ID: 927749700

View in Genome Browser
Species Human (GRCh38)
Location 2:25656593-25656615
Sequence GTTGAAATGGGAAAAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 511}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927749700 Original CRISPR GTTGAAATGGGAAAAGAGGG TGG (reversed) Intronic
902106892 1:14045029-14045051 GATGCAATGTGAAAAGAGAGAGG + Intergenic
902973554 1:20072466-20072488 GATGAAAAGGGAACAGGGGGAGG + Intronic
903063728 1:20686893-20686915 GTTGAAAAGGGAGAAGATGTTGG + Intronic
903147069 1:21381200-21381222 GTGGAAGGGGGAATAGAGGGTGG - Intergenic
903207703 1:21795297-21795319 GTGGAGAGGGGACAAGAGGGTGG + Intergenic
903443098 1:23402928-23402950 GCTGAAATGTGGAAAGAGGAAGG + Intronic
903493141 1:23744196-23744218 GTTGGAATTGAAAAAGAGGCGGG + Intronic
904255852 1:29254398-29254420 GTTGAAATGAGAAAGAGGGGAGG - Intronic
904939735 1:34157335-34157357 GAGGAAATGGGAAGTGAGGGAGG - Intronic
906378575 1:45316878-45316900 GATGAAGGGGGAAAGGAGGGTGG - Intergenic
908089989 1:60675930-60675952 GTTGAAATGAGAAAATAAAGTGG + Intergenic
908358472 1:63344908-63344930 GAGGAAAGGGGGAAAGAGGGAGG + Intergenic
908750695 1:67420154-67420176 GTTGAAGAGGTAAAAGAGGAGGG - Exonic
908888240 1:68814604-68814626 GTTCAAATGTGAAAAGTGGCTGG + Intergenic
909052909 1:70788936-70788958 TTTGAAATGGGAAAAGAAAGGGG + Intergenic
909737690 1:78984906-78984928 GATAAAAAGGAAAAAGAGGGAGG + Intronic
910607256 1:89100446-89100468 GGTGAAAAGGGAAAAAAGAGGGG + Intergenic
910985686 1:93002667-93002689 GTGGGAATGGGAATAGAGGGAGG - Intergenic
911018585 1:93363168-93363190 GTTAAGATGGGGAAAGAGGAGGG - Exonic
911454933 1:98110910-98110932 GTAGAAATGGTAAAGCAGGGAGG - Intergenic
911627417 1:100140782-100140804 GTTCAAATGGGAAAACAGCAAGG - Intronic
912229218 1:107773296-107773318 CTTGAAATATGAAAAGTGGGAGG - Intronic
912564425 1:110576316-110576338 GTTGTACTGGGAAATGATGGAGG - Intergenic
912871593 1:113311555-113311577 GTGGAAATGGGAAATAAGAGGGG + Intergenic
913062111 1:115218033-115218055 GTTGAAAAGAGAAAAGGGTGTGG + Intergenic
913153137 1:116065648-116065670 GTGGAAAAGGGAGAAGGGGGAGG - Intronic
913474869 1:119227519-119227541 TTAGAAATGGGAAAGAAGGGAGG + Intergenic
915240947 1:154521301-154521323 GCTGAAAAGGGAAGAGAGAGAGG - Exonic
915623285 1:157099105-157099127 GCTGACATGGCCAAAGAGGGGGG - Intronic
915847172 1:159278731-159278753 GTTGAAAGCAGAAAAGTGGGTGG - Intergenic
915938587 1:160103844-160103866 GGTGGTATGGGGAAAGAGGGAGG + Intergenic
916156709 1:161857171-161857193 GTTGAAATGAGAAAAGAAAAAGG - Intronic
916320840 1:163502069-163502091 GTTGAAGAGTGAAAAGAGGAGGG - Intergenic
916539743 1:165741455-165741477 GTTTAAAAGGAAGAAGAGGGAGG + Intronic
916582671 1:166122814-166122836 GTGGAAATGGCCAAAGAAGGGGG - Intronic
916681104 1:167105906-167105928 TTGTAAATGAGAAAAGAGGGGGG - Intronic
916988264 1:170214713-170214735 GTGGAAAGGGGAAACGTGGGTGG + Intergenic
917237450 1:172909643-172909665 GAAAAAATGCGAAAAGAGGGAGG - Intergenic
917689154 1:177449673-177449695 GTTTTAAAGGGAAAAAAGGGAGG - Intergenic
919071569 1:192762410-192762432 TTAGAAATTTGAAAAGAGGGCGG - Intergenic
919563712 1:199157459-199157481 GTGCAAATGGGAAGAAAGGGTGG + Intergenic
919799960 1:201348067-201348089 GTGGAAATGGGGAGAGAGTGTGG + Intergenic
919887401 1:201944797-201944819 GTAGCAATGGGAAAGAAGGGAGG - Intronic
920643684 1:207779854-207779876 GTTCAAAGGAGAAAAGAGGATGG - Intronic
921096752 1:211893405-211893427 GCTGAGATGGGGAATGAGGGAGG + Intergenic
921650362 1:217671348-217671370 GGAGAAGTGGGATAAGAGGGTGG - Intronic
921812144 1:219527322-219527344 TTCCAAATGGGAAAAAAGGGGGG - Intergenic
921890026 1:220344494-220344516 GTTGAAATGTGAATGGAGGATGG + Intergenic
922559141 1:226555431-226555453 GCTGAGATGGGGAAAGAGGAGGG - Intronic
922676758 1:227558388-227558410 GATGAAAGGGGTAAACAGGGAGG - Intergenic
922995876 1:229960723-229960745 GTCGAAATGGGAAAAAAGACAGG + Intergenic
923771229 1:236939311-236939333 GGTGAAAAAGGAAAAGAGGGAGG - Intergenic
924400098 1:243670993-243671015 GTTTAAATGGCTAAAGAGGTTGG - Intronic
924628770 1:245717179-245717201 GCTGTAATGGGAAGATAGGGAGG + Intergenic
924949647 1:248870748-248870770 GGTGGAATGAGGAAAGAGGGTGG + Intergenic
1062935375 10:1381964-1381986 CTTGAAATGGGATAAAAGAGTGG + Intronic
1063228138 10:4035177-4035199 ATTTAAAAGGGAAAAGTGGGAGG - Intergenic
1063325543 10:5097926-5097948 CTTGAAATGGGGAGAGATGGTGG - Intronic
1063942636 10:11146156-11146178 GTAGTAAATGGAAAAGAGGGAGG - Intronic
1064669863 10:17701723-17701745 ATTGAAAAGGGAGAGGAGGGGGG - Intronic
1065812631 10:29456298-29456320 GTTAAAATGGGAAAGCAGGGGGG - Intergenic
1065830525 10:29610076-29610098 GTGGAAATGAGAAAAGGGTGAGG - Intronic
1065959050 10:30719248-30719270 GCTGAAATAGGAAAGCAGGGGGG + Intergenic
1066079496 10:31916311-31916333 GTTGAAACGTGGAAAAAGGGAGG - Intronic
1066659422 10:37726176-37726198 CGTGAGAGGGGAAAAGAGGGTGG - Intergenic
1067878412 10:50024206-50024228 GATGGAGAGGGAAAAGAGGGTGG - Intergenic
1067878482 10:50024503-50024525 GATGGAGCGGGAAAAGAGGGTGG - Intergenic
1067893240 10:50153425-50153447 GATGGAGCGGGAAAAGAGGGTGG + Intergenic
1067893310 10:50153722-50153744 GATGGAGAGGGAAAAGAGGGTGG + Intergenic
1068194112 10:53694197-53694219 GTTGAAATAAGAAAAGATGTAGG - Intergenic
1068219466 10:54025858-54025880 GATAAAATGGAAAAAGATGGAGG - Intronic
1068461174 10:57330965-57330987 GTGCAAATGGGAAATGAGTGTGG - Intergenic
1068558243 10:58482148-58482170 GTTGAAAGGTGGAAAGAAGGAGG - Intergenic
1068780339 10:60912939-60912961 GTTAAACTGAGAAAAGTGGGTGG + Intronic
1068932107 10:62602076-62602098 ATTGAAGAGGGAATAGAGGGTGG + Intronic
1069580090 10:69559909-69559931 CTGGAAAGGGGAAAAGACGGAGG + Intergenic
1071270259 10:84000554-84000576 GTGGACATGGGATAAAAGGGAGG - Intergenic
1071869805 10:89781369-89781391 GTAGAAGTGAGAAAAGAGTGAGG - Intergenic
1072258785 10:93646963-93646985 GCGGAAAGGGGCAAAGAGGGTGG + Intronic
1073367827 10:102958396-102958418 GTTTATATTGGAAAAGAGGATGG - Intronic
1073671151 10:105591583-105591605 GGTGAAATGAGAAAAGAGGCAGG - Intergenic
1074776499 10:116771452-116771474 GCTGAAATGGGAACTGAGGAAGG + Intergenic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075508894 10:123052639-123052661 GGTGAAATGTGAAAAGAGAATGG - Intronic
1078158706 11:8821216-8821238 GTTCTAAGGAGAAAAGAGGGTGG + Intronic
1078742263 11:14077977-14077999 GTAGAAATGGGGAGAGAGGGCGG + Intronic
1078883038 11:15472040-15472062 TTTGCAATGGGAGAAGAGAGAGG - Intergenic
1078945525 11:16064249-16064271 GATAAAATGGGAATTGAGGGGGG + Intronic
1080022122 11:27573217-27573239 GTTGCTATGGGAAAACATGGTGG + Intergenic
1080231382 11:30020279-30020301 ATTTAAATGGGCAAAGAGGTAGG - Intergenic
1080592865 11:33738624-33738646 ATTGAAATGGTAAAATAGGCAGG - Intergenic
1080941240 11:36921232-36921254 GGTGAAAAGGGAAAAAAGTGGGG + Intergenic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1082185616 11:49177211-49177233 GTGAAAAAGGGAAAAGAGAGAGG - Intronic
1082973171 11:59044573-59044595 GTTAAAATGGGAAAAATTGGAGG + Intergenic
1082977567 11:59088139-59088161 GTTAAAATGGGAAAAATAGGAGG + Intergenic
1083537941 11:63489310-63489332 GATGAAAAGGGAAAGGAGGAAGG - Intronic
1085095702 11:73759722-73759744 GTTGAAAAGAGAAAAAGGGGAGG + Intronic
1085428147 11:76423102-76423124 ATTGAGGTGGGAAAAGATGGAGG + Intergenic
1085962240 11:81475580-81475602 GAAGAAAAGGGAAAAGAGAGAGG - Intergenic
1086990504 11:93298303-93298325 GTTGAAATGAAAACAGAGAGAGG + Intergenic
1087575005 11:99978834-99978856 GTTTATATGGGAAGAGAGGTAGG + Intronic
1088540953 11:110913184-110913206 GTTGAAAATGGAAAAGAAGTTGG - Intergenic
1089033046 11:115353757-115353779 CTTGCATTGGGAAAGGAGGGTGG + Intronic
1090549778 11:127807159-127807181 GATGAGGTGGGGAAAGAGGGAGG - Intergenic
1090627654 11:128620123-128620145 TTTGAAATGGCAAAACAGGGTGG - Intergenic
1090647699 11:128778908-128778930 GTAGAAATCGGAGAAGAGGAGGG + Intronic
1090937170 11:131353598-131353620 GAAGAAAAGGGAAAAGAGGTAGG - Intergenic
1092829750 12:12432279-12432301 ATTGAAAGAGGAAAAGAGGAAGG - Intronic
1093015311 12:14149229-14149251 GTTGAGATGGGAAATTGGGGAGG + Intergenic
1093719351 12:22420635-22420657 GTGGAAATGTGACAAGAGAGAGG - Intronic
1093719850 12:22427275-22427297 GTGGAAATGTGACAAGAGAGAGG - Intronic
1093722549 12:22461739-22461761 GATGAAGAGGGAAAAAAGGGAGG + Intronic
1094635968 12:32227350-32227372 GTAAGAATGGGCAAAGAGGGTGG + Intronic
1095478794 12:42612251-42612273 GTCAAAAGGGGAAAAGAGAGTGG - Intergenic
1095778230 12:46032641-46032663 TTTGAACTGGGAAAAAAAGGCGG - Intergenic
1095822398 12:46492675-46492697 CTTGAAATGGGGAAAGAGGAAGG + Intergenic
1096037176 12:48482634-48482656 GTGGGAGTGGGAAAAGTGGGAGG + Intronic
1096824310 12:54263062-54263084 ATTGAGATGAGAAAAGAGGCTGG + Intronic
1096949309 12:55448771-55448793 GATGTACTGGAAAAAGAGGGAGG + Intergenic
1097309412 12:58102198-58102220 GGTGAGGTGGGAAAAGAGGCAGG - Intergenic
1098172729 12:67763034-67763056 GGTGAAATGGGGGTAGAGGGAGG - Intergenic
1098270363 12:68764037-68764059 GTTAAGGAGGGAAAAGAGGGAGG - Intronic
1098542414 12:71671495-71671517 GTTGATATGGCAAAAAAGGTGGG - Intronic
1098890496 12:76005539-76005561 GCTGGAAGAGGAAAAGAGGGAGG - Intergenic
1099245307 12:80186954-80186976 GATAATATGGGAAAAGAGGATGG - Intergenic
1099419791 12:82442558-82442580 GCTGAAGTAGGAAAAGAGGGTGG + Intronic
1099632911 12:85173732-85173754 GTTAAATTAGGAAATGAGGGTGG - Intronic
1099857512 12:88185224-88185246 GGTGAAAAGGGGTAAGAGGGAGG - Intronic
1099930353 12:89067118-89067140 GTTGAAAAGTGGAAAGAGGATGG + Intergenic
1100106913 12:91186487-91186509 GTAGAAATGGGAATAGAGACAGG + Intergenic
1101059711 12:100958322-100958344 AGTGAAATGGGAAAAGAGGGAGG - Intronic
1101210847 12:102534077-102534099 CTTGAAATGGGAAACAAGGAGGG - Intergenic
1101322168 12:103682161-103682183 GGGAAGATGGGAAAAGAGGGGGG + Intronic
1101326937 12:103723895-103723917 GTTGAAATGATAAAAGTTGGTGG + Intronic
1101438313 12:104683083-104683105 GTTGAAATGGCAAAAGGGGGCGG + Intronic
1101687366 12:107038153-107038175 GTGAAAATGGTAAAAGAGTGGGG + Intronic
1102101915 12:110285765-110285787 GCTGACATGGGAAACGACGGTGG - Intronic
1102111923 12:110371436-110371458 GTTGAAAAGTGAAAAATGGGAGG + Intergenic
1102283120 12:111634064-111634086 ATTGAAGTGGGAAAGGAGAGAGG + Intergenic
1103633492 12:122282869-122282891 GTAGGAAAGGGAAAAGAGAGGGG + Intronic
1103705523 12:122869370-122869392 GGTGAAATGAGAAAAGGAGGTGG + Intronic
1104617076 12:130279710-130279732 GTTAAAAGAGGAAAAGAGGCTGG + Intergenic
1104777163 12:131397087-131397109 TTTGAAATGTGAAAGGAGGTTGG - Intergenic
1105299444 13:19118971-19118993 GATGGAGGGGGAAAAGAGGGTGG + Intergenic
1105299548 13:19119465-19119487 GATGGAGGGGGAAAAGAGGGAGG + Intergenic
1105299579 13:19119615-19119637 GATGAAGGGGTAAAAGAGGGTGG + Intergenic
1105781978 13:23713979-23714001 GATGGAGGGGGAAAAGAGGGTGG - Intergenic
1105803974 13:23938919-23938941 GATGGAGGGGGAAAAGAGGGTGG - Intergenic
1106095953 13:26644049-26644071 CTTTAAATGGGAAAGGAGGGAGG + Intronic
1106118159 13:26834849-26834871 TTTAAAATTGGAAATGAGGGTGG + Intergenic
1107788757 13:43979885-43979907 ATGTAAAAGGGAAAAGAGGGGGG + Intergenic
1107804158 13:44138611-44138633 GTAGAAATGGAAAATGGGGGAGG + Intergenic
1107812095 13:44210325-44210347 GTGGGAATGGGAAATCAGGGAGG - Intergenic
1108391820 13:49954459-49954481 GTTGATCTGGGAAAAGGGAGTGG - Intergenic
1108437199 13:50412059-50412081 GTTGGAATGGGAAAGAAGGGAGG + Intronic
1109734606 13:66466331-66466353 GGTGAAATGGGAGAAGTGAGAGG - Intronic
1111174281 13:84572715-84572737 GAGGCAATGGGAAAAGTGGGAGG + Intergenic
1111281239 13:86028350-86028372 GTTAAAATGGGAAGACAGGCCGG + Intergenic
1111632092 13:90854605-90854627 GTAGAGATGGGAAAAGAGAAGGG - Intergenic
1112549876 13:100409426-100409448 GGTGAAAAGGGAAAAAAAGGGGG + Intronic
1112807158 13:103175542-103175564 GTGGAAAATGGAAAAGAGTGAGG - Intergenic
1112840649 13:103573395-103573417 GTAGAAAGGGGACATGAGGGTGG - Intergenic
1113599619 13:111559224-111559246 GTAGAGAGGGGAAAGGAGGGAGG + Intergenic
1114050785 14:18918796-18918818 GATGAAGGGGGAAAAGAGGTTGG - Intergenic
1114111774 14:19483126-19483148 GATGAAGGGGGAAAAGAGGTTGG + Intergenic
1114302163 14:21388015-21388037 GTTGATATGGGAAAGGCTGGTGG - Intronic
1115075238 14:29381141-29381163 GTTGAAAAAAGAAAAGGGGGTGG - Intergenic
1115495202 14:33997228-33997250 TTTGAAATAGGAAGGGAGGGAGG + Intronic
1116394701 14:44433457-44433479 GATGAACTGGGAAAGAAGGGAGG - Intergenic
1116407908 14:44587818-44587840 ATTGGAATGGGAAAAGGTGGTGG - Intergenic
1117231881 14:53728071-53728093 CTTGCAATGGGAAGAGAGGCTGG - Intergenic
1117460540 14:55940553-55940575 TGTGAAGTGTGAAAAGAGGGAGG + Intergenic
1117516807 14:56510035-56510057 GTTGAAATTGGAGGAGAGGCAGG + Intronic
1117799281 14:59426877-59426899 ATTGAAATGAGGAAAGAGGGTGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119148475 14:72337224-72337246 GTTGAAATGGGTGATGGGGGTGG - Intronic
1119818599 14:77593853-77593875 TTAGAGATGGGGAAAGAGGGAGG - Intronic
1119863942 14:77957391-77957413 GGTGAAAAAGGAAAAGTGGGAGG + Intergenic
1123122553 14:105924545-105924567 GTGAAAATGGGAGAAGAGGGTGG + Intronic
1123405205 15:20015969-20015991 GTGAAAATGGGAGAAGAGGGTGG + Intergenic
1123514534 15:21022617-21022639 GTGAAAATGGGAGAAGAGGGTGG + Intergenic
1123576235 15:21672456-21672478 ATTCAAATAGGAAGAGAGGGAGG - Intergenic
1123612857 15:22114924-22114946 ATTCAAATAGGAAGAGAGGGAGG - Intergenic
1125300958 15:38252889-38252911 GTGGAAAGGGAAAAAGAGAGGGG - Exonic
1125344717 15:38707481-38707503 GTGGAAAAGTGAAATGAGGGAGG - Intergenic
1125505261 15:40264407-40264429 TTAAAAATGGGGAAAGAGGGAGG - Intronic
1126346713 15:47702842-47702864 GTTGAGAGGGGAAAAAAGGAGGG + Intronic
1126357817 15:47814750-47814772 GATGATATGGGAATAAAGGGAGG - Intergenic
1126592177 15:50351593-50351615 GTGCAAAGGGGAAAACAGGGAGG + Intronic
1127237392 15:57069781-57069803 GAAGGAATGGGAAAAGAGAGAGG + Intronic
1127351691 15:58159240-58159262 TATGAAATGTGAAAAGTGGGAGG - Intronic
1127566549 15:60194826-60194848 GTGGAAAGGGAAAAGGAGGGGGG - Intergenic
1128456086 15:67832250-67832272 TGTGAAAGGGGAAAAGTGGGAGG - Intronic
1128624770 15:69188957-69188979 GTTGAAGTGGGAAAGGCTGGTGG - Intronic
1128946485 15:71826269-71826291 TTTGGGAAGGGAAAAGAGGGTGG + Exonic
1129028466 15:72601390-72601412 GTTGCAATAGGAGAAGAGGTAGG - Exonic
1129169926 15:73801440-73801462 GCTGAAGTTGGAAAGGAGGGAGG + Intergenic
1129240716 15:74250492-74250514 GCTGAGATGGGAAAAGGGGAAGG - Intronic
1129253839 15:74322904-74322926 GTTGAAGTGGGTGCAGAGGGTGG - Intronic
1130538498 15:84803646-84803668 GGTAAAAAGGGAAAAGGGGGTGG + Exonic
1130619014 15:85441844-85441866 ACTGAATTGGGAGAAGAGGGAGG + Intronic
1130898923 15:88192501-88192523 GTTGAAGAGGGAAAGCAGGGAGG - Intronic
1131615677 15:94014826-94014848 GTTGAGAGGGGAAAAGGGGAGGG + Intergenic
1132369185 15:101281443-101281465 GTTGAAATTGGAAATGCAGGAGG - Intergenic
1202985103 15_KI270727v1_random:406701-406723 ATTCAAATAGGAAGAGAGGGAGG - Intergenic
1133380176 16:5323311-5323333 GGTAAAATGGTAAAAGAGGAAGG - Intergenic
1133640513 16:7712544-7712566 CTTGAAAAGAGAAAAGGGGGAGG + Intronic
1133781333 16:8941488-8941510 GTTGACCTGCGAGAAGAGGGTGG - Intronic
1134680548 16:16122030-16122052 GTTGAAATGGGAATAGACCGGGG - Exonic
1135156271 16:20055542-20055564 GTTGAAATTGTTAATGAGGGTGG - Intronic
1135867632 16:26118818-26118840 GTTGAAACGGGATATGAGGTTGG + Intronic
1138349490 16:56338901-56338923 GGGGAAATGGGGAAAAAGGGAGG - Intronic
1138424347 16:56920783-56920805 GTTAAAATGGGCAAAGGGTGGGG + Intergenic
1138529849 16:57629153-57629175 GGTGAAATGGGGAAATGGGGGGG + Intronic
1139065144 16:63303711-63303733 GTTGAAATGAGATATGAAGGGGG - Intergenic
1139268644 16:65662279-65662301 GTTTAAATGGGAAGAGAGAAAGG - Intergenic
1140157275 16:72444595-72444617 GTCGAGAGGGCAAAAGAGGGAGG - Intergenic
1140855296 16:78972635-78972657 GTTGAAACAGAAACAGAGGGTGG - Intronic
1141275888 16:82587984-82588006 GTTTAGAGGGGAGAAGAGGGAGG - Intergenic
1141774566 16:86114229-86114251 GTGGAAGAGGGAAAAGAGGAAGG + Intergenic
1143545929 17:7595546-7595568 GCTGAAATGGGAAGATAGAGGGG - Intronic
1145193716 17:20868912-20868934 GATGGAGGGGGAAAAGAGGGTGG + Intronic
1145298305 17:21612192-21612214 GATGGAGGGGGAAAAGAGGGTGG - Intergenic
1145351942 17:22091136-22091158 GATGGAGGGGGAAAAGAGGGTGG + Intergenic
1145352097 17:22091894-22091916 GGGGTAAGGGGAAAAGAGGGTGG + Intergenic
1145722631 17:27088207-27088229 GATGAAGGGGGAAAAGAGGGTGG - Intergenic
1145722756 17:27088843-27088865 GATGGAGGGGGAAAAGAGGGTGG - Intergenic
1146937837 17:36823754-36823776 GCTGAAATCTGAAAAGAGGAAGG + Intergenic
1147003126 17:37379382-37379404 GGTGAGATTGGAAAAGAGGAAGG + Exonic
1150647551 17:66988760-66988782 GTTGAAAAGGCAAAGGAGGCAGG + Intronic
1150840788 17:68603655-68603677 GTAGAGATGGAAAAGGAGGGAGG - Intergenic
1151144333 17:72026962-72026984 TTTGAAGGGGAAAAAGAGGGTGG + Intergenic
1151256044 17:72877459-72877481 GTTAAAATGGGCAAAAAGCGGGG + Intronic
1151295924 17:73186122-73186144 GTGGAAATGGAAAAAGAGCAGGG + Intergenic
1151362013 17:73594466-73594488 GAGGAGATGGGAAGAGAGGGAGG + Intronic
1151765480 17:76131340-76131362 GTGGAAGTGAGAACAGAGGGAGG - Intergenic
1152061301 17:78077668-78077690 GTTGCCATGAGGAAAGAGGGTGG - Intronic
1153178460 18:2405833-2405855 GAGGAAATGGGATAGGAGGGAGG + Intergenic
1153517305 18:5916113-5916135 GATGAAATGGGAGAAAAGTGGGG + Intergenic
1153697853 18:7662573-7662595 GTGGTAGTGGGGAAAGAGGGAGG + Intronic
1154459173 18:14562522-14562544 ATTCAAATAGGAAGAGAGGGAGG - Intergenic
1154465625 18:14641145-14641167 GATGCAGCGGGAAAAGAGGGTGG - Intergenic
1154484819 18:14865246-14865268 GATGGAGAGGGAAAAGAGGGTGG - Intergenic
1156550535 18:38011805-38011827 GATGAGGTGGGATAAGAGGGAGG + Intergenic
1156661557 18:39351874-39351896 GTTGACATGTGGAAAGAGAGAGG + Intergenic
1156698977 18:39800216-39800238 GTAAAAAGGGGAAAAAAGGGGGG + Intergenic
1157285502 18:46374684-46374706 GTTGAAGGGGGAAAAGATGGGGG - Intronic
1157989310 18:52475876-52475898 GTTGGAATGGGAGCAGATGGAGG - Intronic
1158179451 18:54697528-54697550 TTTAAAATGGTAAATGAGGGAGG - Intergenic
1159134886 18:64326252-64326274 GGTGAAAAGGGAAAAAAAGGGGG + Intergenic
1159193648 18:65083220-65083242 TTTGAAAAGGTAAAAGAGAGAGG - Intergenic
1159562051 18:70006561-70006583 ATTCTAATGGGAAAAGAGGGGGG - Intronic
1159849370 18:73508808-73508830 GTGGAAAGGGAGAAAGAGGGTGG - Intergenic
1159989741 18:74890741-74890763 ATTTGAATGGGAAAAGAGAGAGG + Intronic
1160054169 18:75464067-75464089 GTGGAAAGGGGAAAAAAAGGGGG - Intergenic
1160349768 18:78166874-78166896 GTTAAAATAGTAAAAGAAGGGGG - Intergenic
1161369913 19:3905320-3905342 GCAGGAATGGGAAGAGAGGGTGG - Intronic
1162098137 19:8322925-8322947 GGAGAGAGGGGAAAAGAGGGGGG + Exonic
1162834138 19:13305105-13305127 TGAGAAAAGGGAAAAGAGGGTGG + Intronic
1163748672 19:19062845-19062867 GTTTCATTTGGAAAAGAGGGGGG - Intergenic
1165263329 19:34639251-34639273 GGTGAATTGGGAACACAGGGAGG - Intronic
1165592908 19:36986447-36986469 GTCAAAATGGGAACAGAGAGGGG - Intronic
1166165268 19:40983236-40983258 GGGGCAATGGGAAGAGAGGGGGG + Intergenic
1166315967 19:41990170-41990192 GTTGAAACAGGAAAAGAGACAGG - Intronic
1166333176 19:42090403-42090425 CTTCAAAGGGGAAAAGAGGGAGG + Exonic
1167269918 19:48500911-48500933 GGTGATGTGGGAAACGAGGGGGG + Intronic
1168475871 19:56674728-56674750 GTTAAAATGAGTAAATAGGGTGG + Intergenic
925239676 2:2312840-2312862 GGAGAAATGGGAAGAAAGGGGGG + Intronic
925438546 2:3863582-3863604 GTTGAAATGGGTGGAGTGGGCGG + Intergenic
926634697 2:15166804-15166826 GTTGAAATAAAAAAGGAGGGTGG + Intergenic
926745602 2:16154543-16154565 ATGGAAATGGGGACAGAGGGTGG - Intergenic
927749700 2:25656593-25656615 GTTGAAATGGGAAAAGAGGGTGG - Intronic
928402401 2:30988466-30988488 GAAGAACTGGGAAAGGAGGGAGG + Intronic
928991306 2:37235195-37235217 GTTGAAAAGGGAGAAGGGTGAGG + Intronic
929223352 2:39487966-39487988 GAGGAAAGGGGAAAAAAGGGAGG - Intergenic
930158720 2:48131294-48131316 GTTGGAATGAGGAAAGAGAGCGG + Intergenic
931097161 2:58954075-58954097 ATTCACATAGGAAAAGAGGGAGG - Intergenic
931692476 2:64846892-64846914 TTTAAAATGTGAAAAAAGGGAGG - Intergenic
932242065 2:70165039-70165061 GTTGTGAAGGGAAGAGAGGGAGG - Intronic
932294214 2:70610591-70610613 GAAGAAAGAGGAAAAGAGGGTGG + Intronic
932880856 2:75500733-75500755 GTTGAAAAGGGGAGGGAGGGAGG - Intronic
933523546 2:83406162-83406184 GTTGAAATGAAAAAAAATGGTGG + Intergenic
934511243 2:94946355-94946377 GATGAAGGGGGAAAAGAGGATGG - Intergenic
934511373 2:94946967-94946989 GATGAAGGGGGAAAAGAGGGTGG - Intergenic
935326438 2:101941761-101941783 TCTGAAATGTGGAAAGAGGGTGG - Intergenic
935579245 2:104742350-104742372 GGTAAAATGGGACAAGAGGTTGG - Intergenic
935874929 2:107496159-107496181 GTTGAAGTGGGGAGAGAGGCCGG - Intergenic
937273844 2:120671825-120671847 GTTGAGAAGGGAAGGGAGGGAGG + Intergenic
937727830 2:125187841-125187863 TTTAAAAGGGGAAAAAAGGGGGG + Intergenic
938310064 2:130283983-130284005 GGGGGAAGGGGAAAAGAGGGTGG + Intergenic
938444855 2:131368386-131368408 GGGGGAAGGGGAAAAGAGGGTGG - Intergenic
939254926 2:139730579-139730601 GTCTGGATGGGAAAAGAGGGAGG - Intergenic
940003180 2:148987440-148987462 GTTGAAATTGCAAAAGAGAGGGG + Intronic
940559770 2:155280895-155280917 GTGGAAAGGGGAAAAAAGAGTGG - Intergenic
940612807 2:156011525-156011547 GTTGAAAAGGAAAAAAAAGGAGG - Intergenic
941181256 2:162262077-162262099 TTAGAAATGGGAATAGAGGGAGG - Intergenic
943141415 2:183987268-183987290 GGTGAACTGGGAAAAGAAGATGG - Intergenic
943206051 2:184897417-184897439 ATGGAAAGGGGAAAAAAGGGGGG - Intronic
943679741 2:190755701-190755723 GTTAATAATGGAAAAGAGGGAGG - Intergenic
943736358 2:191359889-191359911 TTTCAAATGGGAAAGGAGGAAGG - Intronic
944059895 2:195561629-195561651 GGGGACATGGGAAAAGAGAGAGG + Intergenic
944099906 2:196013200-196013222 ATTTAAACAGGAAAAGAGGGAGG + Intronic
944880046 2:204003544-204003566 GAAGAAATGGAAAAAGTGGGAGG + Intergenic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
945478829 2:210320673-210320695 GTTGAAATTGGAAAAATGTGTGG - Intergenic
945697509 2:213126270-213126292 GAAGAAATGGGAAAAGTGGTAGG - Intronic
946038043 2:216759612-216759634 CTTGAAATGGTAAAATAGGCTGG - Intergenic
947030131 2:225783270-225783292 GTGGAAAGGGGAAAGGAAGGAGG - Intergenic
947296055 2:228631805-228631827 GTTAAAATAGGAAAAGGGTGGGG + Intergenic
947407522 2:229795178-229795200 GTGGAAATGGGACAGGAGGCAGG - Exonic
1169188519 20:3641292-3641314 TTAAAAATGGGAAAAGAGGCCGG + Intronic
1169943278 20:10961153-10961175 GTAGAAATGGGGCAAGAGAGAGG - Intergenic
1170083348 20:12501308-12501330 GTTGAACTGAGGAAAGAGGATGG - Intergenic
1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG + Intronic
1174598006 20:51700222-51700244 TTAGAAATGGGTAAAGAGGCCGG + Intronic
1174821841 20:53733247-53733269 GGTGAAATGAGAATAGAGGTTGG + Intergenic
1176796508 21:13374229-13374251 GATGGAGAGGGAAAAGAGGGTGG + Intergenic
1176808932 21:13517337-13517359 GATGCAGCGGGAAAAGAGGGTGG + Intergenic
1176814967 21:13590822-13590844 ATTCAAATAGGAAGAGAGGGAGG + Intergenic
1177005667 21:15669274-15669296 GGTGAGATGGGAGAAGAGAGTGG + Intergenic
1177051259 21:16237763-16237785 GTGGGAAGGGGAAAAGTGGGAGG + Intergenic
1177413896 21:20770126-20770148 ATAGAAATGGGCAAAGATGGTGG - Intergenic
1178378393 21:32087723-32087745 GTTACAAGGGGAAAAGAGGCAGG - Intergenic
1178395080 21:32235830-32235852 GATAAAATGGGAAAAGAGGAAGG + Intergenic
1179258158 21:39735913-39735935 GTTGAAATGGGCGAAGATTGTGG - Intergenic
1179336150 21:40456468-40456490 TTTCAAATGGGAAAATAGGCAGG + Intronic
1180469262 22:15641171-15641193 GATGAAGGGGGAAAAGAGGTTGG - Intergenic
1181119698 22:20657704-20657726 GATAGAAGGGGAAAAGAGGGTGG + Intergenic
1181119773 22:20657997-20658019 GATGGAGGGGGAAAAGAGGGTGG + Intergenic
1181335075 22:22123245-22123267 GATGGAGGGGGAAAAGAGGGTGG - Intergenic
1182280252 22:29214301-29214323 GTGGAGATGGGAAAGGATGGAGG + Intronic
1182927694 22:34141444-34141466 GTTGCGAGGGGAAAAGAGAGAGG - Intergenic
1184527631 22:45034933-45034955 GAGGAAATGAGAAAGGAGGGAGG + Intergenic
949151244 3:770219-770241 ATTGAAATGTGAAAGGAGGAAGG + Intergenic
949207099 3:1453362-1453384 GTTGAAAAAGGAAAGGAGGAAGG + Intergenic
949950385 3:9224333-9224355 GTGGAAAAGGGAATAGAGGGAGG + Intronic
950159780 3:10751584-10751606 GTTGAAGAGTGTAAAGAGGGTGG - Intergenic
950305507 3:11912988-11913010 GTTGAAGGGGGAAAAAATGGTGG - Intergenic
951193773 3:19802197-19802219 GGTGAAAAGGGAAAAAAAGGAGG + Intergenic
951769090 3:26234978-26235000 TTTGAAGTGGGAATAGAGGCAGG - Intergenic
952334771 3:32394181-32394203 GGAGAAGTGGGAAAATAGGGAGG - Intronic
952355181 3:32577466-32577488 GTTAAAATAGGAAAGGAGTGGGG - Intergenic
952467876 3:33610351-33610373 GTTTCAGTGGGAAAAGAAGGTGG - Intronic
952832457 3:37576523-37576545 GTTGAGGTGGGAAGAGAGTGAGG + Intronic
953072884 3:39540432-39540454 GGTGGAATGGGAAAGGGGGGAGG - Intergenic
955969247 3:64420524-64420546 GTTGTGATGGGAAAAGTGAGGGG + Intronic
956551653 3:70467550-70467572 GTAGGGATGGGGAAAGAGGGTGG - Intergenic
956851432 3:73231651-73231673 GGTGACCTGGGAAAAGAGGGAGG - Intergenic
957290707 3:78274319-78274341 GTAGCAGTGGGAAAAGAAGGCGG - Intergenic
958015385 3:87934347-87934369 GTTGGAATGGGGACAGAGGGTGG - Intergenic
958139578 3:89544191-89544213 GTTGCTATGGGAAATGATGGGGG + Intergenic
960412567 3:117345812-117345834 TGTGAAAGGGAAAAAGAGGGAGG - Intergenic
961306759 3:125963276-125963298 TTTGTAGTGGGATAAGAGGGAGG + Intergenic
961542484 3:127609359-127609381 TTTGAAATTGGAACAGAGGCAGG + Intronic
962581350 3:136800689-136800711 GTTGAAAACAGAAGAGAGGGAGG + Intergenic
962755799 3:138464705-138464727 GTTGGAAGGGGAAAGGAGGTAGG - Intronic
963261059 3:143191357-143191379 GATGAGATGAGAAAAGATGGAGG - Intergenic
964696503 3:159513834-159513856 CTTGAAATGTGAAAAGAGGGAGG - Intronic
964779127 3:160315687-160315709 ATGGCAAAGGGAAAAGAGGGTGG - Intronic
965507112 3:169528984-169529006 ATTCAAATGGGAAAAAAGTGAGG - Intronic
966461704 3:180183658-180183680 GGTCAAATAGGAAAAGATGGAGG + Intergenic
966959346 3:184918023-184918045 ATTGAAATGAGATAAGATGGAGG + Intronic
967883903 3:194320436-194320458 GTTGAAAAGGGCCAGGAGGGAGG + Intergenic
968178765 3:196574227-196574249 TATGAAATGGGAAAATAGGCCGG - Intronic
968251668 3:197222260-197222282 GTGGAAAGGGGAAAGGAGTGTGG - Intronic
968252791 3:197237228-197237250 ACTGAAAGGTGAAAAGAGGGTGG + Intronic
969541559 4:7793829-7793851 GTTGAAGTGGGAAAAAAGGTAGG + Intronic
970275788 4:14399155-14399177 GTAGAAAAGGCAAAAGACGGAGG + Intergenic
970318581 4:14853441-14853463 GTTGAAATGGAAAAAAGGTGTGG - Intergenic
970354550 4:15239054-15239076 GATGAAAGGGCAGAAGAGGGAGG - Intergenic
970665425 4:18331275-18331297 TTTAAAATGGGAAAAGAGCCAGG + Intergenic
970768080 4:19575609-19575631 ATTGAAAAGGGAAAAGGGGAAGG + Intergenic
971976608 4:33697492-33697514 GTTGAAATGGGAAATCAGATGGG + Intergenic
972001900 4:34047613-34047635 GTTCAAGTGAGAAATGAGGGTGG + Intergenic
972555501 4:40176921-40176943 GGTGAAAAGGGAAAAAAGCGGGG - Intergenic
972749914 4:41978360-41978382 GGAGAAATGGGAAGAGATGGTGG + Intergenic
972908515 4:43783816-43783838 TATGAAAGGTGAAAAGAGGGAGG + Intergenic
973263094 4:48184549-48184571 ATTGAATTGAGAAAAGAGGTGGG - Intronic
973635128 4:52855237-52855259 ATTGAAATAGAGAAAGAGGGTGG + Intergenic
973839317 4:54844852-54844874 GATGAAATGGGAAAGGGAGGTGG - Intergenic
974633930 4:64533763-64533785 GTTGTAATGGGAATAGGGGTGGG + Intergenic
975812192 4:78181241-78181263 GTTGAAGAGGTAAAAGAGGAGGG - Intronic
976443723 4:85106616-85106638 CTGGAAGTGGGAAAAGAGGGAGG - Intergenic
976471757 4:85436910-85436932 GTTAAAAAAGAAAAAGAGGGTGG + Intergenic
976532148 4:86167909-86167931 ATTCAAATAGGAAAAGAGGAAGG + Intronic
976683831 4:87788275-87788297 GTTGAGATGGGAATAGGGGCAGG + Intergenic
976703589 4:87998253-87998275 GTTGTTATGGGAAAAGTAGGAGG - Intergenic
978573539 4:110165894-110165916 TGGGAAGTGGGAAAAGAGGGTGG + Intronic
979348546 4:119619004-119619026 ATTGAAAAGAGAAAAGAGGATGG - Intronic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
980595657 4:134951424-134951446 AGTGTAATGGGAAAAGAGAGAGG + Intergenic
980710538 4:136561035-136561057 TTTGAATGGGGAAAAGGGGGTGG - Intergenic
982176352 4:152709001-152709023 GTTGAAAGGAGAAGAAAGGGCGG + Intronic
983103931 4:163661773-163661795 GTTGCAAGGGGAAAAGGGAGAGG - Intronic
983118821 4:163854137-163854159 ATTGAAAAGGGATAAGAGGAAGG - Exonic
983270933 4:165560714-165560736 GATGAAGTAGGAGAAGAGGGAGG + Intergenic
983463598 4:168057846-168057868 ATTGATATGGGAAAAAATGGAGG - Intergenic
983561737 4:169108520-169108542 CTAGAAATGGGAAGAGAGGGTGG + Intronic
984064679 4:175033303-175033325 GTGGAGAGGGGAAAAGAGGGTGG + Intergenic
984680541 4:182603907-182603929 GCTGAAAAGAGAAAAGGGGGAGG - Intronic
984933800 4:184872102-184872124 GTGGAGAGGGGTAAAGAGGGTGG - Intergenic
985140610 4:186836753-186836775 GTAGAAAAGAAAAAAGAGGGAGG - Intergenic
985632422 5:1020978-1021000 GTTTAAATGGGAAAACGTGGAGG - Intronic
986387188 5:7246322-7246344 GTTGAAAGGGGGAAAGTGTGAGG + Intergenic
986762543 5:10893394-10893416 GTATAAATGGCAAAAGAGTGGGG + Intergenic
987082115 5:14435203-14435225 GGTGAAAAGGGAAAAAAAGGGGG + Intronic
988209251 5:28181807-28181829 ATCCAAATGGGAAAAGAGGAAGG - Intergenic
988348382 5:30069750-30069772 GCTGAAATGTGGAAAGAGAGAGG - Intergenic
989527017 5:42465461-42465483 GTTGAAGAGGTAAAAGAGGAGGG - Intronic
990123351 5:52483623-52483645 GGGGAAAGGGGAAAATAGGGTGG + Intergenic
990495258 5:56341016-56341038 GTAGAAATGGGAAAAATTGGTGG - Intergenic
990969261 5:61485079-61485101 GAGGAAGGGGGAAAAGAGGGAGG - Intronic
991122227 5:63029854-63029876 TTTGAAATGGGAAAACAGTAAGG + Intergenic
994380797 5:99068503-99068525 CTTGAAGTGGGAAAAGAGATGGG - Intergenic
995774289 5:115709239-115709261 GCTGAGAAGGGAGAAGAGGGAGG - Intergenic
995928923 5:117411670-117411692 GCTGAAATGCAAAAAGATGGAGG - Intergenic
996058078 5:119002043-119002065 GATGTAATGGAAAAAGAGGCAGG - Intergenic
996765943 5:127034023-127034045 GTTGAGATGGGAAAATAGTGTGG + Intergenic
997605484 5:135172990-135173012 GGAGAAGGGGGAAAAGAGGGAGG + Intronic
998981482 5:147707823-147707845 GTTGAAATAGGAGATTAGGGAGG + Intronic
1000022761 5:157333005-157333027 GGTGAAAAGGGAAAAAAAGGAGG + Intronic
1000790234 5:165597678-165597700 GTTGAAAAGAGAAAAGATGATGG - Intergenic
1001059605 5:168477271-168477293 GGTGAAATGGCAAAAGGGAGGGG - Intergenic
1001722412 5:173867467-173867489 TGTGCAATGGGAAAAGAAGGAGG + Intergenic
1001855648 5:175008154-175008176 GTTGAAATGGAAAAGGAAGTAGG + Intergenic
1001981078 5:176037403-176037425 GATGGAGGGGGAAAAGAGGGTGG + Intergenic
1002082442 5:176745547-176745569 GTTGAAAGGGGAAAAGGTGGGGG - Intergenic
1002474388 5:179455841-179455863 GGTGAAAAGGGAAAAAAGGAGGG + Intergenic
1002723523 5:181280551-181280573 GATGGAGGGGGAAAAGAGGGTGG - Intergenic
1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG + Intergenic
1003339324 6:5204536-5204558 TTTCACATGGGAAGAGAGGGAGG - Intronic
1004238489 6:13897046-13897068 GGAAAAATGGGCAAAGAGGGAGG - Intergenic
1004280100 6:14273289-14273311 GTTGAAATACTAAAAGTGGGAGG + Intergenic
1004902355 6:20206075-20206097 GGTAAAATGAGAACAGAGGGTGG - Intronic
1005040648 6:21596618-21596640 GGGGCAAGGGGAAAAGAGGGAGG - Exonic
1005873943 6:29997318-29997340 TTCAAAATGGGAGAAGAGGGAGG - Intergenic
1006146593 6:31963265-31963287 GTTGAAATGGGATGAGATGTTGG + Intronic
1006182929 6:32164698-32164720 TTTCAAATGGGGAAAGAGTGGGG + Intronic
1007459863 6:42010206-42010228 GTTGTCATGAGAAGAGAGGGAGG - Intronic
1007493061 6:42239515-42239537 CTTGAGAGGGGAAAAGAAGGAGG - Intronic
1008011779 6:46475469-46475491 CTTGACATTGGAGAAGAGGGTGG - Intronic
1008092139 6:47304699-47304721 GTTGGGAAGGGAAAAAAGGGAGG - Intronic
1008290962 6:49715581-49715603 GTAGAAATAGGACAAAAGGGTGG + Intergenic
1009426403 6:63518520-63518542 GTTGAGACTGAAAAAGAGGGTGG + Intergenic
1009878794 6:69539424-69539446 GATGGCATGGGAACAGAGGGTGG + Intergenic
1010922815 6:81704852-81704874 GAGGAAATGAGAAAAAAGGGAGG + Intronic
1013646904 6:112152825-112152847 ATTGAAATTAGAAAAGAGGAAGG - Intronic
1013929521 6:115514378-115514400 GTTTAAATGGGAGGAGAGGAAGG - Intergenic
1013983167 6:116157720-116157742 GTTGAAATGGTGAGAGTGGGTGG + Intronic
1014991111 6:128078139-128078161 AATGAAATGGGACTAGAGGGGGG + Intronic
1015600691 6:134907261-134907283 GTTGAGAGGGGAAAGGATGGAGG + Intergenic
1016464880 6:144315384-144315406 GGTGAGATGGGAAGAGAGGAAGG + Intronic
1016950838 6:149578000-149578022 GCAGGAATGGGGAAAGAGGGTGG - Intronic
1016995411 6:149959173-149959195 ATGGAAATGGGAAAGGAAGGGGG - Intergenic
1017587009 6:155937647-155937669 CTTGTAATCAGAAAAGAGGGAGG - Intergenic
1018452744 6:163924370-163924392 GAGGAAAGGGGAAAAGAGGAGGG - Intergenic
1019132761 6:169889459-169889481 GGTGAAATGGGAAAACCAGGAGG - Intergenic
1019180443 6:170184309-170184331 GTGGAAAATGGAAATGAGGGAGG - Intergenic
1022657921 7:32337712-32337734 GGAGAAAAGGGAAAGGAGGGGGG + Intergenic
1022827825 7:34034522-34034544 GCTGAAATGTGCAAAGATGGTGG - Intronic
1023186618 7:37539442-37539464 GTTGAAGGGGGAACAGTGGGAGG + Intergenic
1023892972 7:44406770-44406792 GTGAAAATGGGGGAAGAGGGAGG + Intronic
1023895524 7:44429797-44429819 AATGACATGAGAAAAGAGGGTGG + Intronic
1024656758 7:51457574-51457596 AGTGAAAAGGGAAAAGAGAGGGG - Intergenic
1024881815 7:54095371-54095393 GGTAAAAGGGGAACAGAGGGAGG + Intergenic
1025275586 7:57579302-57579324 GATGGAGGGGGAAAAGAGGGTGG - Intergenic
1026181106 7:68041660-68041682 GGACAAATGTGAAAAGAGGGAGG + Intergenic
1027367485 7:77473543-77473565 GTGAGAATGGGAAAAGAGAGAGG - Intergenic
1028266924 7:88737063-88737085 GATGAGATTGGAACAGAGGGTGG + Intergenic
1028278085 7:88883504-88883526 GCTGAAAGGGGAAAAGAGCTTGG - Intronic
1030046688 7:105503507-105503529 GTTGTATTGAGTAAAGAGGGAGG - Intronic
1030078015 7:105753198-105753220 GTAGAAGTGGGAAAAGAGTTGGG + Intronic
1030289603 7:107858957-107858979 GTAGAAATGGGCAGAGAGGCCGG - Intergenic
1030304501 7:108004322-108004344 GTTGGAGAGGGAAAAGAGGTTGG + Intergenic
1030609993 7:111678975-111678997 ATTTAAAGGGGAAAAGTGGGTGG + Intergenic
1031845461 7:126800395-126800417 ATTTAAATGGGAAAAATGGGGGG - Intronic
1032780419 7:135161365-135161387 ATTCAAATGGGAAAAGTGAGAGG + Intronic
1033387637 7:140893854-140893876 GATGAAATGGGAGATGAGGCAGG + Intronic
1034287536 7:149897988-149898010 GTTGCAATGAGAAAAGGAGGTGG - Intergenic
1034663591 7:152794919-152794941 GTTGCAATGAGAAAAGGAGGTGG + Intronic
1037467700 8:19176064-19176086 GGGGAAATGGGGAAAGAGAGAGG - Intergenic
1039149130 8:34483692-34483714 GTTGAAAAGGGAAATAAGGAAGG - Intergenic
1039182872 8:34886048-34886070 GTTGAGATGTCAAAAGAGGTTGG + Intergenic
1040790779 8:51226995-51227017 GTTGAAATCGAAAAAGTTGGAGG + Intergenic
1040792352 8:51247178-51247200 GGTGAAAGGGGAAAAAGGGGTGG + Intergenic
1041332308 8:56740041-56740063 GTTGAAATGGAAGGAGAGGTGGG - Intergenic
1041551182 8:59103096-59103118 GGAGAAAATGGAAAAGAGGGAGG - Intronic
1041759193 8:61345726-61345748 TTTGAAAAGGGAAGAGATGGGGG + Intronic
1042700973 8:71614017-71614039 GTTGAAAGGAGCAAAGAGGCCGG + Intergenic
1042867877 8:73371379-73371401 GAAGAAAAGGGAGAAGAGGGGGG + Intergenic
1043029805 8:75120172-75120194 GATGAAGTGGAAAAAGAGGAAGG - Intergenic
1044502918 8:92981906-92981928 ATTGAAATAGAAAGAGAGGGTGG + Intronic
1044740850 8:95324663-95324685 ATTGTAAAGGGGAAAGAGGGAGG - Intergenic
1045813091 8:106246852-106246874 CTTGAAATGGCAAATGATGGTGG + Intergenic
1047011743 8:120680037-120680059 GTTGAGATAGGAAGACAGGGAGG - Intronic
1048003221 8:130396813-130396835 TTTGGAAAGGCAAAAGAGGGAGG + Intronic
1048935932 8:139357070-139357092 GTTGAAAGGAGGTAAGAGGGTGG + Intergenic
1049191086 8:141287986-141288008 CTTGAAAGGGGCAAGGAGGGTGG - Intronic
1049756434 8:144313159-144313181 GTTGCACTGGGAAAACAGGTGGG - Intronic
1050234845 9:3566742-3566764 CTGGAAATAGGAAAAGAGGAGGG + Intergenic
1051926085 9:22328476-22328498 GTTGAGATGGGAGAAAAGGAAGG - Intergenic
1052197948 9:25741032-25741054 GATGAAAGGGCAAAAGAGGAGGG + Intergenic
1053654001 9:40197303-40197325 GATGAAGGGGGAAAAGATGGTGG + Intergenic
1053654123 9:40197912-40197934 GATAAAGGGGGAAAAGAGGGTGG + Intergenic
1053904391 9:42826478-42826500 GATGAAGGGGGAAAAGATGGTGG + Intergenic
1053904512 9:42827088-42827110 GATAAAGGGGGAAAAGAGGGTGG + Intergenic
1054366119 9:64343519-64343541 GATGAAGGGGGAAAAGATGGTGG + Intergenic
1054366237 9:64344128-64344150 GATAAAGGGGGAAAAGAGGGTGG + Intergenic
1054530474 9:66178427-66178449 GATAAAGGGGGAAAAGAGGGTGG - Intergenic
1054530594 9:66179036-66179058 GATGAAGGGGGAAAAGATGGTGG - Intergenic
1054673747 9:67833249-67833271 GATGAAGGGGGAAAAGATGGTGG + Intergenic
1054673868 9:67833858-67833880 GATAAAGGGGGAAAAGAGGGTGG + Intergenic
1055687337 9:78790853-78790875 GTTGAAATGGAAAAGCAGGCTGG + Intergenic
1055980174 9:81993277-81993299 GTCGAAATGGGAAAAGGAAGTGG - Exonic
1056325972 9:85479334-85479356 TTTGAAATAGGAAGAGAGGAAGG - Intergenic
1056329765 9:85511623-85511645 GTTGAACTGGGTCAAGAAGGTGG - Intergenic
1056587923 9:87940289-87940311 GATGAAGGGGGAAAAGACGGTGG + Intergenic
1056608944 9:88112656-88112678 GATGAAGGGGGAAAAGACGGTGG - Intergenic
1057379551 9:94555536-94555558 GATGAAGGGGGAAAAGAAGGTGG + Intergenic
1057379675 9:94556147-94556169 GATAAAGGGGGAAAAGAGGGTGG + Intergenic
1057873754 9:98737139-98737161 TTTCAGATGAGAAAAGAGGGTGG + Intronic
1058272056 9:102985294-102985316 TCTGAAAGGGGAAAAGTGGGAGG + Intergenic
1058349399 9:104003421-104003443 GTGGAAAAGGGAGAAGAGGAAGG + Intergenic
1058465766 9:105225579-105225601 GTTGAGATGGGAAGGGAGGAGGG + Intergenic
1058675012 9:107392882-107392904 GTGGAAATAGGAAGAGAGGGAGG - Intergenic
1059502791 9:114769576-114769598 GTTGGAATGAGACAAGAGGAGGG + Intergenic
1061714392 9:132509836-132509858 GTGGAAGGGGGAAAAGATGGGGG - Intronic
1062529943 9:136995403-136995425 GGTGGGAGGGGAAAAGAGGGGGG - Intronic
1203532391 Un_GL000213v1:158613-158635 ATTCAAATAGGAAGAGAGGGAGG - Intergenic
1185617690 X:1433288-1433310 GTTGTCATGGGAACAGGGGGAGG + Intronic
1186155546 X:6722072-6722094 GTAGAAATGGGGGGAGAGGGTGG + Intergenic
1187054178 X:15726031-15726053 TTTTAAAAGAGAAAAGAGGGTGG - Intronic
1188150092 X:26662938-26662960 CTTGAAATTTGAAAAGAGGGAGG - Intergenic
1188670841 X:32879912-32879934 ATTCAAATGGGAGAAGAGGAAGG - Intronic
1189081631 X:37979210-37979232 ATTTAAACGGGAAAAGTGGGCGG + Intronic
1189107014 X:38247019-38247041 GTTGATATGGGACAAGAGCTGGG - Intronic
1192160713 X:68784671-68784693 GTTGAAGAGGTAAAAGAGGAGGG + Intergenic
1192313295 X:70033677-70033699 GTTGAAAGGAGGAAAGAGAGAGG + Intronic
1192754189 X:74029357-74029379 ATTCAGATCGGAAAAGAGGGAGG + Intergenic
1192847026 X:74916793-74916815 ATTGAATTAGGAAAATAGGGGGG + Intronic
1193760001 X:85452914-85452936 GGTGGAATGGGGAGAGAGGGTGG - Intergenic
1193855800 X:86600063-86600085 TGTAAACTGGGAAAAGAGGGAGG + Intronic
1194526540 X:94983928-94983950 GTGGAAAGGGGAGAAAAGGGTGG + Intergenic
1195917585 X:109951046-109951068 GTTGAGAAGGGAAGAGGGGGTGG + Intergenic
1197587646 X:128368940-128368962 GTGGAAATGGATAAAGAGTGGGG + Intergenic
1198429827 X:136554192-136554214 GTTGAAATAGGGAAAAATGGGGG + Intronic
1198537624 X:137601747-137601769 GTGGAAATGGGAAGAAAGAGTGG + Intergenic
1198680986 X:139181954-139181976 GTTGGAGAGGGAGAAGAGGGTGG - Intronic
1200309943 X:155067935-155067957 CTGCAAATGGGAAAAAAGGGGGG - Intronic
1200758478 Y:7014054-7014076 GTTAAAATGTGAAAAGTGAGGGG + Intronic