ID: 927746238

View in Genome Browser
Species Human (GRCh38)
Location 2:25624062-25624084
Sequence AGATGAAGCCTGCAAATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 1, 2: 4, 3: 105, 4: 583}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927746238 Original CRISPR AGATGAAGCCTGCAAATAGT AGG (reversed) Intronic
901970119 1:12901745-12901767 AGATGCAGTCTCCAAATGGTAGG + Intronic
902015052 1:13300036-13300058 AGATGCAGTCTCCAAATGGTAGG - Intergenic
902075039 1:13777644-13777666 AAATGAGGCATGCAAATATTGGG - Intronic
902739336 1:18423971-18423993 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
903840666 1:26236960-26236982 AGATGAAGCCTCCAAATAGTAGG + Intronic
904280617 1:29415768-29415790 AAATGGTGCCTGCACATAGTAGG - Intergenic
904495354 1:30883582-30883604 AGATCATGCCTGCACACAGTCGG + Intronic
904712157 1:32438388-32438410 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
904762077 1:32812646-32812668 AGATGAAGCCTCCAGGTAGCTGG - Intronic
906632003 1:47379302-47379324 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
907291234 1:53414161-53414183 AGCGGAACCCTGCAAAAAGTTGG - Intergenic
907971233 1:59383650-59383672 AGATGAAGCCTCCACTTAGCAGG - Intronic
908095227 1:60730589-60730611 AGATGAAGCCTCTGGATAGTAGG - Intergenic
908326877 1:63031717-63031739 AGATGAAGCCTCCAAGTGGCAGG + Intergenic
908364271 1:63402040-63402062 TGATGAAGTCTACTAATAGTAGG + Intronic
908549690 1:65196276-65196298 AGAGGCATCCTGCAAATGGTGGG + Intronic
909199852 1:72677330-72677352 AGATGAAGCCTCCAGAAAGCAGG + Intergenic
909201558 1:72695486-72695508 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
910258446 1:85273267-85273289 AAATGAAGACTGAAAATATTTGG - Intronic
910577158 1:88777902-88777924 AGATGAAACCTCCAGATAGCAGG - Intronic
911264509 1:95727194-95727216 AGATGAAGCCTCCAAGTAGTGGG + Intergenic
911407650 1:97462896-97462918 AGATGAAGCCTCCAGGTAGCAGG - Intronic
911649078 1:100366871-100366893 AGAAGAAATCTGCAAATAGGTGG + Intronic
911752163 1:101507813-101507835 AGATGACTTTTGCAAATAGTTGG + Intergenic
913031389 1:114907220-114907242 ATATGTAGCCTGCATATAATTGG + Intronic
913652686 1:120933460-120933482 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
914080907 1:144410761-144410783 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
914168414 1:145195589-145195611 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
914175822 1:145279292-145279314 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
914267152 1:146048046-146048068 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
914530541 1:148520777-148520799 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
914642869 1:149627581-149627603 AGATGAAGCCTCCAGATAGCAGG - Intergenic
914886913 1:151593026-151593048 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
915099134 1:153485859-153485881 AGAAGTAGCCTGTAAATATTTGG - Intergenic
915708335 1:157868864-157868886 AGATGAAGCCTCCAAGTAACAGG + Intronic
916329382 1:163596961-163596983 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
916801344 1:168219490-168219512 AGATGAAGCCTCCAAGTAGGAGG + Intergenic
917012568 1:170490559-170490581 AGGTGGAGGATGCAAATAGTGGG - Intergenic
917097978 1:171418555-171418577 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
917123027 1:171660871-171660893 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
917150887 1:171943464-171943486 AGATGAAGCCTCCAGGTAGCAGG - Intronic
917411807 1:174766911-174766933 AGGTGAAGCCTCCAGATAGCAGG - Intronic
917458395 1:175205536-175205558 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
917530713 1:175832623-175832645 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
918427251 1:184423421-184423443 GAATGAAGCCTTCAAATACTGGG + Intronic
918543369 1:185655444-185655466 AGAGCAAGCCTGCAAATTGCAGG - Intergenic
918802573 1:188990668-188990690 AGATGAAGCCTGCTGGTAGCTGG - Intergenic
919426626 1:197440657-197440679 AGAGGAAGACAGAAAATAGTGGG + Intronic
919465132 1:197916710-197916732 GGATGAAGCCAGCATCTAGTAGG + Intronic
922067844 1:222161116-222161138 AGATGAAGCCTCTAAGTAGCAGG - Intergenic
922166348 1:223118629-223118651 AGATGAAGCCTCCAGGTAGCAGG + Intronic
922166550 1:223120265-223120287 AGATGAAGCCTCCAGGTAGCAGG - Intronic
922356347 1:224779907-224779929 AGATAAAGCCTGCAAGTAGCAGG - Intergenic
922404692 1:225299722-225299744 AGAAGAAGCCTGGAAAGTGTGGG - Intronic
922758826 1:228111588-228111610 AGATGAAGCCTTCAGGTATTAGG + Intergenic
922979963 1:229817288-229817310 AGAGGAAGCCTTCAGGTAGTAGG - Intergenic
923066379 1:230521122-230521144 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
923666147 1:236000311-236000333 AGATGAAGCCTCCAGGTAGGCGG - Intronic
923769845 1:236928908-236928930 AGATGAAGCCTCCAGGTAGCCGG - Intergenic
924573225 1:245257035-245257057 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1062953250 10:1521609-1521631 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1063018568 10:2102873-2102895 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1064160831 10:12944291-12944313 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1064359336 10:14649469-14649491 AGATGAAGCCTCCAGATAGCAGG - Intronic
1065365671 10:24934524-24934546 AGATGAAGCCTTCAGGTAGCAGG - Intronic
1066956747 10:42180060-42180082 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1067266038 10:44746067-44746089 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1067341455 10:45408510-45408532 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1067538389 10:47134111-47134133 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
1067856317 10:49796633-49796655 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1068047522 10:51906654-51906676 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1068139778 10:52991334-52991356 AGACCAATCCTGCAAATAGTTGG - Intergenic
1068177197 10:53476794-53476816 AGATGAAGCCTCCAGGTAGTAGG + Intergenic
1068418996 10:56764591-56764613 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1069196820 10:65561351-65561373 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1069543209 10:69311105-69311127 AGATGAAGCCTCCAGATAGCAGG + Intronic
1069732425 10:70626160-70626182 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1070171827 10:73938731-73938753 AAATGAAGCCTCCAGATAGCAGG - Intergenic
1070430803 10:76335791-76335813 AGATGAAGCCTACAGGTAGCAGG + Intronic
1071012120 10:80951724-80951746 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1071032125 10:81197242-81197264 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1071235746 10:83646253-83646275 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1071426890 10:85566235-85566257 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1071666034 10:87559499-87559521 AGATGAAGCCTCCATGTAGCAGG - Intergenic
1071826032 10:89327190-89327212 AGATGAAGCCTCCAAGTAGCAGG + Intronic
1071863075 10:89695895-89695917 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1071959455 10:90795979-90796001 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1073396037 10:103218378-103218400 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1074463059 10:113656157-113656179 AGATGAAGCCTCCAAGCAGCAGG - Intronic
1074840442 10:117345803-117345825 AGAGGAAGCCTTCAGGTAGTAGG + Intronic
1074840643 10:117347261-117347283 AGAGGAAGCCTTCAGGTAGTAGG - Intronic
1075226121 10:120630797-120630819 AGATGGAGCCTTCAGGTAGTAGG - Intergenic
1075350077 10:121716131-121716153 AGATGAAGCCTCCACGTAGCAGG + Intergenic
1076378676 10:130010375-130010397 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1076812040 10:132891700-132891722 AGATGAAGCCTCCAGGTAGCCGG - Intronic
1077211423 11:1372473-1372495 AGGTGAAGCCTCCCAATGGTTGG - Intergenic
1077558562 11:3240763-3240785 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1077782920 11:5351588-5351610 AGATGTAGGCTGCCAATAATGGG - Exonic
1079163714 11:18017011-18017033 AGATGAAGCCTCCAGATGGCAGG - Intergenic
1079483982 11:20914490-20914512 AGATGAAGCCTCTAAATAGCAGG + Intronic
1080010489 11:27454026-27454048 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1080650931 11:34222245-34222267 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1080873319 11:36256012-36256034 AGAGGAAGCCTTCAGATGGTAGG + Intergenic
1080882389 11:36334480-36334502 AGCTGAAGCCAGCAAATACTTGG - Intronic
1080988856 11:37505956-37505978 AAATGAATCCTCCAAGTAGTAGG - Intergenic
1081154091 11:39667619-39667641 ATATGAAGCCTCCAAGTAGCAGG - Intergenic
1082689478 11:56282305-56282327 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1082718561 11:56644723-56644745 AGATGAGGCCAGCAAAGTGTGGG + Intergenic
1083105922 11:60358704-60358726 AGATGAAGCCTTCAGGTAGCAGG + Intronic
1084365491 11:68694927-68694949 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1084614833 11:70228786-70228808 AGATGAAGGCTTCAAGTAGTAGG - Intergenic
1085423961 11:76386581-76386603 TGATGATGTCTGCAAATAGCAGG - Intronic
1085710341 11:78823595-78823617 AGCTGAAGCCTGGAAAGAGGCGG + Intronic
1086033067 11:82383780-82383802 AGATGAATCCTGCCAAGACTGGG - Intergenic
1086039215 11:82454913-82454935 AGATGAAGCCTCCAACTAAAGGG + Intergenic
1086283081 11:85213557-85213579 AGATGAAGCCTACAGGTAGCAGG + Intronic
1086390418 11:86357615-86357637 AGATGAAGCCTGTAAGTAACAGG - Intergenic
1087648897 11:100841243-100841265 AGATAAAAGCTGCAAATATTTGG + Intronic
1087701948 11:101444795-101444817 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1088087150 11:105994986-105995008 AGAGGAAGCCTTCAGGTAGTAGG + Intergenic
1088129300 11:106467763-106467785 AGAGGAAGCCTTCAGGTAGTAGG - Intergenic
1088578598 11:111296524-111296546 AGATGAAGCCTGAAAGCACTGGG + Intergenic
1091257096 11:134198227-134198249 AGAGGAAGCCTTCAGATAGTAGG - Intronic
1091362571 11:134989278-134989300 AGATGAAGGCTTCAGGTAGTAGG - Intergenic
1092040847 12:5382808-5382830 AGAAGACACCTGCAAATAGGTGG - Intergenic
1092721999 12:11450565-11450587 AGATGAAGCCTCCAAGTAGGAGG + Intronic
1092725976 12:11485926-11485948 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1093812245 12:23505173-23505195 AGATGAAGCCTCCAGGTAGCTGG - Intergenic
1093895665 12:24571814-24571836 ACATCAAGGCTGCAACTAGTTGG + Intergenic
1094212319 12:27905502-27905524 AGATGAAGCCTCTAAGTAGCAGG + Intergenic
1094360750 12:29628585-29628607 AGATGAAGCCTCCAAGTAGCAGG - Intronic
1094468372 12:30778953-30778975 AGGTGAAGCCTCCAAATAGCAGG + Intergenic
1095779603 12:46044807-46044829 AGATGAAGCTTCCAGGTAGTAGG - Intergenic
1096353923 12:50924198-50924220 AGATGAAGCCTCCAAGTAGCAGG + Intronic
1097201254 12:57280721-57280743 AGCAGAAGCCTGCAAAGAGGAGG - Intronic
1097590366 12:61567139-61567161 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1098296166 12:69006259-69006281 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1099102642 12:78460986-78461008 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1099761186 12:86922286-86922308 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1100367191 12:93932723-93932745 AGAGGAAGCCTTCAGGTAGTAGG - Intergenic
1100929740 12:99593029-99593051 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1101355898 12:103977426-103977448 GGATGAAGCCTCCACATTGTTGG - Intronic
1101462486 12:104910984-104911006 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1102416025 12:112763621-112763643 AGATGAAGCTTCCAGGTAGTAGG + Intronic
1102444367 12:112990472-112990494 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1104536023 12:129619052-129619074 AGGTGAAGCCTCCAAATAGCAGG + Intronic
1104781830 12:131426587-131426609 AGATGAAGCCTCCAGTTAGCAGG - Intergenic
1104914047 12:132255514-132255536 AGATGAAGCCTCCAGGTAGCGGG - Intronic
1105812821 13:24009714-24009736 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1106123033 13:26877739-26877761 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
1106207884 13:27616341-27616363 AGAGGAAGCCTTCAGGTAGTAGG + Intronic
1106566047 13:30885616-30885638 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1106836264 13:33638568-33638590 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1107346506 13:39467341-39467363 AGATGAATGTTGAAAATAGTTGG - Intronic
1107852740 13:44587367-44587389 AGATGAAGCCTCCAATTAACAGG + Intergenic
1108258106 13:48629921-48629943 AGAGGAAGCCTTCAGGTAGTAGG + Intergenic
1108390977 13:49947430-49947452 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1108848002 13:54698561-54698583 AATTGAAGCCTGCAACCAGTGGG + Intergenic
1109805100 13:67429378-67429400 CGATGAAGCCTCCAAGTAGCAGG - Intergenic
1110455226 13:75683927-75683949 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1110680700 13:78308847-78308869 ATATGAGGCCTGCTAATATTTGG + Intergenic
1110781288 13:79468486-79468508 GAATAAAGTCTGCAAATAGTAGG - Intergenic
1110928392 13:81184746-81184768 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1111172158 13:84541545-84541567 AGATGAAGCCTTCAGGTAGCTGG + Intergenic
1111870596 13:93826737-93826759 AAATGAAGCCTCCAAATAAGTGG - Intronic
1112619492 13:101040134-101040156 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1112691704 13:101903693-101903715 AAATGCAGCCTGAAAATAGTTGG - Intronic
1112868737 13:103942070-103942092 AGATGAAACCTCCAGATAGCAGG - Intergenic
1113481804 13:110626705-110626727 AGATGAGGCCTGAGAACAGTTGG + Intronic
1113535649 13:111064337-111064359 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1113918716 13:113891291-113891313 AGATGAAGCCTCCAGATAGCAGG - Intergenic
1113971815 13:114197056-114197078 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1113978880 13:114254917-114254939 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1114080101 14:19196368-19196390 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1114080198 14:19197237-19197259 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1114346293 14:21798819-21798841 AGATGAAGCCTCCACATAGCAGG + Intergenic
1114565664 14:23630950-23630972 AGATGAAGCCTCCAGGTAGTAGG + Intronic
1114742900 14:25116342-25116364 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1114773981 14:25460661-25460683 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1115933504 14:38525703-38525725 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1118264219 14:64279007-64279029 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1118380390 14:65213207-65213229 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1118510278 14:66464424-66464446 TGAGGAAGCCTGCAGGTAGTGGG - Intergenic
1119789638 14:77338396-77338418 AGATGAAGCCTCCAGGTAGCAGG - Exonic
1120357802 14:83456724-83456746 AGATGAAGCCTCTAATTAGCAGG - Intergenic
1120402026 14:84044075-84044097 AGATGAAGCCTCCATGTAGCAGG - Intergenic
1120407309 14:84105246-84105268 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1120622277 14:86778667-86778689 AGATGAAACCTCCAAGTAGCAGG + Intergenic
1121377097 14:93422370-93422392 AGATGAAGCCTCCAGGTAGCTGG + Intronic
1121424983 14:93843976-93843998 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1122640951 14:103158996-103159018 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1122915929 14:104858976-104858998 AGATGGAGCGTGGAAATGGTGGG - Intergenic
1122916145 14:104859862-104859884 AGATGGAGCGTGGAAATGGTGGG - Intergenic
1122916221 14:104860222-104860244 AGATGGAGCATGGAAATGGTGGG - Intergenic
1202936371 14_KI270725v1_random:91700-91722 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1123888942 15:24756306-24756328 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1124064249 15:26325095-26325117 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1124075937 15:26444247-26444269 AGATGAAGCCTTTAAGTAGCAGG + Intergenic
1124210249 15:27757438-27757460 AACTGAAGCTTGCATATAGTAGG + Intronic
1124230675 15:27943558-27943580 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1124664214 15:31578369-31578391 AGATGAAGCCTTCAGGTAGCAGG - Intronic
1124821987 15:33055154-33055176 AGTTGAAGCCTCCAGATAGCAGG - Intronic
1126288542 15:47044558-47044580 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1126946046 15:53821695-53821717 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1127305807 15:57704880-57704902 AGATGAAGCCTCCAGTTAGCAGG - Intronic
1127947016 15:63765543-63765565 AGATGAAGCCTCCAAGTAGCAGG - Intronic
1128902640 15:71438637-71438659 AGAGGGAGCCTCAAAATAGTGGG - Intronic
1129648536 15:77461511-77461533 AGATCAAGGGTGCAAATAGAAGG + Intronic
1129797921 15:78392066-78392088 AGATAAAGGCTGCAAATGGTGGG - Intergenic
1130769273 15:86907836-86907858 AGATGAAACCTGCAATTACTTGG - Intronic
1130889765 15:88123841-88123863 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1131465008 15:92647906-92647928 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1135236446 16:20760881-20760903 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1135638297 16:24097903-24097925 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1135912568 16:26574805-26574827 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1138576429 16:57910249-57910271 AGATGAAGCCTCTAAATAGCGGG - Intronic
1138600461 16:58051140-58051162 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1138632324 16:58307837-58307859 AGATGAAGCCTCCAGATAGCAGG - Intronic
1138633304 16:58316632-58316654 AGATAAAGCCTCCAGGTAGTAGG - Intronic
1140056191 16:71527828-71527850 AGAGGAAGCCTTCAGATAGCAGG + Intronic
1141030574 16:80584266-80584288 AGTTGAAGCCTCCAGGTAGTAGG - Intergenic
1141259724 16:82441521-82441543 AGAGGAAGCCTCCAAGTAGCAGG + Intergenic
1143887926 17:10079484-10079506 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1144951170 17:18994306-18994328 TGCTGCAGCCTGGAAATAGTGGG - Intronic
1144962078 17:19050177-19050199 AGATGAAGCCTCCAGGTAGCTGG + Intergenic
1144973083 17:19124344-19124366 AGATGAAGCCTCCAGGTAGCTGG - Intergenic
1145243967 17:21255654-21255676 AGATGAAGCCTCTAAGTAGCAGG + Intergenic
1145747446 17:27330994-27331016 AGACGAAGCCTCCAAGTAGCAGG + Intergenic
1146146599 17:30424273-30424295 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1146720078 17:35117984-35118006 AGGTAATGCCTGCACATAGTAGG + Intronic
1148951804 17:51319811-51319833 AGATGAAGCCTCCAGGTAGCTGG + Intergenic
1150740487 17:67775529-67775551 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
1151357472 17:73568861-73568883 ACATGAAGCCTGCAGAGAGGTGG - Intronic
1152306272 17:79522483-79522505 AAATGTACCCTGAAAATAGTTGG - Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153121908 18:1739062-1739084 AGATAAAGCCTCCAGGTAGTAGG + Intergenic
1153345375 18:4020107-4020129 AGATGAAGCCTCCAAGTAGCAGG + Intronic
1153607885 18:6853366-6853388 AGATGAAGCCTCCAAGTAGCAGG - Intronic
1153837533 18:8977350-8977372 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1153982017 18:10318282-10318304 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1154464097 18:14626722-14626744 AAATGAAGCCTGAGAATAGCAGG + Intergenic
1155526340 18:26719835-26719857 AGAAAATGCCTGCATATAGTAGG + Intergenic
1156082650 18:33356963-33356985 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1156133228 18:34004010-34004032 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1157498982 18:48177002-48177024 AGATGATGCCTGCAAGAACTTGG + Intronic
1157671853 18:49537037-49537059 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1157954732 18:52084268-52084290 AGATGAAGTCTCCAAGTAGCAGG - Intergenic
1158122888 18:54069912-54069934 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1158167375 18:54555575-54555597 AGATAAAGCCTCCAGATAGTAGG + Intergenic
1158917742 18:62152239-62152261 AGAGGAACCCTTCAGATAGTAGG + Intronic
1159670454 18:71214809-71214831 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1159745407 18:72228481-72228503 AGATGAAGCCTCCAAGTAACAGG - Intergenic
1160548372 18:79677428-79677450 AGGTGAGGCCTGCAAACAGCAGG + Intergenic
1165257168 19:34585075-34585097 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1165597642 19:37024073-37024095 AGATGAAGCCTCCAAGTAGCAGG - Intronic
1165854643 19:38871994-38872016 AGATGGAGACTCCAAAGAGTGGG - Intronic
1165916269 19:39262824-39262846 AGATGAAGCCTCCAGATAGCAGG - Intergenic
1166037662 19:40180875-40180897 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1168519968 19:57042116-57042138 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
925186422 2:1849733-1849755 AAATGAAGCATGCAACTTGTGGG - Intronic
925509613 2:4610879-4610901 AGATGAAGCCTTCAGGTAGCTGG + Intergenic
927746238 2:25624062-25624084 AGATGAAGCCTGCAAATAGTAGG - Intronic
927748746 2:25646520-25646542 AGATGAAGCCTCCAGGTAGCAGG - Intronic
928519197 2:32071808-32071830 AGATGAAGCCTCCAGGTAGCAGG + Intronic
928604811 2:32935916-32935938 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
928671591 2:33608758-33608780 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
929211901 2:39366416-39366438 AGATGAAACCTCCAGGTAGTAGG + Intronic
930023274 2:47014233-47014255 ACAGGAAGCCTACATATAGTAGG + Intronic
930150107 2:48050775-48050797 AGATGAAGCCTCCAGATAGCAGG + Intergenic
930164194 2:48187687-48187709 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
930285491 2:49422739-49422761 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
930707270 2:54517037-54517059 AGATGAGGCCTCCAAGTAGCAGG + Intronic
932549306 2:72751437-72751459 AGATGAAGCCGCCAAGTAGCAGG + Intronic
933079911 2:77972818-77972840 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
933527807 2:83465730-83465752 AGCTGAAGCCTCCAAATAGAAGG - Intergenic
933536816 2:83585708-83585730 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
934247542 2:90321060-90321082 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
934304823 2:91812520-91812542 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
934328434 2:92040230-92040252 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
934466814 2:94270745-94270767 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
935481275 2:103593276-103593298 AGATGGAGCCTACAATTAATCGG + Intergenic
935654932 2:105413995-105414017 AGATGCCGCTTGCAAATAGTAGG + Intronic
936653474 2:114456832-114456854 ATATGAAGCCAGCATAAAGTGGG + Intronic
937764646 2:125645974-125645996 ATTTGTAGCCAGCAAATAGTTGG + Intergenic
937951548 2:127391775-127391797 GGATGAAGCCTCCAGATAGCAGG + Intergenic
938142103 2:128803136-128803158 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
938933950 2:136112319-136112341 ACATTAAGCCTGCAACTAGGGGG - Intergenic
939423077 2:141998858-141998880 AGATGAAGCCTCCAGGTAGCAGG + Intronic
939500476 2:142977020-142977042 AGATGAAGCCTCCAAGTAGCAGG + Intronic
939710284 2:145509045-145509067 TGATGAAGCCTGCTAAGACTGGG + Intergenic
941386312 2:164856843-164856865 AGATGAGGCCTGCCATGAGTAGG + Intergenic
941529925 2:166655470-166655492 AGATGAGGCCTGCAGGTAGCAGG + Intergenic
941907990 2:170735505-170735527 AGATGAAGCCTCCAGCTAGCAGG - Intergenic
941928565 2:170919029-170919051 AGATGAAGTCTCCAAGTAGCAGG + Intergenic
942294053 2:174500441-174500463 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
942936391 2:181561731-181561753 AGATGAAGCCTCCAGATATCAGG - Intronic
943081304 2:183261506-183261528 AGATAAAGCATGCAGATTGTAGG - Intergenic
943309287 2:186306936-186306958 AGATGAAGCCTCTAGGTAGTAGG - Intergenic
943657261 2:190522711-190522733 AGATGAAGCCTCCAGGTAGCAGG - Intronic
943702498 2:191001808-191001830 AGATGTACCCTGCACATACTAGG + Intronic
943750162 2:191502430-191502452 AGATGAAGCCTCCAGGTAGCCGG + Intergenic
944124971 2:196282688-196282710 AGATGAAGCCTCCAGGTAGCAGG + Intronic
944659715 2:201911275-201911297 AGATAAAGCCTCCAAGTAGCAGG + Intergenic
944661124 2:201922808-201922830 AGATGAAGCCACCAAGTAGCAGG - Intergenic
945111369 2:206363347-206363369 AGAGGAAGCCTGCAAGTAGAAGG - Intergenic
945884863 2:215364404-215364426 AGAAGCAGCCTGAGAATAGTAGG + Intronic
947226919 2:227849474-227849496 AGATGAAGCCTCTAAGTAGCAGG - Intergenic
948091069 2:235296230-235296252 AGATGAAGCCTCCAGATAGCAGG + Intergenic
948717922 2:239877479-239877501 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1170930668 20:20767419-20767441 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1170936637 20:20815867-20815889 AGATGAAGTCTCTAAGTAGTAGG + Intergenic
1171206492 20:23285643-23285665 AGATGAAGCCAGAACCTAGTGGG - Intergenic
1171235610 20:23521844-23521866 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1172566865 20:35937547-35937569 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1173888133 20:46479795-46479817 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1174119400 20:48251163-48251185 AGATGAAGCCTCCAGGTAATGGG - Intergenic
1174128494 20:48325938-48325960 TGATGAAGAGTGCAAAGAGTCGG + Intergenic
1174143451 20:48433468-48433490 AGATGAAGCCTCCAAGTAGCTGG - Intergenic
1174296824 20:49551356-49551378 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1174591224 20:51646669-51646691 AGATCAGGTCTGGAAATAGTAGG - Intronic
1176362848 21:6012564-6012586 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1176587126 21:8597899-8597921 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1176692586 21:9934031-9934053 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
1176810434 21:13531664-13531686 AAATGAAGCCTGAGAATAGCAGG - Intergenic
1176902537 21:14460786-14460808 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1177003182 21:15638768-15638790 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1177255840 21:18662033-18662055 AGAGGAAGCCTTCAGATAGCAGG - Intergenic
1177701123 21:24640666-24640688 AGATGAAGCCTCTAAGTAGCCGG - Intergenic
1178247477 21:30967898-30967920 AGATGAAGCCTCCAAATAGCAGG + Intergenic
1178513091 21:33223443-33223465 AGATGAAGCCTCCAAGTAGCTGG + Intergenic
1178525882 21:33328241-33328263 AGATGAGGCCTGCAGATAGCAGG + Intronic
1179731633 21:43371379-43371401 AGATGAAGCCTCCAGATAGCAGG - Intergenic
1179760670 21:43525981-43526003 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1180269957 22:10574896-10574918 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1180500576 22:15925447-15925469 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1180500673 22:15926332-15926354 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1180587951 22:16909967-16909989 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1181121899 22:20674494-20674516 AAATGAAGCCTGAGAATAGCAGG - Intergenic
1181334695 22:22118475-22118497 AAATGAAGCCTGAGAATAGCAGG + Intergenic
1182501408 22:30750645-30750667 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1182501682 22:30752607-30752629 AGATGAAGCCTCCAAGTAGCAGG + Intronic
1183103115 22:35596085-35596107 AGATGAAGCCTCCACGTAGCAGG - Intergenic
1184338641 22:43872554-43872576 AGATGAAGCCTCCAGATAGCAGG - Intergenic
949107741 3:220930-220952 AGATGAGGCCTCCAGGTAGTAGG - Intronic
949604691 3:5640012-5640034 AGCTGAAGCCTTCAAGTGGTGGG - Intergenic
949677803 3:6477682-6477704 AGAGGAATCCTGGAAAGAGTAGG - Intergenic
950155102 3:10716117-10716139 AGATGGAGGCTGCAGACAGTTGG + Intergenic
950999303 3:17539275-17539297 AGATGAAGCCTCCAGGTAGCAGG + Intronic
951773844 3:26286841-26286863 AGATGAAGCCTCCACGTAGCAGG - Intergenic
952202258 3:31142723-31142745 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
953178114 3:40570424-40570446 AGATGAAGCCTCCAGGTAGCAGG + Intronic
953505422 3:43481644-43481666 AGATGAAGCCTCCAGATAGTGGG - Intronic
953747839 3:45588604-45588626 AGATGAAGCCTCCAGGTAGCAGG + Intronic
954650088 3:52155772-52155794 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
954830827 3:53419825-53419847 AAATAAACCCTGCAAACAGTTGG - Intergenic
954923493 3:54212502-54212524 AGATGAAGCCTCTAAGTAGCAGG + Intronic
956307782 3:67845372-67845394 AGATGAAGCCTCCAGATAGCAGG + Intergenic
957305245 3:78449426-78449448 AGATGAAACCTTCAAGTAGCAGG - Intergenic
957443519 3:80284984-80285006 AAATGTAGCCTGCAAATAAAGGG - Intergenic
957576842 3:82018604-82018626 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
959241294 3:103798070-103798092 AGATGAAGCCTCTAAATAACAGG + Intergenic
959752840 3:109858744-109858766 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
960110155 3:113837997-113838019 AGATGCAGCCTCCAAGTAGCAGG + Intronic
960371741 3:116849358-116849380 AGATGAAGCCTCTAAGTAGCAGG - Intronic
961323051 3:126091584-126091606 AGATGAAGCCTCCAGGTAGCAGG + Intronic
961344150 3:126250903-126250925 AGATGAGGCCTCCAAGTAGCAGG - Intergenic
961394090 3:126574128-126574150 AGATGAAGCCTCCAGGTAGCAGG - Intronic
961541653 3:127604386-127604408 CGATGAAGCCTTAAAATAGAAGG - Intronic
962272382 3:133987351-133987373 AGATGAAGCCTCCAGGTAGCCGG - Intronic
962272494 3:133988250-133988272 AGAGGAAGCCTTCAAGTAGTAGG - Intronic
962467739 3:135675873-135675895 AGAGGAAGCCTTCAGGTAGTAGG - Intergenic
962739828 3:138355320-138355342 AGGAGAAGGCTGCAAACAGTTGG - Intronic
963756368 3:149238888-149238910 AGATGAAGCCTCCACCTAGCAGG + Intergenic
965091642 3:164170497-164170519 AGATGAAGCCTCCAAGCAGTAGG + Intergenic
965969643 3:174538672-174538694 AGATGAAGCCTCCAGGTAGCAGG - Intronic
969095748 4:4731390-4731412 AGCTGAAGCCTCCAAGTAGCAGG + Intergenic
969198982 4:5586601-5586623 AGATGAAGCCTCCAGGTAGCAGG - Intronic
969346356 4:6572958-6572980 AGATGAAGCCTCCAGTTAGCAGG - Intergenic
969667414 4:8568205-8568227 AGATGAAGCCTCCAGGTAGCAGG + Intronic
969915008 4:10482294-10482316 ACATGAAGCCTGGAAATGCTGGG + Intergenic
969918182 4:10510676-10510698 AGATGAAGCCTTCAGGTAGCAGG - Intronic
970205693 4:13653663-13653685 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
970400505 4:15712803-15712825 AGATGAAACCTACAGGTAGTGGG - Intronic
970822582 4:20235660-20235682 GGATGAAAGCTGGAAATAGTTGG - Intergenic
971076388 4:23153866-23153888 ACATGAAGCCTCCAGGTAGTAGG - Intergenic
971117645 4:23666570-23666592 AGTTGAAGGCTTCAAATAATTGG + Intergenic
971851704 4:31993127-31993149 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
972303236 4:37806077-37806099 AGATGAAGCCTACAGGTAGCAGG - Intergenic
973971452 4:56217585-56217607 AGATGGAGCCTCCAGATAGCAGG + Intronic
974043644 4:56879134-56879156 AGAAGAACCCTTCAAGTAGTTGG + Intergenic
974479923 4:62430045-62430067 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
975029100 4:69591491-69591513 AGAGGAAGCCTTCAGGTAGTAGG + Intronic
975240574 4:72052793-72052815 AGATGAAGCCTCCAGGTAGCAGG - Intronic
975484988 4:74926040-74926062 AGATGAAGCCTCCATGTAGCAGG + Intergenic
975614939 4:76236834-76236856 AGAGGAAGCCTTCAGGTAGTAGG + Intronic
975797631 4:78025745-78025767 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
976008703 4:80461170-80461192 AGATGAAGCCTCCAGGTAGCAGG + Intronic
976347403 4:84020592-84020614 AGATGAAGCCTGCATGTAGCAGG - Intergenic
977874633 4:102134433-102134455 AAACGAAGCTTGCAAATAGAGGG + Intergenic
977992916 4:103466335-103466357 AGATGAAGCCTCCAGGTAATAGG + Intergenic
978377628 4:108092484-108092506 AGAGGAAGCCTGCAGATTTTTGG - Intronic
978490865 4:109310521-109310543 AGATGAAGCCTCCAGGCAGTAGG - Intergenic
979183708 4:117760465-117760487 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
979910626 4:126361519-126361541 AGATGAAGCCTTCAAGCAGCAGG - Intergenic
980242305 4:130192191-130192213 AGAAGAAGACAGCAAATTGTGGG - Intergenic
980259839 4:130433976-130433998 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
980329773 4:131395605-131395627 AGATGAAGCCTCTAAGTAGTAGG - Intergenic
980365169 4:131794243-131794265 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
980571445 4:134625386-134625408 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
980816316 4:137951055-137951077 AGATGAAGCCTCCAGATAGCAGG - Intergenic
980908795 4:138975381-138975403 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
980984993 4:139686311-139686333 AGAGGAAGCCTTCAGATGGTAGG + Intronic
981091998 4:140741767-140741789 AGATGAAGCCTCCAGATAGCAGG - Intronic
981110080 4:140925265-140925287 AGGTGAAGCCTGCAAACTGGTGG - Intronic
981189669 4:141847406-141847428 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
981629514 4:146802412-146802434 AGATGAAGTCTTCAAAAAATTGG - Intronic
981630496 4:146813613-146813635 ATATGAAGCCAGAAAATATTGGG + Intronic
981903274 4:149891173-149891195 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
982009455 4:151092726-151092748 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
982428337 4:155293504-155293526 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
983710781 4:170713049-170713071 AGATGAAGCCTCCAAGTAACAGG - Intergenic
983863785 4:172738973-172738995 AGATGAAGCCTCCAGGTAGCAGG + Intronic
984008276 4:174339918-174339940 AGATGAAGCCTCCAGGTAGTAGG + Intergenic
984495122 4:180487282-180487304 AAATGATGCCTGCAACTTGTAGG - Intergenic
985218419 4:187676858-187676880 AGAAGAGGGCTGCAAACAGTGGG + Intergenic
985348965 4:189037394-189037416 ACATAAGGCCTGCCAATAGTAGG + Intergenic
986027166 5:3861763-3861785 AGCTTCAGCCTGCAAATTGTTGG + Intergenic
986219330 5:5753409-5753431 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
987542279 5:19271061-19271083 AGATGAAGCATCCAAGTAGCAGG + Intergenic
988731743 5:33979392-33979414 AGATGAAGCCTCCATGTAGCAGG + Intronic
988831266 5:34989623-34989645 AGATGAAGCCTCCAAGTAACAGG - Intergenic
989183972 5:38605050-38605072 AGATGAAGCCTTCAAGTAACAGG + Intronic
989564055 5:42883902-42883924 AGATGAAGCCTCCAGGTAGCAGG - Intronic
989592338 5:43122762-43122784 AGATGGAGCTTCCAAATATTAGG + Intronic
990717911 5:58659410-58659432 ACATGATGCCTGCAAATAACTGG - Intronic
990759723 5:59115033-59115055 AGATGCAGCCATCAAAGAGTAGG + Intronic
990763939 5:59161499-59161521 AGATGAAGCCTCCAGGTAGCAGG + Intronic
991202154 5:64006968-64006990 AGTTGAAGCCTCTAAATAGCAGG - Intergenic
991314254 5:65282397-65282419 AGATGAAGCCTCCAGGTAGCAGG + Intronic
992108027 5:73466458-73466480 AGATGAAGCCTCCAGATGGCAGG + Intergenic
992283034 5:75201844-75201866 AGATGAAGCTTACAGATAGCAGG - Intronic
992541904 5:77774430-77774452 AGATGAAGCCTCCAGGTAGCAGG - Intronic
992583678 5:78209339-78209361 AGATAAAGCCTCCAGGTAGTAGG - Intronic
992812513 5:80403635-80403657 AGATAAAGGCTGAAAACAGTAGG + Intergenic
993652851 5:90542985-90543007 AGATGAAGCCTCCAGGTAGCAGG + Intronic
993722294 5:91333668-91333690 AGATGAAGCCTCCATGTAGCAGG - Intergenic
994572841 5:101535994-101536016 AGAAGAAACCTGAAAATAGGTGG + Intergenic
994829375 5:104759493-104759515 AGATGAAGCCTCCACTTAGCAGG - Intergenic
995083435 5:108080844-108080866 AGATGAAGCCTCCAAGTAGCAGG + Intronic
995245137 5:109926834-109926856 AAATGAAACCTGGAAATAATTGG + Intergenic
995285696 5:110385831-110385853 AGATGAAACCTCCAAGTAGCAGG - Intronic
995596870 5:113756720-113756742 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
995741400 5:115359429-115359451 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
996063427 5:119056238-119056260 AGAGGAAGCCTTCAAATAGCAGG + Intronic
996865956 5:128122035-128122057 AGATGAAGACTGTAAATTCTTGG + Intronic
997507073 5:134426039-134426061 AGAGTAAGCCTGCAACTCGTAGG - Intergenic
998032596 5:138884335-138884357 AGATGAAGCCTCCAGGTAGTAGG + Intronic
998271118 5:140707622-140707644 AGATGAAGCCTGTAACTTGCTGG + Intergenic
999458440 5:151737281-151737303 AGATGACGCGTGCACATAGAAGG - Intergenic
999668816 5:153940427-153940449 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1000061439 5:157659938-157659960 AGATAAAGCCTCCAGATAGTAGG + Intronic
1000113338 5:158130026-158130048 TGCTGAAGGCTGCACATAGTGGG - Intergenic
1000657128 5:163893067-163893089 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1000743560 5:165001087-165001109 AGAGGAAGACTGCACACAGTGGG + Intergenic
1001152229 5:169241972-169241994 AGATAGAGCCTGGAAATAATAGG - Intronic
1001282464 5:170396746-170396768 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1001339232 5:170828326-170828348 AGATGAAGCCTCCAGGTAATAGG - Intergenic
1001877738 5:175215930-175215952 AAAAGAAGCCTGCCAATCGTCGG - Intergenic
1002070810 5:176678076-176678098 AAAGGAAGCATGCATATAGTAGG + Intergenic
1002325697 5:178404148-178404170 AGATGCTGCCTGCACACAGTAGG - Intronic
1002371884 5:178761413-178761435 AGGTGAAGCCTCCAGGTAGTAGG + Intergenic
1002410273 5:179069275-179069297 AGATGAAACCTCCAAGTAGCAGG - Intronic
1002869646 6:1155585-1155607 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1003040438 6:2682833-2682855 AGATGGAACATGCAAATATTAGG + Intronic
1003100840 6:3175423-3175445 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1003321376 6:5055046-5055068 AGATGAAGCCTCCAAATAGCAGG - Intergenic
1003639535 6:7864900-7864922 TGATGAAGTCTGCCAATGGTAGG + Intronic
1004200889 6:13546923-13546945 AGATGAAGCCTCCAGGTAGGAGG - Intergenic
1004646996 6:17571755-17571777 AGATGAAACCTCCAGATAGCAGG - Intergenic
1005331836 6:24758193-24758215 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1005491890 6:26354748-26354770 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1006018659 6:31103582-31103604 TGATGAATCCTGCAAGTACTGGG + Intergenic
1006234039 6:32611846-32611868 GGATGAAGCCTCCAAGTAGCAGG - Intergenic
1006702250 6:35984991-35985013 AAATGAAGCCTCCAAGTAGCAGG - Intronic
1006993777 6:38238794-38238816 AGGTGAAGCCTCCAAGTAGTAGG + Intronic
1007240523 6:40421576-40421598 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1008078024 6:47166345-47166367 ACATGAAGCCTGGAGCTAGTTGG - Intergenic
1008291700 6:49723667-49723689 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1008476053 6:51937057-51937079 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1008649907 6:53551536-53551558 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1008730271 6:54473678-54473700 ACATGAAGCCTCCAAGTAGCAGG - Intergenic
1009346446 6:62617516-62617538 AGATAAAGCCTCCAGGTAGTAGG - Intergenic
1009579291 6:65511445-65511467 AGATGAAGCAAGCAAAGAGAAGG - Intronic
1010397477 6:75408738-75408760 AGATCAAGTCTGCCCATAGTAGG - Intronic
1011400509 6:86956336-86956358 AGATGAATCCTCCAAGTAGCAGG - Intronic
1011750651 6:90451511-90451533 AGATGAAGACTCCAAGTAGCAGG - Intergenic
1012306280 6:97662025-97662047 AGATGAAGCTTACAAAGAATGGG - Intergenic
1012530847 6:100234426-100234448 AGAAGAAGTCTGCAAAGAGGTGG - Intergenic
1012901851 6:105015432-105015454 AGATGTAGACGGCAAAGAGTCGG + Intronic
1013419214 6:109950917-109950939 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1013475971 6:110507684-110507706 AGAGGAAGCCTGCAGGTAGTCGG - Intergenic
1013888158 6:114996385-114996407 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1013921900 6:115415583-115415605 AGATGAAGCCTACAAGTAGCAGG + Intergenic
1014171953 6:118288571-118288593 AGATGAAGCCTCCAAGTAGCAGG + Intronic
1015078788 6:129197325-129197347 AGATGAAGCCTCAAGGTAGTAGG - Intronic
1015167178 6:130211161-130211183 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1015216230 6:130753273-130753295 TGAAGAAGCATGCAGATAGTAGG - Intergenic
1015824440 6:137296654-137296676 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1015986665 6:138891445-138891467 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1016048713 6:139506985-139507007 AGATGAGAGCTGAAAATAGTGGG - Intergenic
1016280834 6:142416598-142416620 ATATGAAGCCTGCAAAAATAAGG - Intronic
1016374052 6:143402487-143402509 AGATGAAACCTCCAAGTAGCAGG + Intergenic
1016521520 6:144951913-144951935 AGATGAAGCCTGCAGGTAGCAGG - Intergenic
1016854877 6:148657382-148657404 AGAGGAAGCCTTCAAGTACTAGG + Intergenic
1016920691 6:149290033-149290055 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1017359308 6:153547353-153547375 AGATGAAGCCTCCAGATAGCAGG - Intergenic
1018155589 6:160982593-160982615 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1018486918 6:164249964-164249986 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1018780293 6:167057668-167057690 AGATGAAGCCTCCAGATAGCAGG + Intergenic
1019041803 6:169112106-169112128 AGATGAAGCCTCCAGGTAGCGGG - Intergenic
1019150096 6:169999790-169999812 AGACGAAGCCTCCAAGTAGCAGG - Intergenic
1019946831 7:4336651-4336673 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1020424310 7:8046500-8046522 AGAAGAAGCCTCCAGATAGCAGG - Intronic
1020680777 7:11234052-11234074 AGATGAAGCCTCCAGTTAGCAGG + Intergenic
1020753990 7:12178150-12178172 AGATGAAGCCTCTATTTAGTAGG + Intergenic
1021796043 7:24255418-24255440 AGATGAAACCTGGAATGAGTAGG + Intergenic
1022677484 7:32513399-32513421 AGATGAAGCCTCCAAGTATCAGG - Intronic
1022679194 7:32528025-32528047 AGATGAAGCCTCCAAGTATCAGG - Intronic
1024191596 7:47017053-47017075 AGATGAAGCCTTCAGATAGCAGG + Intergenic
1024276449 7:47680843-47680865 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1024928768 7:54647117-54647139 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1024949083 7:54839694-54839716 AGATGCAGCCTGCAGATGGGAGG - Intergenic
1026210103 7:68296481-68296503 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1026537979 7:71256043-71256065 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1026563076 7:71466643-71466665 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1026898242 7:74022817-74022839 AGATGGAGCCTGGAGATAGTAGG - Intergenic
1027869837 7:83693402-83693424 AGATGAAACCTCCAGGTAGTAGG + Intergenic
1028788574 7:94826295-94826317 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1029500933 7:100929275-100929297 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1030283864 7:107804748-107804770 AAATGATGTCTGCAAAGAGTGGG - Intergenic
1030825821 7:114156370-114156392 AGATGAAGCCTCCAGGTAGCTGG - Intronic
1030877426 7:114832317-114832339 AGATGAAGCCTACAAGTAGAAGG + Intergenic
1031188798 7:118519437-118519459 GGATGAAGCCTCCAAGTAGCAGG + Intergenic
1031424514 7:121589015-121589037 AGATGAAGCCTACAGGTAGCAGG - Intergenic
1031810423 7:126361059-126361081 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1032674295 7:134114239-134114261 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1033027915 7:137794432-137794454 AGATGAAGCTAGCAAATTGCAGG + Intronic
1034334682 7:150313473-150313495 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1034429024 7:151031429-151031451 AGATGAAGACTGCAATTAGAAGG + Intronic
1034681665 7:152933574-152933596 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1035430568 7:158817302-158817324 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1036057949 8:5280754-5280776 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1036636685 8:10555582-10555604 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1037174718 8:15933088-15933110 AGATGAAGCCTCCAGACAGCAGG + Intergenic
1037653346 8:20861030-20861052 AGATGAAGCCTCCAGATACCAGG - Intergenic
1038293896 8:26273576-26273598 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1038739493 8:30204454-30204476 AGATGAAGCCTCCACGTAGCAGG + Intergenic
1039685312 8:39795416-39795438 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1039736170 8:40335288-40335310 AGAGGAAGCCTTCAGGTAGTAGG + Intergenic
1039757388 8:40538180-40538202 AGAGGAAGCCTTCAGATAGTAGG - Intronic
1039799374 8:40941030-40941052 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1040020874 8:42739805-42739827 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
1040055657 8:43055364-43055386 AGATGAAGCCTCCAAGTAACAGG + Intronic
1040089990 8:43387846-43387868 AGATGAAGCCTCTAGATAGCAGG - Intergenic
1040361067 8:46664962-46664984 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1040401893 8:47059657-47059679 AGATGAAGCCTCTAGATAGCAGG + Intergenic
1040921859 8:52629677-52629699 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1040927835 8:52703301-52703323 AGATGGAATCTGCAGATAGTAGG - Intronic
1040945162 8:52876668-52876690 GGATGAAGCCTCTAAGTAGTAGG + Intergenic
1041676479 8:60545114-60545136 TGACGAATCCTGCAATTAGTGGG + Intronic
1041854947 8:62440988-62441010 AGATGAAGCCTTCAAAATGGAGG - Intronic
1042361214 8:67885303-67885325 AGATGAAGCCTCCAGGTAGTAGG + Intergenic
1042364052 8:67916170-67916192 AGATAAAACCTGCAAATACTTGG - Intergenic
1042451340 8:68950479-68950501 TAAAGAAGCCTGCAAACAGTAGG + Intergenic
1042661646 8:71161044-71161066 ATATGAAGGCTATAAATAGTGGG - Intergenic
1042820315 8:72923176-72923198 AGATGAAGCCTTCAGGTAGAAGG + Intronic
1042933497 8:74035710-74035732 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1042979058 8:74505491-74505513 AGATGAAGCCTCCAGGTAGCTGG - Intergenic
1043535298 8:81196673-81196695 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1043734870 8:83730160-83730182 AATTGCAGCCTGCAACTAGTGGG + Intergenic
1043749189 8:83914167-83914189 AGAGGAAGCTTACAAAAAGTTGG - Intergenic
1043947903 8:86275087-86275109 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1043948639 8:86282789-86282811 AGATGAAGCCTCCAGGTAGGAGG + Intronic
1044031431 8:87242381-87242403 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1044211932 8:89560758-89560780 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1044309458 8:90676898-90676920 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1044593831 8:93939863-93939885 AGATGAAGCCTCCAGGTAGTAGG + Intergenic
1045644239 8:104284570-104284592 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1045660666 8:104434266-104434288 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1045753575 8:105514866-105514888 ATATCGAGCCTGCACATAGTAGG + Intronic
1046332964 8:112746128-112746150 AGATGTAGCCTCCAGATATTTGG + Intronic
1047055168 8:121155830-121155852 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1047113927 8:121819408-121819430 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1048621466 8:136137502-136137524 AGATGAAGCCTTCAGGTAGCAGG - Intergenic
1048777912 8:137967831-137967853 AGATGAAGCCTGCAGGTAGCAGG - Intergenic
1049454402 8:142679755-142679777 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1049460453 8:142725020-142725042 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1049467603 8:142759220-142759242 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1049870237 8:144969335-144969357 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1049959944 9:728701-728723 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1050636493 9:7618346-7618368 AGATGAAGCCTCCATATAGCAGG - Intergenic
1050793848 9:9510942-9510964 AGATGGAGGCTGAAAGTAGTGGG + Intronic
1050995092 9:12207314-12207336 AGAGGAAGCCTCCACGTAGTAGG + Intergenic
1051050531 9:12927292-12927314 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1051857718 9:21588501-21588523 CTAAGAAGCCTGCAATTAGTTGG + Intergenic
1052520385 9:29540168-29540190 ATATAGAGCCTGAAAATAGTAGG + Intergenic
1052613921 9:30813343-30813365 AGCTGAAGCCTCCAAGTAGCAGG - Intergenic
1053629528 9:39920096-39920118 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
1053776239 9:41543451-41543473 AGATGAAGCTTGCAGGTAGCAGG + Intergenic
1053943258 9:43277678-43277700 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1054214359 9:62330606-62330628 AGATGAAGCTTGCAGGTAGCAGG + Intergenic
1054308115 9:63446778-63446800 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1054365494 9:64335039-64335061 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
1054406849 9:64770769-64770791 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1054440473 9:65256235-65256257 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1054489934 9:65765689-65765711 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1054673124 9:67824752-67824774 AGATGAAGCTTGCAGGTAGCAGG - Intergenic
1055045643 9:71921311-71921333 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1055233688 9:74092430-74092452 AGATGAAGTCTGTAAGTAGCAGG - Intergenic
1055776832 9:79775418-79775440 AGATAAAGCCTCCAGATAGCAGG + Intergenic
1055787909 9:79890603-79890625 AAATGAAGCCAGCACATAGTAGG - Intergenic
1055832734 9:80401410-80401432 AGATGAAGCCTCCATATAGCTGG - Intergenic
1055902486 9:81257204-81257226 AGGTGATGCTTGCAAATAGATGG - Intergenic
1056034450 9:82588782-82588804 AAATGAAGCCAGAAAATATTTGG - Intergenic
1056920104 9:90779925-90779947 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1056921257 9:90791239-90791261 ACATGAAGCCTCCAAGTAGCAGG + Intergenic
1057580028 9:96279501-96279523 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1058125483 9:101189364-101189386 AGATGAAGCCTCCAGGTAGCAGG + Intronic
1058301096 9:103373812-103373834 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1058306958 9:103455475-103455497 AACTGAAGTCTGCAAATAATTGG + Intergenic
1058784904 9:108377457-108377479 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1058990724 9:110253726-110253748 ACATGAAGCCTGCACATACGTGG - Intronic
1060163245 9:121386587-121386609 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1202779316 9_KI270717v1_random:21204-21226 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1203586378 Un_KI270747v1:7583-7605 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1203617084 Un_KI270749v1:75614-75636 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1185655215 X:1678987-1679009 AGATGAAGCCAGCAGGTAGCAGG + Intergenic
1185662480 X:1738329-1738351 AGATGAAGCCTCCAGATAGCAGG + Intergenic
1185839617 X:3376448-3376470 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1185975139 X:4711653-4711675 AGATGCAGCCTCCAAGTAGCAGG + Intergenic
1186007525 X:5089737-5089759 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1186152816 X:6693123-6693145 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1186329715 X:8519087-8519109 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1186811955 X:13199032-13199054 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1186830020 X:13380882-13380904 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1187057333 X:15753424-15753446 AGATGAAGCCTCCCAGTAGCAGG + Intronic
1187324624 X:18274909-18274931 AGATGAAACCTGCAGGTAGCAGG - Intronic
1187369035 X:18688974-18688996 AGATGAAGCCTTCAGGTAGCAGG + Intronic
1187467433 X:19539904-19539926 CTGTGAAGCCTGCAAATAGTTGG - Intronic
1188375487 X:29423069-29423091 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1188521470 X:31042905-31042927 AGATGAAGTCTCCAAGTAGTAGG + Intergenic
1188560514 X:31462904-31462926 AGATAAAGCCTGCAAAAACTGGG + Intronic
1188838355 X:34986148-34986170 AGATGAAGCCAATAAATTGTGGG - Intergenic
1188909005 X:35822778-35822800 TGATGAAGCCTCCAAGTAGCAGG - Intergenic
1188937777 X:36198415-36198437 AGATGAAGTCTTCAGATAGCAGG + Intergenic
1188968781 X:36587157-36587179 AGACTAAGCCTGAAAAGAGTTGG - Intergenic
1190867024 X:54393342-54393364 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1190902519 X:54691650-54691672 AGAAGGAGCCTGCTACTAGTGGG + Intergenic
1191021654 X:55867093-55867115 AGAGGAAGCCTTCAGATAGTAGG + Intergenic
1192065564 X:67881093-67881115 AGATGAAGGCTTCAAGTAGCAGG + Intergenic
1192180600 X:68913432-68913454 GGATAAAGCCTCCAAATAGGGGG - Intergenic
1192732043 X:73810186-73810208 AGATGAAGCCTCCAGGTAGGAGG - Intergenic
1192970429 X:76222489-76222511 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
1193240975 X:79168856-79168878 TAATGAAGCTTGCATATAGTAGG + Intergenic
1193486692 X:82092333-82092355 AGATGAAGCCTCCAAGTAGCAGG + Intergenic
1193621566 X:83758591-83758613 AGAGGAAGTCTTCAAAAAGTTGG - Intergenic
1193666781 X:84329107-84329129 AGATGAAGGCTCCAGGTAGTAGG + Intronic
1193709679 X:84863678-84863700 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1193974642 X:88102346-88102368 AGATAAAGCCTCCAGATAGCAGG - Intergenic
1194262225 X:91710441-91710463 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1194341627 X:92712926-92712948 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1194483038 X:94450724-94450746 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1194802920 X:98293855-98293877 AGATGAGGCCTCCAAGTAGCAGG + Intergenic
1195014689 X:100766550-100766572 TGATGAAGCCTGCCAGGAGTGGG + Intergenic
1195258728 X:103113126-103113148 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1195291929 X:103438018-103438040 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1195566566 X:106345960-106345982 AGATGAAGCCTCCAGATAGCAGG + Intergenic
1196302000 X:114058494-114058516 GGATGAAGCCTCCAAGTAGCAGG - Intergenic
1196833756 X:119796464-119796486 AAAAGAAGTCTGCAAATTGTTGG - Intergenic
1198058522 X:133019969-133019991 AGATGAAGCATGAAAATAAGAGG + Intergenic
1198123644 X:133620719-133620741 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1198258477 X:134945723-134945745 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1198276861 X:135102948-135102970 AGATGAAGCCTTCAGGTAGCAGG + Intergenic
1198982870 X:142419159-142419181 AGATGAACCCTCCAAATAGCAGG - Intergenic
1199336765 X:146627754-146627776 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1199381023 X:147172753-147172775 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1200286622 X:154828901-154828923 AGATGAGGTCAGGAAATAGTTGG - Intronic
1200293368 X:154892986-154893008 AGATGAAGCCTCCAGGTAGCAGG - Intronic
1200392417 X:155957451-155957473 AGATGAAGCCTCCAAGTAGCAGG - Intergenic
1200581519 Y:4955274-4955296 AGATGAAGCCTCCAGGTAGCCGG + Intergenic
1201260710 Y:12156546-12156568 AGATGAAGCCTCCAGGTAGCAGG + Intergenic
1201319191 Y:12678409-12678431 TGATGAAGCCTCCAGGTAGTAGG + Intergenic
1201348646 Y:13014220-13014242 AGATGAAGCCTCCAGGTAGCAGG - Intergenic
1201701416 Y:16886420-16886442 AGAGGAAGCCTCCAAGTAGCAGG - Intergenic