268 10:98173668-98173690 AGTGGGCAGTGATTAATCACAGG + Intronic
1073635778 10:105197141-105197163 TCTTTGCACTTATAAATCAAGGG - Intronic
1079916497 11:26374599-26374621 TGTTGGCCATGATAAATTGATGG + Intronic
1087010828 11:93512587-93512609 TGTAGGCAGTTATAACACAATGG - Intronic
1087258527 11:95984132-95984154 TGTAGGCAGTTATAACACAATGG - Intronic
1090597132 11:128332171-128332193 TGATGGCACTGTTAAATTAATGG - Intergenic
1091841010 12:3620772-3620794 TGTTTGCAATGATGACTCAAAGG + Intronic
1091891836 12:4062106-4062128 TGTAGGCAGTTACAAAACAATGG + Intergenic
1092292752 12:7173142-7173164 TTTTGGCAGTGATATAGCAGTGG + Intergenic
1094050065 12:26209579-26209601 TGCTGGCAGTAAAAACTCAAAGG - Intronic
1095251964 12:39989469-39989491 ATTTGGCAGTGATGAATGAAAGG - Intronic
1095581324 12:43803435-43803457 TGTTAGCAGTTATTAATAAAGGG + Intronic
1098534207 12:71576297-71576319 TGTTGGCAGGGAGCAAGCAAAGG + Intronic
1099597902 12:84691783-84691805 TTTTGATAGTAATAAATCAAAGG + Intergenic
1102379918 12:112456261-112456283 AGTTGGCAGTGAGTAGTCAATGG + Intronic
1103426992 12:120844558-120844580 TGTTTGTATTGAGAAATCAAAGG - Intronic
1106198244 13:27512414-27512436 TGTTGGGAATGATAGAGCAATGG - Intergenic
1109258031 13:60108115-60108137 TGTTTGGAATGATAAACCAATGG + Intronic
1109582325 13:64357560-64357582 TTTTTGTAGTGATAAATCATAGG - Intergenic
1110761254 13:79232942-79232964 TGTAGGCAAAGAGAAATCAAAGG - Intergenic
1111070664 13:83161708-83161730 TGTAGGCAGTTATAACACAATGG - Intergenic
1111371603 13:87326367-87326389 TGTTTGCATTGAAAAATTAATGG + Intergenic
1114422971 14:22599904-22599926 AGCTGGGAGTGATACATCAATGG - Intronic
1115572428 14:34679434-34679456 TGTAGGCAGTGGTAACACAATGG - Intergenic
1115726209 14:36218861-36218883 TGTAGGCAGTGGTAACACAATGG + Intergenic
1115782911 14:36790195-36790217 TATTTACAGTGATAATTCAAAGG + Intronic
1117981165 14:61343185-61343207 TTTTGGAACTGATAAATCAAAGG + Intronic
1118524875 14:66628412-66628434 TGTAGGCAGTTATAACACAATGG + Intronic
1119553184 14:75531876-75531898 TGTTGGCACAGATAAGTCACAGG + Intronic
1119708562 14:76804086-76804108 TGTTGCCAGTGAAAAAGTAATGG - Intronic
1121950462 14:98167014-98167036 CGTTGGCTGTGAAAAATCATGGG - Intergenic
1124018626 15:25900198-25900220 TGTAGGCAGTTATAACACAATGG - Intergenic
1125441310 15:39707108-39707130 TGATTGCAGTGAAAGATCAAGGG - Intronic
1128372132 15:67048260-67048282 TGTTGGCAGTTTTGAAGCAAAGG - Intergenic
1131257121 15:90870334-90870356 TGCAGACAGTGATACATCAAAGG + Intronic
1132849245 16:2017050-2017072 TGTTGGCACTGATAATCCAGTGG - Intronic
1135379163 16:21979534-21979556 TGTAGGCAGTTATAACACAAAGG + Intronic
1137832700 16:51559342-51559364 TGTAGGCAGTTATAACACAATGG - Intergenic
1143734884 17:8904655-8904677 CGTTGGCAGAGATGAATCAAAGG + Intronic
1144499925 17:15777651-15777673 TGTAGGCAGTTATAACACAATGG + Intergenic
1144640991 17:16936410-16936432 GGTTGGCTGTGATTAATTAAAGG + Intronic
1144874091 17:18388107-18388129 GGTTGGCTGTGATTAATTAAAGG - Intronic
1145158129 17:20556309-20556331 GGTTGGCTGTGATTAATTAAAGG + Intergenic
1146365991 17:32228379-32228401 TGTTGGCACTGATAATGCTACGG + Intronic
1147155138 17:38540888-38540910 TGTTGGTAGTGAGACATCGATGG + Intronic
1148688002 17:49511571-49511593 TGTGGGCAGTGACATATAAAAGG - Intronic
1149483196 17:57019816-57019838 TGCAGGCAGAGATAAATCCATGG + Intergenic
1150838804 17:68589041-68589063 TGTTGGCCAACATAAATCAAAGG - Intronic
1152173179 17:78767691-78767713 TGATTGCAGTGATAAGTGAATGG + Intronic
1152423439 17:80206105-80206127 TTTTCCCAGTGAAAAATCAAAGG + Intronic
1152849181 17:82621834-82621856 CTTTGGCTGTGAGAAATCAAAGG - Intronic
1153528787 18:6022491-6022513 TGTTGGCAGTAAGAAATCATTGG - Intronic
1153927493 18:9846969-9846991 TGTTGAGAGTAAGAAATCAAAGG - Intronic
1153969409 18:10211906-10211928 TGCTGGCAGTGATACAGGAAGGG - Intergenic
1156513792 18:37662796-37662818 TGTAAGCAGTGATAAGTTAAGGG + Intergenic
1156631383 18:38973698-38973720 TGTTTGCAAAGATAAATAAAAGG + Intergenic
1157988268 18:52464689-52464711 AGTAGGCAGTGAGAAATCACAGG + Intronic
1166626420 19:44360345-44360367 TGTTGCCAATGATATATAAAAGG + Intronic
925961839 2:9024694-9024716 TGTTGGAAGTGAAAAAAAAAAGG + Intergenic
927745490 2:25616007-25616029 TGTTGGCAGTGATAAATCAAAGG + Intronic
928269122 2:29839683-29839705 TATTGGCAGAGATAAAGAAAAGG - Intronic
928939466 2:36713078-36713100 TGTCAGAAGTGATAAGTCAATGG + Intronic
929420644 2:41786165-41786187 TGTTGGAATTGTTAAATAAATGG + Intergenic
930273984 2:49290075-49290097 TCTTTGCAGGGATAAAACAATGG + Intergenic
932827304 2:74953387-74953409 AGTTGGCAGTGATAACAGAATGG - Intergenic
933119233 2:78515555-78515577 TGATGGCAAAGATAAAACAATGG + Intergenic
933871511 2:86570402-86570424 TGTTGGCAGTTGTAACACAATGG + Intronic
937964848 2:127496924-127496946 TGTAGGCAGTGGTAACACAATGG - Intronic
938646786 2:133339588-133339610 TCTTGGCAGAAATAAATTAATGG - Intronic
939050857 2:137305926-137305948 TGTAGGCAATGATAACACAATGG + Intronic
943604610 2:189962189-189962211 TGTAGGCAGTTATAACACAATGG - Intronic
943840936 2:192579772-192579794 TGATGGCTGTTAAAAATCAAGGG - Intergenic
945298542 2:208194350-208194372 TGTTGGCACAGATAAATCTGTGG + Intergenic
945812842 2:214569380-214569402 TGTTGGCCATGATAAAGCATTGG - Intronic
946401444 2:219470565-219470587 TGTCAGCAGAGATAAATGAATGG + Intronic
946637659 2:221747499-221747521 TGGTGGCAGTGATGAGTCAAAGG - Intergenic
946824897 2:223667817-223667839 TGTTAGCAGTGAGAACTAAAAGG + Intergenic
1170367205 20:15610808-15610830 TGTTGGCAGTGGAAAACCACTGG + Intronic
1170880792 20:20295332-20295354 TGTTGGAAGTGATTAAGAAAGGG - Intronic
1172353258 20:34260416-34260438 TGTTGGCAGTGAAGAAGCAGAGG - Exonic
1173154241 20:40594439-40594461 TGTTGGGAGGGATTAATGAAGGG - Intergenic
1173173872 20:40749503-40749525 TGTTGGCAGTTAGAAAACCATGG - Intergenic
1173278244 20:41603361-41603383 TGTTTGCATTGTTAATTCAAAGG - Intronic
1173691153 20:44962148-44962170 TCTTGCCAGTGATTCATCAAGGG + Intergenic
1178237054 21:30855235-30855257 TGATAGCAGTGCTAAGTCAAGGG - Intergenic
1178590895 21:33908964-33908986 TGTTGGCAGTGAAGAATCTCAGG - Intronic
1178944727 21:36937243-36937265 TGTTGGCAGAGATGACCCAAAGG - Exonic
1182427404 22:30282106-30282128 TGTAGGCAGTTATAATGCAATGG - Intergenic
949106008 3:200157-200179 TGTTGGCTGTCATAAATTAAAGG - Intronic
949353774 3:3155376-3155398 TGTGGGCAGTGATTCATTAAGGG + Intronic
951527309 3:23665799-23665821 TGTAGGCAGTTATAACACAATGG + Intergenic
951791572 3:26491372-26491394 TGTTAGCAGTGAGATAACAAAGG - Intergenic
952034540 3:29183641-29183663 TGTTGGCATAGATGACTCAAAGG + Intergenic
952585731 3:34889950-34889972 TTTTGCCAGTGCTAAATTAAGGG + Intergenic
953086299 3:39671372-39671394 TCTGGGCAGTGGTAATTCAACGG - Intergenic
953204702 3:40814883-40814905 TACTGGCAATGAAAAATCAAGGG + Intergenic
954780075 3:53052186-53052208 TGTTGTCAGGGAAAAAACAATGG + Intronic
957224982 3:77431772-77431794 TGTTGACAGTGTTAAATCTAGGG + Intronic
957646170 3:82932053-82932075 TATAGGCAGTGATTGATCAATGG - Intergenic
959350156 3:105251544-105251566 TCTTGGCATTGATAACTGAATGG - Intergenic
960292338 3:115900740-115900762 TGTTGACAGTGAAAGAACAATGG + Intronic
961084066 3:124051530-124051552 TTTAGTCAGTAATAAATCAATGG + Intergenic
961084721 3:124057093-124057115 TGTGGTAAGGGATAAATCAATGG - Intergenic
962009309 3:131378968-131378990 TTTTGGCAGAGATAATCCAAAGG + Intergenic
962690159 3:137887750-137887772 GGTTGGGTGTGATAAATTAATGG - Intergenic
963300248 3:143589483-143589505 TGTAGGCAGTTATAACCCAATGG - Intronic
965870761 3:173261755-173261777 TGTTTGCATTGATAAAGTAAGGG + Intergenic
969890699 4:10257220-10257242 AGATGGCAGTGATCAAACAATGG - Intergenic
970186376 4:13458745-13458767 TGTAGGCAGTTATAACACAATGG - Intronic
970676063 4:18451717-18451739 TGCTGCCAGTGATAACTCTACGG - Intergenic
972182143 4:36480534-36480556 TGTTGGCAGAGGTAAAACACTGG + Intergenic
972396276 4:38662457-38662479 TGATGTCAGTGATCAATAAATGG + Intergenic
972571549 4:40315226-40315248 TGTAGGCAGTTATAACACAATGG + Intergenic
972693082 4:41418926-41418948 TGTTAGCAGTGATAAAACATAGG + Intronic
973561051 4:52135998-52136020 TGTTGATAGTGATAAAACACTGG + Intergenic
975852502 4:78587149-78587171 GGTTGGTAATGATATATCAATGG - Intronic
977875646 4:102146745-102146767 TGTCAGCAGTGAAAAATGAAAGG - Intergenic
978048820 4:104169517-104169539 TGCTGACAGAGATAAATCACAGG + Intergenic
978227202 4:106351282-106351304 TCTTGGCAGAGATAACTCATAGG + Intergenic
979983319 4:127284033-127284055 TGTAGGCTGTGATAGCTCAATGG - Intergenic
980535319 4:134113428-134113450 TGTAGGCAGTTATAACACAATGG - Intergenic
980573902 4:134660797-134660819 TGCCGGCATTGATAAATGAAGGG + Intergenic
984080252 4:175239177-175239199 TGTAGGCAATTATAACTCAATGG - Intergenic
984435151 4:179700717-179700739 TGTAGGCAGTTGTAAAACAATGG - Intergenic
986602930 5:9491656-9491678 TTTTGGCAGTGGTAATTTAAAGG - Intronic
987873561 5:23650252-23650274 TCTTGGCCATGATATATCAAAGG + Intergenic
988206302 5:28140207-28140229 AGCTTGCAATGATAAATCAATGG + Intergenic
990172491 5:53069008-53069030 TGTTGGCATTGTTAAGTCACTGG + Intronic
991262877 5:64685811-64685833 TGTGGAGAGTGATTAATCAACGG + Intergenic
991645597 5:68797467-68797489 AATTTGCAGTGATAAATTAATGG - Intergenic
992167069 5:74064068-74064090 TGGTGGCAGCGATGAATCAAGGG + Intergenic
993453108 5:88096662-88096684 TTTTGGAAGTGCTAAAACAAAGG - Intergenic
993759069 5:91768914-91768936 AGTTGGCAGTAATAAAAAAATGG - Intergenic
994944279 5:106365251-106365273 TATTGGCAGTGATAACCTAAAGG + Intergenic
996808764 5:127489513-127489535 TATTGGAAGGGATAAAGCAATGG + Intergenic
997711833 5:136011393-136011415 TCTTGCCAGTTTTAAATCAAAGG - Intergenic
1001061357 5:168492299-168492321 TATTGGAAGTGAAAACTCAATGG - Intronic
1001194417 5:169658924-169658946 TGTTGGCAATGATTAATTATAGG - Intronic
1003689095 6:8334951-8334973 TGATGACACTGATGAATCAAAGG + Intergenic
1006965843 6:37983735-37983757 TGTGGGCAATTATAAAACAAAGG - Intronic
1009508007 6:64510064-64510086 TATTGGTAGTGATAATTTAAAGG + Intronic
1010361065 6:74994858-74994880 TGTAGGCAGTTATAACACAATGG - Intergenic
1010691352 6:78914677-78914699 TGTAGGCAGTGACAATTCACTGG - Intronic
1011643411 6:89434949-89434971 TGTTGGGAGGTATAAACCAATGG + Intronic
1015099497 6:129459200-129459222 TGTAGGCAGTTGTAACTCAATGG + Intronic
1015286484 6:131491150-131491172 TGTTGGAAATGTAAAATCAAAGG + Intergenic
1015752961 6:136579384-136579406 TGTTGGCAGTGAGATACAAAAGG - Intronic
1015876762 6:137830231-137830253 TGTTCTCAGTATTAAATCAAAGG + Intergenic
1016566662 6:145462770-145462792 TGTTGGTAGTGATAGATTGATGG - Intergenic
1018123168 6:160657020-160657042 TGTTGGCACTGAACCATCAAAGG - Intronic
1018402459 6:163438572-163438594 TGTAGGCAGTTATAACACAATGG + Intronic
1020712107 7:11620026-11620048 AGTTGGCAATGATAAACCATGGG + Intronic
1022831629 7:34073386-34073408 TGTAGGCAATGATAATACAATGG + Intronic
1028295487 7:89124564-89124586 TGTTCTCAGTTATAAATGAAGGG - Intronic
1030013633 7:105196634-105196656 TGTTGGCTGTGTTACATCAGAGG - Intronic
1030319772 7:108153014-108153036 TGTTGGGAGGGGAAAATCAATGG + Intronic
1030343761 7:108409982-108410004 TGGTGGCAGGAATAAGTCAAAGG - Intronic
1030680586 7:112430028-112430050 TGTTGGCAGATACAAATCAGAGG + Intronic
1034080167 7:148269175-148269197 AGTGGCAAGTGATAAATCAAAGG + Intronic
1034825527 7:154258831-154258853 TGTTGTCAGTGAAAAATAAAAGG + Intronic
1038921552 8:32090713-32090735 TGTTGGTAGTGATAAAAGGAAGG - Intronic
1040446289 8:47498205-47498227 TTTTGGCAGTGATAGGCCAAAGG + Intronic
1041994253 8:64034434-64034456 TGTAGGCAGTGGTAACACAAAGG - Intergenic
1043540622 8:81258203-81258225 TGTTGGAAATGATAATTAAAAGG + Intergenic
1044467317 8:92522947-92522969 TTTTGGATGTGATAACTCAATGG - Intergenic
1046549397 8:115694841-115694863 TGTTAGCAGTGGTAACACAATGG + Intronic
1047644571 8:126856494-126856516 TGTAGGCAATGGTAACTCAAGGG - Intergenic
1047982709 8:130199479-130199501 GGTTGGGAGTGACAAACCAAGGG + Intronic
1051032282 9:12695597-12695619 TGGTGGCAATGACAAATAAAGGG - Exonic
1051036692 9:12755728-12755750 CTTTGGCAGTTATAAATCTATGG + Intergenic
1052852893 9:33388586-33388608 TGTAGGCAGTGCTCAATAAATGG - Intronic
1059337620 9:113579131-113579153 TGGTGGCTGTGATGAATCATCGG + Intronic
1060321560 9:122566055-122566077 TGTTTTCAGTGATAAATAAGAGG - Intergenic
1061353884 9:130088417-130088439 TGTTGGAAGTGATAATACTAAGG - Intronic
1186234663 X:7494589-7494611 TGTTGGATGTGAAATATCAAAGG - Intergenic
1186597768 X:11002543-11002565 CTCTGGCAGTGATGAATCAAAGG + Intergenic
1187717808 X:22120751-22120773 TGTTTGCAGTGGTAACCCAAAGG + Intronic
1188359514 X:29235298-29235320 TGTTGGTACTGAACAATCAACGG + Intronic
1190280414 X:48925475-48925497 TGTTGGCAGAGACAACTCAATGG - Intronic
1190956800 X:55203109-55203131 TGTAGGCACAGATAAATCCATGG - Intronic
1193691755 X:84654352-84654374 TCTTGTCAGTGACAGATCAATGG + Intergenic
1198375904 X:136039908-136039930 TGATGGCAGTGAAACAGCAAAGG - Intronic
1199133678 X:144225899-144225921 TGTTTACAGAAATAAATCAATGG - Intergenic
1199472105 X:148206793-148206815 TGTTGACAGTGTGAAATGAAAGG + Intergenic
1201607799 Y:15806785-15806807 TAGTGGCATTGATAAATCAATGG - Intergenic
1202019150 Y:20447171-20447193 TGTAGGCAGTTATAACACAATGG - Intergenic
1202025167 Y:20514079-20514101 TGTAGGCAGTTATAACACAATGG - Intergenic