ID: 927750053

View in Genome Browser
Species Human (GRCh38)
Location 2:25660406-25660428
Sequence GGTTTCCAGGGGTTTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 0, 2: 13, 3: 126, 4: 791}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927750046_927750053 2 Left 927750046 2:25660381-25660403 CCATAGCAACAGAAAATTAATCA 0: 1
1: 0
2: 3
3: 31
4: 393
Right 927750053 2:25660406-25660428 GGTTTCCAGGGGTTTGTGGAGGG 0: 1
1: 0
2: 13
3: 126
4: 791
927750045_927750053 17 Left 927750045 2:25660366-25660388 CCAGAATAGGTAAATCCATAGCA 0: 2
1: 20
2: 148
3: 658
4: 1641
Right 927750053 2:25660406-25660428 GGTTTCCAGGGGTTTGTGGAGGG 0: 1
1: 0
2: 13
3: 126
4: 791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927750053 Original CRISPR GGTTTCCAGGGGTTTGTGGA GGG Intronic
900563388 1:3319764-3319786 GGCTTCCAGGGCTGTGTGGGTGG - Intronic
900877041 1:5350218-5350240 GGTTTTCAGAGGTCAGTGGAAGG + Intergenic
901016494 1:6234937-6234959 TGTTTCCTGGGGTTTGTGTTCGG - Exonic
901301304 1:8201658-8201680 TGTGTTCAGGGGTTTGGGGAGGG + Intergenic
901457846 1:9373661-9373683 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
902266167 1:15266758-15266780 GGTTGCCAGGGGTCAGGGGAAGG - Intronic
902424902 1:16312497-16312519 GATTGCCAGTGGTTGGTGGAAGG + Intronic
902660771 1:17901679-17901701 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
902843584 1:19092077-19092099 GGGTGCCAGGGGCTTGTGGCAGG + Intronic
903489583 1:23718144-23718166 GGTTGCCAGGGGCTGGGGGAGGG + Intergenic
903532272 1:24040516-24040538 GGTTACCAGGGGCTGGAGGAAGG + Intergenic
904274868 1:29374958-29374980 GGTTTTCAGTGGCTTATGGATGG + Intergenic
905088722 1:35408942-35408964 GGTTGCCAGGGATGGGTGGAGGG - Intronic
905288134 1:36899500-36899522 GGTTTCCAGGGCCTAGAGGAAGG + Intronic
905447903 1:38039225-38039247 GGCTGCCTGGGGTTTGTGGCAGG - Intergenic
906490989 1:46268353-46268375 GGTTGCCAGGGATTAGGGGAGGG - Intronic
906938103 1:50232220-50232242 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
907121947 1:52015746-52015768 GGTTGCTAGGGGTTGGTGGGAGG - Intergenic
907131637 1:52102560-52102582 GGTTTCCAGGGCCTTGGGGAGGG - Intergenic
908002804 1:59697356-59697378 GGTTGCTAGGGGTTGGGGGAGGG - Intronic
908475672 1:64485320-64485342 GGTTTCCAGGAGTTTCAGGTGGG - Intronic
908675206 1:66595899-66595921 GGCTTCCAGTGGTTTGAGGAGGG + Intronic
908812348 1:67995925-67995947 GGTTAACAGGGGTTTGGGGGTGG + Intergenic
908997516 1:70174755-70174777 GGTTGCCAGGGGTTGGGGTATGG + Intronic
909428018 1:75550372-75550394 GGCTTCCAGGGGCTGGAGGATGG + Intronic
910232597 1:85001598-85001620 GGTTGCCAGGGGTTGGAGGGAGG - Intronic
910309738 1:85809967-85809989 GGCTGCCAGGGTTTGGTGGAAGG - Intronic
910671333 1:89775817-89775839 GGTTACCAGGGGTTGGGGGTAGG - Intronic
910890029 1:92008668-92008690 GGTTGCCAGGGTTGTGAGGAGGG - Intronic
911659103 1:100480160-100480182 GGTTTCCAGGGACTTGGGTAGGG - Intronic
911930006 1:103890519-103890541 GGTTACCTAGGGTTTGTGGTGGG - Intergenic
911957705 1:104259292-104259314 GGTTTCCAGGTCTTTGAGAAAGG - Intergenic
911969035 1:104407120-104407142 GGTTGCCAGGGGTTTGGGTTGGG - Intergenic
912663456 1:111556717-111556739 GGTTGCCAGGGGCTTGAGGGAGG + Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913648900 1:120890554-120890576 GGTTGCCAGGAGTTTGGGGATGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914077791 1:144372829-144372851 GGTTGCCAGGAGTTTGGGGATGG - Intergenic
914101388 1:144593676-144593698 GGTTGCCAGGAGTTTGGGGATGG + Intergenic
914172700 1:145241369-145241391 GGTTGCCAGGAGTTTGGGGATGG - Intergenic
914297592 1:146343960-146343982 GGTTGCCAGGAGTTTGGGGATGG - Intergenic
914330086 1:146660355-146660377 GGTTGCCAGGGATTAGTGGGAGG + Intergenic
914527357 1:148482502-148482524 GGTTGCCAGGAGTTTGGGGATGG - Exonic
914639037 1:149584631-149584653 GGTTGCCAGGAGTTTGGGGATGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915293574 1:154903266-154903288 GGCTGCCAGGGGGTTGGGGAGGG + Intergenic
915614893 1:157029972-157029994 GGTTTTCAGGGGTTAGGGGAAGG + Intronic
916586321 1:166153293-166153315 GGGATCCAGGGGTCTGGGGAAGG + Intronic
917069391 1:171133496-171133518 GATTTCCAGGGGCTTGAGGGTGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917468199 1:175303004-175303026 GATTTTCAGGGGTTGGAGGAAGG + Intergenic
917747336 1:178023478-178023500 GGTTACCAGGGGTTGGGGAAGGG + Intergenic
917856292 1:179102932-179102954 GGTTTACAGGGGGAGGTGGATGG - Exonic
917977269 1:180248230-180248252 GGTTAGCAGGGCTGTGTGGAAGG + Intronic
918412767 1:184277433-184277455 GGTTTCCAGGGGTTGGGGGATGG + Intergenic
918676610 1:187294288-187294310 GGTTGTCAGGGGTTTGGGAAAGG + Intergenic
918843073 1:189569625-189569647 TGTTACCAGGGGGTTGGGGAAGG + Intergenic
918933242 1:190884800-190884822 GGTTGCCAGGGTTTGGAGGAGGG + Intergenic
919115756 1:193278548-193278570 GGTTACCAGGGGCATGGGGAGGG - Intergenic
919591070 1:199503396-199503418 GGTTTCCAAGGGCTTGAGGGAGG + Intergenic
919762091 1:201104353-201104375 GGTTTTCAAGGGATTGGGGAGGG - Intronic
920027547 1:203010860-203010882 GGTTTCCAAGGGCTGGAGGAGGG - Intronic
920265499 1:204719091-204719113 GGTTGCCAGGGGTTAGTGGTGGG - Intergenic
920339189 1:205265087-205265109 GGTGTCCAGGCCTCTGTGGAGGG + Intronic
920513971 1:206570561-206570583 GGTTGCCAGGGGTGGGGGGAGGG - Intronic
920945408 1:210524078-210524100 GGTTGCCAGGGGGTGGGGGAAGG + Intronic
921025565 1:211277644-211277666 GGTTGCCAGGGACTGGTGGAAGG + Intronic
921086153 1:211795026-211795048 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
921158955 1:212459571-212459593 AGTTTCCAGGGGCTGGGGGAAGG - Intergenic
921448991 1:215280727-215280749 GGTTTCCAGGGTCTTGGGGGAGG - Intergenic
921501457 1:215909271-215909293 GTTTGCCAGGGGTTGGGGGAGGG + Intronic
921627284 1:217390828-217390850 GGTTGCCAGGGGTTGGTGTGGGG + Intergenic
923090132 1:230734370-230734392 GGTTTCCAGGGGCTGGGGGAGGG + Intergenic
923457696 1:234178911-234178933 AATTTCCAGGGGTTGGGGGAAGG - Intronic
923940737 1:238822889-238822911 GGTCTCCAGGGGTTGAGGGAAGG + Intergenic
924532047 1:244901744-244901766 AGTTGCCAGGGGTTAGTGGGAGG - Intergenic
1062962642 10:1584931-1584953 GGTTGCCAGGGTTTGGAGGAGGG + Intronic
1063035901 10:2286360-2286382 GGTTGCCAGGGGTTGGGGGAAGG - Intergenic
1063162125 10:3426092-3426114 GGCATCCAGGGGTTTGAGGGTGG - Intergenic
1063792413 10:9467797-9467819 GGTTTCCAGGGGTTGGGGTGGGG + Intergenic
1063792801 10:9473682-9473704 GGTTTCCAGGGGGTAGGGAAAGG + Intergenic
1064290531 10:14030083-14030105 GGTTTCCAGGAGCTGGAGGAGGG + Intronic
1065065696 10:21961554-21961576 GGTTACCAGGGGTTGGTGTGGGG + Intronic
1065786554 10:29221053-29221075 GGTTACCAGGGGTTGGGGGAGGG - Intergenic
1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG + Intronic
1065865028 10:29907301-29907323 GGTTTCCAGGGGCTGGAGGTTGG - Intergenic
1066340550 10:34528779-34528801 GGTTTCAAGGGGTATGGAGAAGG + Intronic
1067216813 10:44310546-44310568 GCTCTACAGGGTTTTGTGGAGGG - Intergenic
1067515138 10:46933468-46933490 GGTTTCCAGGGTATAGAGGAAGG - Intronic
1067606669 10:47670023-47670045 GGCTTCCAGGGGCTGGGGGAGGG - Intergenic
1067647118 10:48118342-48118364 GGTTTCCAGGGGATAGAGGAAGG + Intergenic
1067826506 10:49577808-49577830 GGTTGCTAGGGGTTGGTGGCAGG - Intergenic
1067978192 10:51050325-51050347 GGTTGCCAGGGGTTGGGGGAGGG - Intronic
1068104089 10:52592022-52592044 TGTTTCCTGGGGTTGGGGGAGGG + Intergenic
1068696634 10:59974838-59974860 GGTTTCAAGGGGTTGGAGGTAGG - Intergenic
1068886640 10:62104615-62104637 GGTTTCCATGCCTTTGTGAATGG - Intergenic
1069350212 10:67516763-67516785 GCTTTCCAGGGATTGGTGGGTGG - Intronic
1069540099 10:69287586-69287608 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
1069752858 10:70755396-70755418 GATTTCCAGGGGCTGCTGGAGGG + Intronic
1070343055 10:75515201-75515223 AGTTGCCAGGGGCTGGTGGATGG + Intronic
1070539140 10:77403670-77403692 TGTGTACAGTGGTTTGTGGAGGG - Intronic
1070637323 10:78139739-78139761 GGTTTCCAGGGCTCTGGAGAAGG + Intergenic
1071104582 10:82079633-82079655 GATTGCCAGGGGTTTGGGGGTGG - Intronic
1071142829 10:82531942-82531964 GGTTTCCAGGGGCTAGGAGAAGG - Intronic
1071287213 10:84160011-84160033 GGTTACCAGGGGCTGGTGGGTGG + Intergenic
1072070666 10:91913359-91913381 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1072341194 10:94452447-94452469 GGTTTCCAGGGGATTGGAGGAGG - Intronic
1072389178 10:94965467-94965489 GGTTGCCATGGGGTGGTGGAAGG - Intronic
1073039212 10:100588814-100588836 GGTTGCCAAGGGTTTGGGGGAGG + Intergenic
1073274617 10:102299297-102299319 GATTGCCAGGGGTTGGTGGTGGG + Intronic
1073505972 10:103990166-103990188 GGTTGCCAGGGGTTGGAGGAAGG + Intronic
1074310989 10:112323358-112323380 GGTTACCAGGGGTTGGGGGTCGG - Intergenic
1075047726 10:119159394-119159416 GGTGGCCAGGGGTTTGTGCAGGG + Intronic
1075078960 10:119370075-119370097 GGTATCCAGGAGTCTGGGGAAGG - Intronic
1075216846 10:120543775-120543797 GGTTGCCAGGGGCTTGGCGAAGG - Intronic
1075279649 10:121128712-121128734 GGTTTGCAGGGGTCTCGGGAGGG - Intergenic
1075809012 10:125210748-125210770 GGTTGCCAGGGGCTAGGGGAGGG - Intergenic
1076140429 10:128074092-128074114 GGTTGCCAGGGGTTAGGGGAAGG - Intronic
1076588165 10:131564187-131564209 AGTTTCCAGGGGCTGGGGGAAGG + Intergenic
1076600891 10:131656362-131656384 GGGTCCCGGGGGTTTGTGGGTGG - Intergenic
1077660275 11:4061963-4061985 GGTTGGCAGGGGTTGGTGGGAGG + Intronic
1077726328 11:4678675-4678697 GGTTACCAGGGGCTGGGGGAGGG - Intergenic
1077771486 11:5223844-5223866 GGTTTCCAGGGGTTGGGGGTGGG - Intergenic
1078552130 11:12288277-12288299 GGCTTCCAGGGACTTGGGGAGGG - Intronic
1078693787 11:13608568-13608590 GGCTGCCAGAGGCTTGTGGATGG - Intergenic
1078960259 11:16258538-16258560 GGTTGCCAGGGATTGGGGGAGGG + Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079181721 11:18199855-18199877 GGTTGCCAGGGATTTGGGAAGGG - Intronic
1079275807 11:19036655-19036677 GATTGCCAGTGGTTTGAGGATGG + Intergenic
1079371612 11:19858217-19858239 GTTTACCAGGGGCTGGTGGATGG - Intronic
1079516859 11:21280038-21280060 GGATTCCAGAGGTTGGGGGAAGG + Intronic
1080414436 11:32056085-32056107 GGGTTGCAGGGCTTTGAGGAGGG + Intronic
1080484472 11:32691023-32691045 GGTTGCCAGGGGTTGAAGGAGGG - Intronic
1080916001 11:36660380-36660402 GGTTGCCAGGGTTTAGGGGAAGG - Intergenic
1081785087 11:45740434-45740456 GGTTGCCAGGGGCTGGAGGATGG - Intergenic
1081889470 11:46528612-46528634 GGCTGCCAGGGGCTTGTGGGAGG + Intronic
1081956039 11:47094296-47094318 GGTTTCCAGGGATTGGGGAAGGG + Intronic
1082006251 11:47420783-47420805 GGCTTCCAGGGGGTAGAGGAGGG - Intronic
1083949911 11:65948121-65948143 GGCTTCCTGTCGTTTGTGGAAGG - Exonic
1084146815 11:67269451-67269473 GGTGTGCAGGGGTGGGTGGAGGG - Intronic
1084824605 11:71720341-71720363 GGTTTCCAGGGGCTGCAGGAGGG + Intergenic
1084990742 11:72922954-72922976 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1085441705 11:76569989-76570011 GTTTGCCAGGGGTTTGGGGAAGG - Intergenic
1085780573 11:79404434-79404456 GGCTGCCAGGGGATTGGGGAAGG + Intronic
1086413128 11:86562081-86562103 GGTCGCCAGAGGTTTGGGGAAGG - Intronic
1086415433 11:86584773-86584795 GGTTTCCAGGGATTAGAGGTAGG + Intronic
1086787611 11:90989985-90990007 GGTTCCCAGAGGCTTGTGGGTGG + Intergenic
1086975289 11:93125243-93125265 GGTTTCCAGGGGCTGGGGGGAGG - Intergenic
1087097671 11:94335350-94335372 GGTTTCCAGGGGCTGGGGGAAGG - Intergenic
1087917585 11:103829156-103829178 AGGTTCCAGGACTTTGTGGATGG + Intergenic
1088531365 11:110813527-110813549 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1088553105 11:111034795-111034817 GATTCCCAGGGGCTAGTGGAAGG + Intergenic
1088675167 11:112185929-112185951 GATTGCCAGGGGTTAGAGGAAGG - Intronic
1088689435 11:112312675-112312697 GGTTTCCAGGGGTTACAGGTGGG - Intergenic
1088902312 11:114127571-114127593 GCTTTTCAGGTGCTTGTGGATGG + Intronic
1088948920 11:114545545-114545567 GGTTGCCAGAGATTTGGGGAGGG + Intronic
1089168491 11:116496198-116496220 GTTTGCCAGGGGTTTGAGGGAGG - Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089877100 11:121734732-121734754 GGTTTGCAGGGGTTAGTGGAGGG - Intergenic
1090146561 11:124329690-124329712 GGTTTCCAGGGGCTGGTGGGAGG + Intergenic
1090169885 11:124591938-124591960 GGTTTCCAGGGGCTGGAGGTAGG - Intergenic
1090178920 11:124676310-124676332 GCTTTCCAGGGGTTGGGGCAGGG - Intronic
1090533634 11:127616902-127616924 GGTTGCCTGGGGTTAGGGGAAGG - Intergenic
1091225439 11:133954248-133954270 GGTGGCCAGAGGTTTATGGAAGG - Intronic
1091587178 12:1822923-1822945 GCCTTCCTGGGGTTGGTGGAAGG + Intronic
1091638669 12:2217235-2217257 GGTTGCCAGGGGCTGGTGCAGGG + Intronic
1091664841 12:2411671-2411693 GGTTTCCAGGGCTTGCTGAAGGG + Intronic
1091820060 12:3469550-3469572 GGTTGCCGGGGGTTAGGGGAAGG + Intronic
1092311627 12:7361917-7361939 AGTTTCCAGGGGCTGGAGGAGGG - Intronic
1092418508 12:8310537-8310559 GGTTTCCAGGGGCTGCAGGAGGG - Intergenic
1092814209 12:12298859-12298881 GGTTTCCAGGGGTTGGGGAGAGG - Intergenic
1092908764 12:13126312-13126334 GGTTGCCAGGGGTTTGAGGGAGG - Intronic
1093738427 12:22652019-22652041 GGTTGCCAGGGGCTGGAGGAAGG - Intronic
1094306227 12:29022677-29022699 GGTTTCCAGGGGTTGGAGGAAGG + Intergenic
1095277121 12:40299565-40299587 GGTTGTCAGGGGTTAGGGGAGGG + Intronic
1095640652 12:44481824-44481846 GTTTTCCTGGGGTTAGAGGAGGG + Intergenic
1096713071 12:53471988-53472010 GTTTTCAAGGGGTTGGTGGGGGG + Intronic
1097366127 12:58715227-58715249 GGTTTCCAGGGGTTGAAGGAGGG + Intronic
1097835453 12:64268532-64268554 GGTTTCCAGGGGTTAGGAGGAGG + Intronic
1098656415 12:73035926-73035948 GGTTGCCAGGAATTAGTGGAGGG - Intergenic
1100357581 12:93845947-93845969 GGTTGCCAGGGGGTGGGGGAGGG - Intronic
1100381052 12:94062339-94062361 GGTTGCCAGAGGTTGGTGGGGGG + Intergenic
1100528460 12:95442129-95442151 GGTTTCCAGGGATTGAGGGAGGG + Intergenic
1100626507 12:96338969-96338991 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1100626544 12:96339351-96339373 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
1101380529 12:104210466-104210488 GGTTGCCAGGGATTTGGGGGAGG - Intergenic
1101430001 12:104618973-104618995 CCTCTCCAGTGGTTTGTGGAAGG + Intronic
1102137503 12:110587464-110587486 GGTTGCCAGGGACTTGGGGAAGG + Intergenic
1102305527 12:111801806-111801828 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1102698580 12:114819024-114819046 GGTTACCAGGAGTTTGGGGGAGG - Intergenic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1103065792 12:117896354-117896376 GGTTGCCAGGGGCTGGTGGGAGG + Intronic
1103080240 12:118017984-118018006 GGTTGCCAGGGGCTAGAGGAAGG - Intronic
1103364830 12:120374301-120374323 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1103371892 12:120425447-120425469 TGCTTCCAGGAGGTTGTGGAAGG + Intergenic
1104021998 12:124998589-124998611 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1105386168 13:19931482-19931504 GGTTGCCAGGGGTTGGGAGAGGG - Intergenic
1105390732 13:19975351-19975373 AGTTACCAGGGGCTTGAGGAAGG - Intronic
1105970577 13:25426064-25426086 GGTTGCCAGGGGTTGGGGGAGGG + Intronic
1106104996 13:26724856-26724878 GGTTACCAGGGGTTGGTGGGAGG - Intergenic
1106111168 13:26778399-26778421 GGTTGCCAGGGGCTGGTGGGAGG - Intergenic
1106768198 13:32937155-32937177 GATTCACAGAGGTTTGTGGAGGG - Intergenic
1106812537 13:33374267-33374289 GGTTTCCAGGGGCTGGGGAATGG + Intergenic
1107223864 13:38022150-38022172 GGATTGCAGGGGTCTGTGGTGGG + Intergenic
1107300971 13:38965290-38965312 GGTTTCTTGGGGTTGGGGGAGGG + Intergenic
1107491650 13:40885432-40885454 AGTTTCCAGGGGCTGGTGGTAGG - Intergenic
1107736244 13:43401431-43401453 GGTTTCCAGGGCTTAATGCAAGG + Intronic
1108259269 13:48640798-48640820 GGTTTTCAGGGGTTTGAGAAGGG + Intergenic
1108361693 13:49673803-49673825 GGTTGCCAGGGGTTAAGGGATGG + Intronic
1108637973 13:52354837-52354859 GGTTGTCAGGGGTTTGGGAAGGG - Intergenic
1109271674 13:60262539-60262561 GGTTTCCAGGGACTGGGGGAAGG - Intergenic
1109399151 13:61802154-61802176 GGTTTCCAGGGCTGAGGGGAAGG + Intergenic
1110086204 13:71383849-71383871 GGTTTCCAGGGACTTGGGGAGGG - Intergenic
1110512598 13:76368958-76368980 GGTTGCCAGGGGTTGGGGCAGGG + Intergenic
1111328143 13:86726323-86726345 GGTTTCCAGGGGCTTGAAAATGG - Intergenic
1111369727 13:87301473-87301495 TGTTTCCAGGGGTGGGGGGAGGG + Intergenic
1111390776 13:87591998-87592020 GGCAGCCAGGGGTTAGTGGAGGG - Intergenic
1111927085 13:94475511-94475533 GGTTACCAGGGGATGGGGGAGGG + Intronic
1111959502 13:94794446-94794468 GGTTGCCAGGGGTTGGGGGAAGG + Intergenic
1111978166 13:94989279-94989301 GGTTGCCTGGGGGTGGTGGAAGG - Intergenic
1112095900 13:96131711-96131733 GGTTACCAGGAGTTAGGGGAGGG - Intronic
1112706696 13:102078120-102078142 GGTTTCCAGGGGTACGGGGTGGG + Intronic
1112714318 13:102166092-102166114 GGTTGCCAGGAGCTTGGGGAGGG - Intronic
1112833311 13:103480005-103480027 GGTTTATAGGGGTTGGTGGGAGG + Intergenic
1112964671 13:105173743-105173765 GGTTTCCAGGTATTGGAGGATGG + Intergenic
1113415731 13:110127058-110127080 GGTTACATGGGGTTTGTTGATGG - Intergenic
1113475493 13:110577813-110577835 GGTTGCCAGGGGTTGGGGGAGGG - Intergenic
1113902100 13:113803121-113803143 GGTGTCCAGGGTTTTCCGGAAGG + Intronic
1114145353 14:19969891-19969913 GGTTTCCAGGTGTTTGAGGAGGG + Intergenic
1116212807 14:41969554-41969576 GGTTGCCAGGAATTTGGGGAAGG - Intergenic
1116429743 14:44832134-44832156 GGTTACCAGGGGTTGGGGGAAGG - Intergenic
1116743963 14:48793342-48793364 GGTCTCCTGGAGTTTGTGGGAGG - Intergenic
1117467480 14:56007741-56007763 GGTTTCCAGGGGGATGAGGCTGG + Intergenic
1117517320 14:56514729-56514751 GGTTGCCAGGGGCTGGTGGGAGG + Intronic
1117583942 14:57180941-57180963 GGTTACCAGGGGTGAGGGGATGG + Intergenic
1117860139 14:60081765-60081787 GGTTTCCAGGGACTTGGGGGAGG - Intergenic
1118012023 14:61619182-61619204 GGTTGCCAGGGGATGGGGGAAGG + Intronic
1118150143 14:63180301-63180323 GGGGTGCAGGGGGTTGTGGAAGG - Intergenic
1118265086 14:64287208-64287230 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1118449951 14:65891734-65891756 TGTTTCCAGGGCTTAGGGGAGGG + Intergenic
1118542580 14:66844885-66844907 GTTTACCAGGGGTTGGGGGAGGG - Intronic
1118654901 14:67936262-67936284 GATTTCCAAGGGCTTGGGGAAGG - Intronic
1118682475 14:68257180-68257202 GGTTTCCAGGAGCTTGGGGAAGG + Intronic
1119321657 14:73735084-73735106 GGTTACCAAGGGTTAGGGGATGG + Intronic
1119581304 14:75784195-75784217 GGTTGCCAGGGGCTTGGGGGAGG - Intronic
1119663286 14:76466188-76466210 GGGGTCCAGGGGCTTGGGGAGGG + Intronic
1119756887 14:77125747-77125769 GGGGCCCAGGGGCTTGTGGAAGG + Intronic
1120580594 14:86243290-86243312 GGTTGCTAGGGGTCAGTGGAGGG + Intergenic
1120580931 14:86247619-86247641 GATTGCCAGGGGTTAGGGGAAGG + Intergenic
1121021207 14:90581151-90581173 GGGGCCCAGGGGCTTGTGGAGGG + Intronic
1122432230 14:101660310-101660332 GGTTGCCAGGGGCTAGAGGAAGG - Intergenic
1122851345 14:104533581-104533603 GGTTTCCAGTGGTTGGTGGGAGG - Intronic
1122856686 14:104563472-104563494 GGATCCCAGGTGTTTGGGGACGG + Intronic
1122906924 14:104805876-104805898 GGTTTCCTGGAGTTTGTGGAAGG - Intergenic
1122971704 14:105154904-105154926 GGAGCCCAGGGGTTTGTGGATGG - Intronic
1123185542 14:106513075-106513097 AGCTTGCAGGGGTTTGGGGAGGG + Intergenic
1123500246 15:20875537-20875559 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1123557492 15:21449231-21449253 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1123593719 15:21886493-21886515 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1123942202 15:25221999-25222021 TCTTTCCAGGGTTTTGTGGCAGG + Intergenic
1124043022 15:26122297-26122319 GGTTTCCAAGAGCTTGGGGAGGG - Intergenic
1124213573 15:27785046-27785068 GGTTTTCAGAAGTTTGTGTATGG - Intronic
1124417267 15:29482503-29482525 GGTTGCCAGAGGTTTGGGGGAGG - Intronic
1124448250 15:29759629-29759651 GGTTACCAGGGGTTAGGGGTGGG - Intronic
1124622828 15:31286210-31286232 GGTTTCCAAGGGCTAGAGGAAGG + Intergenic
1125220573 15:37328436-37328458 GATTGCCAGGGGCTTGGGGAAGG + Intergenic
1125242326 15:37589602-37589624 GGTTACCAGGGGTTTGGGGGAGG - Intergenic
1125554769 15:40574849-40574871 GGTTGCCAGAGGCTGGTGGAAGG - Exonic
1125647972 15:41288938-41288960 GGTTGCCAGGGGTTGCAGGAAGG + Intergenic
1125935129 15:43628466-43628488 GGTTTCTTGGGGGTTGGGGAGGG - Intergenic
1125947888 15:43724778-43724800 GGTTTCTTGGGGGTTGGGGAGGG - Intergenic
1126367898 15:47914903-47914925 GGTTTCCAGGGGCTAAGGGAAGG + Intergenic
1126393461 15:48185123-48185145 GGATTCCAGGGGTTTGTGAGGGG + Intergenic
1126537083 15:49778213-49778235 GGTTCCCAGGGGTTTGGGGTGGG - Intergenic
1126658480 15:51006996-51007018 GGTTACCAGGGGTTGGGGGCAGG - Intergenic
1127309539 15:57740071-57740093 GGTTTCCAGGGTTTGGTAGTGGG + Intronic
1128794284 15:70453514-70453536 GGTTATCAGGGGTTTGGGGGAGG - Intergenic
1129125388 15:73436172-73436194 GCTTTCCAGGGGCTTGGGGGAGG + Intergenic
1129884425 15:79028623-79028645 GGTTTCCAGGAGTCTTGGGAAGG + Intronic
1129905367 15:79183483-79183505 GGCTTCCTGGGGTCTGTGGAAGG + Intergenic
1130142937 15:81246339-81246361 GGTTGCCAGGGGTTAGGGGTGGG - Intronic
1130191685 15:81742873-81742895 GGTTTCCAGGGGATGGAGGGAGG - Intergenic
1130312566 15:82767971-82767993 GGTTTACAGAAGTTTGTGAAAGG - Intronic
1130603515 15:85294577-85294599 GGTTTCCAGAGGCCTGGGGAGGG + Intergenic
1131132926 15:89911792-89911814 GATTGCCAGGGGATAGTGGATGG - Intronic
1131446963 15:92507019-92507041 TGTTGCCAGGGGTTAGAGGAGGG + Intergenic
1131714030 15:95089139-95089161 GGTTTCCAGGGGCTGGGGAAGGG - Intergenic
1202965842 15_KI270727v1_random:176404-176426 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1133327996 16:4953733-4953755 GGTTTCCAGGGGCTGCGGGAAGG + Intronic
1133357935 16:5150385-5150407 GGTTTCCAGGGGCTGCAGGAGGG - Intergenic
1133702454 16:8321735-8321757 GGTTGCCAGGGGCTGGTGGGAGG - Intergenic
1134396389 16:13868249-13868271 GTTTCTCAGGGGTTTGAGGAAGG - Intergenic
1134562405 16:15221957-15221979 GGTTGCCAGGGGTTGGGGGAGGG + Intergenic
1134782872 16:16914616-16914638 AGTTGCCAGGGGTCTTTGGATGG - Intergenic
1134796663 16:17044960-17044982 GGTTGCCAGGGGCTTGGGGTGGG - Intergenic
1134798103 16:17060064-17060086 GGTTTCCAGGGGCTTGGGGAAGG + Intergenic
1134922947 16:18133584-18133606 GGTTGCCAGGGGTTGGGGGAGGG + Intergenic
1135502000 16:23004135-23004157 GGTTGCCAGGGGCTGGAGGAAGG + Intergenic
1135775073 16:25250458-25250480 GGTTGCCAGGGGCTTGGGTAAGG + Intronic
1135782354 16:25314687-25314709 TGTTTCCTGGGCTTTGGGGAAGG + Intergenic
1136601216 16:31290230-31290252 GGTTTCCAGGGGCTGGGGGTTGG + Intronic
1136618049 16:31410625-31410647 GGGTTCCAGGGTTCTGGGGAGGG + Intronic
1137523318 16:49212100-49212122 GCTTTGCAGGGCCTTGTGGATGG - Intergenic
1137628736 16:49927076-49927098 GGTTGCCAGGGGTTGGGGGGAGG + Intergenic
1138311855 16:56031764-56031786 GGTTTCTAGGGGTTAATGGTGGG - Intergenic
1138914121 16:61442121-61442143 GTTTGCCAGGGGTTTGGGCAGGG + Intergenic
1139295697 16:65898511-65898533 GGTTGCCAGGGGTGGGAGGAAGG + Intergenic
1140003467 16:71050556-71050578 GGTTGCCAGGGATTAGTGGGAGG - Intronic
1140138774 16:72233744-72233766 GGTTTCCAGGGGCTGAGGGAAGG - Intergenic
1140245650 16:73245700-73245722 AGTTTCCATGGGGTTCTGGAAGG - Intergenic
1140461960 16:75147110-75147132 GATTTCCAGGGGTTGTGGGATGG + Intergenic
1140619427 16:76710268-76710290 GGTTGCCAGGGGTTAGAGGGTGG - Intergenic
1141278777 16:82611769-82611791 GGTTGCCAGGGGGTGATGGAGGG + Intergenic
1141447636 16:84072294-84072316 GGTTGCCAAGGGCTGGTGGAAGG + Intronic
1141480357 16:84302188-84302210 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1141568835 16:84922007-84922029 CGTTTCCAGGGACTTGTGGGCGG - Intergenic
1141593792 16:85085601-85085623 GGTGTCCAGGGAGTTGTGTAAGG + Intronic
1141929601 16:87193154-87193176 GGTTGCCAGGGGTTAGGGAAGGG - Intronic
1143255103 17:5551195-5551217 GGTTTCCAGGGCTTGGGGGAAGG - Intronic
1144390723 17:14791157-14791179 GGTCCCCAGGGGTTGGTGGGGGG - Intergenic
1144517650 17:15929847-15929869 GGTTGCCAGGGGCTGGGGGAAGG + Intergenic
1144644022 17:16956839-16956861 GATTCCCAGGGGTTGGAGGATGG + Intronic
1144662892 17:17082773-17082795 GGTTTCCAGGGGCTGGGGAAGGG - Intronic
1144668395 17:17117372-17117394 GGTTGCCAGGGGCTAGGGGAGGG - Intronic
1144848655 17:18233120-18233142 GGTGTCTAGGGGTTTGGGGCAGG + Intronic
1144938787 17:18921988-18922010 GGTTGCCAGGGGCTGGGGGATGG - Intronic
1144964573 17:19068300-19068322 GGTTAGCAGGGGTTGGGGGAGGG + Intergenic
1144983394 17:19183873-19183895 GGTTAGCAGGGGTTGGGGGAGGG - Intergenic
1144984831 17:19194366-19194388 GGTTAGCAGGGGTTGGGGGAGGG + Intergenic
1145113966 17:20190878-20190900 GGTTGCCAGGGGTTGGGGGGAGG - Intronic
1146443117 17:32914382-32914404 GGTTGCCAGAGGTTGGGGGAGGG - Intergenic
1146612270 17:34318211-34318233 GGTTGCCAGGGGCTTGGGGGAGG + Intergenic
1146658684 17:34650255-34650277 GCTTTCCAGGGGTTGGGGGCGGG + Intergenic
1146972217 17:37082506-37082528 GGTTTCCTGTGGTTGGTGGAGGG - Intergenic
1148989127 17:51650139-51650161 GGTTTCCAGGGGCTTCAGCAGGG + Intronic
1149041120 17:52189509-52189531 GTTTTCCAGGTGCTGGTGGAAGG - Intergenic
1149443476 17:56694986-56695008 GGTTGCCAGGGGTTAGGGGAGGG - Intergenic
1150335042 17:64324854-64324876 GGTTGCTAGGGGTTGCTGGAGGG + Intronic
1150973039 17:70052145-70052167 GTTTTCCAGGAGTTAGGGGAAGG - Intergenic
1151244810 17:72786211-72786233 GTTTTCCATATGTTTGTGGATGG - Intronic
1151383243 17:73739912-73739934 GGTTGCCCAGGGATTGTGGAAGG - Intergenic
1151974627 17:77477312-77477334 GATTTCCAGGGGCTGGGGGAGGG - Intronic
1152306366 17:79523112-79523134 GGTTGCCAGGGGCTTGTGGTGGG + Intergenic
1153410370 18:4785763-4785785 GGTTACCAGGGGTTGGGGGCTGG + Intergenic
1153465839 18:5387315-5387337 GGTTGCCAGGGGCTTCTGGGAGG - Intergenic
1153585932 18:6620252-6620274 GGTTACCAGAGGTTTGGGGTGGG + Intergenic
1153726453 18:7961285-7961307 GGTTGCCAGGGTTATGGGGAAGG - Intronic
1153869998 18:9309546-9309568 GGTTGCCAGTGGTTAGAGGAAGG + Intergenic
1154393562 18:13965978-13966000 GGTTACCAGGGGCTGGGGGATGG + Intergenic
1154462486 18:14607539-14607561 GGTTTCCAGGTGTTTGAGGAGGG + Intergenic
1155150008 18:23115731-23115753 GGTTGCCAGGGGCTTGGGGAAGG - Intergenic
1155197325 18:23487080-23487102 GGTTTCCAGAAGTTTCAGGAGGG - Intergenic
1155215488 18:23639887-23639909 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
1155417023 18:25609880-25609902 GGTTTCCAGGGGTTCAGGCAGGG + Intergenic
1155535649 18:26814209-26814231 GGTTACCAGGGGTTTGGGGTAGG - Intergenic
1155667621 18:28330371-28330393 GGTTTCCAGGGATTGAGGGAGGG - Intergenic
1156131650 18:33983173-33983195 GGTTGCCAGGGGTTAGGGGGAGG + Intronic
1157447885 18:47759860-47759882 GAATTCCAAGGGTTTGTAGAGGG + Intergenic
1157503876 18:48212313-48212335 GGTTTCCAGGGGTTGGGGGGAGG + Intronic
1157868265 18:51205202-51205224 GGTTGCCAGGGGTTGGAGGAAGG + Intronic
1158741017 18:60142287-60142309 GGTTTCCAGGAGCTGGGGGAAGG + Intergenic
1158750964 18:60260342-60260364 GGTTACCAGAGGCTTGCGGATGG - Intergenic
1158793644 18:60814028-60814050 GGTTGCCAGGGGTTGGGGGAGGG - Intergenic
1158905521 18:62007625-62007647 GGTTGCCAGAGGTTTGGGGGAGG + Intergenic
1158917538 18:62150655-62150677 GGTTGCCAGGCGTTGGGGGAGGG + Intronic
1158932914 18:62338645-62338667 GGTTTCCAGGAGCTTGAGGGAGG + Intronic
1159315490 18:66767862-66767884 CATTACCAGGGGCTTGTGGAGGG + Intergenic
1159362420 18:67422762-67422784 GGTTGCCAGAGGTTGGGGGAGGG - Intergenic
1159479424 18:68968703-68968725 GGTTACCAGGGGCTGGAGGAGGG - Intronic
1160197457 18:76767780-76767802 GGTTGCCAGGGGTTGGTGGGAGG - Intergenic
1160315699 18:77844142-77844164 AGTTGCCAGGGGCTGGTGGAAGG - Intergenic
1160415504 18:78707010-78707032 GGTTTCCAGGGGTTGGGGACTGG - Intergenic
1160574505 18:79844381-79844403 GGTTGCCAGGGGATTGGGGGTGG + Intergenic
1161113460 19:2483144-2483166 GGTTGTCAGGGGTTGGGGGAGGG - Intergenic
1162148876 19:8631116-8631138 GGGTACCAGGGGTTTCTGGAAGG + Intergenic
1162460661 19:10812126-10812148 GGTTTCCTGGGCTTTGGGGCTGG + Intronic
1162541954 19:11302263-11302285 GGGTGCCAGGGGCTTGGGGAGGG - Intronic
1162978049 19:14220095-14220117 GGTTGCCAGGGGATGGGGGATGG + Intergenic
1163233914 19:16020342-16020364 GGCTGCCTGGGGCTTGTGGAGGG - Intergenic
1163271173 19:16254852-16254874 GGCTGCCAGGGGTTGGGGGAGGG - Intergenic
1163280553 19:16314134-16314156 GGTTGCCAGGGGCTGGGGGAGGG + Intergenic
1163352295 19:16785064-16785086 GGTGGCCAGGGGTTAGGGGAGGG + Intronic
1163735709 19:18979163-18979185 GGTTGCCAGGGACTGGTGGAGGG + Intergenic
1163800232 19:19360391-19360413 AGTTGCCAGGGGCTTGGGGAGGG - Intergenic
1164668513 19:30059461-30059483 AGTTTCCGGGAGCTTGTGGAAGG - Intergenic
1164800077 19:31068916-31068938 GGGTTCCAGGGACTTCTGGAGGG - Intergenic
1164871717 19:31651034-31651056 GGTTGCCAGGGGCTGGAGGAGGG + Intergenic
1165537174 19:36458481-36458503 GGTCACCAGGGGTTGGGGGACGG + Intronic
1165657391 19:37545674-37545696 GGATGCCAGGAGTTTGGGGAAGG - Intronic
1165861449 19:38911518-38911540 GGGTCCCATGGGGTTGTGGAGGG + Intronic
1166195072 19:41200354-41200376 GATTGCCAGGGGTTGGAGGAGGG - Intronic
1166555284 19:43695477-43695499 GGTTGCCAGAGGTTGGGGGACGG + Intergenic
1166765113 19:45248262-45248284 GGTTGCCAGGGGTTGGAGGCTGG - Intronic
1166981573 19:46634821-46634843 GGTGGCCAGGGGCTGGTGGAGGG + Intergenic
1168363083 19:55759501-55759523 GGTTGCCAGGGGTTGTGGGAAGG - Intronic
1168364034 19:55769501-55769523 GGTTGCCAGGGGTTGTGGGAAGG - Intronic
1168479951 19:56711456-56711478 GGTTGCCAGGGGATAGGGGAGGG - Intergenic
924982043 2:232371-232393 GATTTTCAGATGTTTGTGGAAGG - Intronic
925181785 2:1822186-1822208 GGCTCCCAGTGCTTTGTGGATGG + Intronic
925714295 2:6770719-6770741 TGTTCCCAGGGGTGTGGGGACGG - Intergenic
926004537 2:9362958-9362980 GGTTACCAGGGGTTGGGGGTGGG - Intronic
926111167 2:10184692-10184714 GGTCTCCATGGGTTTGGGGCAGG + Intronic
926342401 2:11914644-11914666 TCTTTCCAGGGTTTTGTGCAAGG + Intergenic
926380897 2:12288255-12288277 GGTCTCAAGGCGTTTGTGGTGGG - Intergenic
927584413 2:24287368-24287390 GGTTACCAGGGGTTAGAGGGAGG - Intronic
927750053 2:25660406-25660428 GGTTTCCAGGGGTTTGTGGAGGG + Intronic
927984763 2:27401420-27401442 GGATGCCAGGGGTTAGTGGACGG + Intronic
929651353 2:43682734-43682756 GGTTGCCAGGGGCTAGTGGGAGG - Intronic
929863447 2:45698425-45698447 GGCTCCCTGGGGGTTGTGGATGG + Intronic
929909494 2:46076975-46076997 GGTTTCCAGAGGCTGGTGGAGGG + Intronic
930596609 2:53397431-53397453 GGTTTCCAGGGGCTGGGGTAAGG + Intergenic
931003778 2:57823652-57823674 GGTTGCTAAGGGTTTGAGGAAGG + Intergenic
931649925 2:64458309-64458331 CGTTTCCGAGTGTTTGTGGATGG + Exonic
931931743 2:67145529-67145551 GGTTTCCAGGGCTGGGAGGAGGG - Intergenic
931942050 2:67262935-67262957 GGTTTCCAGGGCCTAGGGGAAGG - Intergenic
933197881 2:79413087-79413109 GGTTACCAGAGGTTGGGGGATGG - Intronic
934858875 2:97747543-97747565 GGTTGCCAGGGGCTAGGGGAAGG + Intergenic
935277667 2:101489510-101489532 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
936064959 2:109323973-109323995 GTTTTCCAGGGGCTGGGGGAAGG - Intronic
936459481 2:112702298-112702320 GGTTACCAAGGGTTGGGGGAAGG - Intergenic
936494969 2:113010879-113010901 GGTTTCCAGGGACTGGGGGAAGG - Intergenic
936649049 2:114405466-114405488 CGTTTCCAGGAGATTGTGGATGG - Intergenic
936654050 2:114463806-114463828 GATTTGAAGGGGTTTGGGGAGGG - Intronic
936889891 2:117356965-117356987 GGTTGCCAGGGGATGGGGGAGGG - Intergenic
936936679 2:117845824-117845846 GGTTACCAGGGGTTGGGAGAAGG + Intergenic
937754913 2:125525460-125525482 GGTTTCCAGGGATTGAGGGAAGG + Intergenic
937817541 2:126269521-126269543 GGTTTCCAGGAGATGGAGGAAGG + Intergenic
938184995 2:129223606-129223628 TGTTTCCAGTGGCTTGCGGAAGG + Intergenic
938190211 2:129272955-129272977 GGTTACCAGGGGCTAGGGGAAGG + Intergenic
938211765 2:129471695-129471717 GGTTACCAGGGGTTGGGGGAAGG - Intergenic
940356987 2:152754224-152754246 GGTTTCCAGGGGATAGAGGCAGG - Intronic
940539745 2:154997023-154997045 GGTTGCCAGGAGTTAGAGGAAGG + Intergenic
940658988 2:156523254-156523276 GGTTGCCAGGGGTTAGGGGAGGG - Intronic
941115512 2:161467531-161467553 GGTTGCCAGGGCGTTGGGGAGGG - Intronic
941837550 2:170042131-170042153 GGTTTCCAGGGGTTGGGAGAAGG - Intronic
942287047 2:174429786-174429808 GGTTGCCAGGGGTTGGAGGGAGG - Intergenic
942857820 2:180572018-180572040 GGTTTCCAAGGGTTGGTAGAAGG + Intergenic
943197112 2:184767426-184767448 AGTTACCACGGGTTTGTGGAAGG + Intronic
943225066 2:185162586-185162608 GGTTTCCAGGGGCTGGAGAAAGG - Intergenic
944687184 2:202127967-202127989 GGTTGCCAGGGGCTAGGGGAGGG - Intronic
944722431 2:202437625-202437647 GGTTGCCAGAGGCTTGGGGAGGG - Intronic
944739446 2:202597391-202597413 GGTTACCAGGGATTAGGGGAGGG - Intergenic
944851489 2:203724208-203724230 GGTTTCCAGGGATTTAAGGGAGG + Intronic
944916311 2:204364317-204364339 GGTTTCCTGTTGGTTGTGGATGG - Intergenic
945487024 2:210407907-210407929 GGTTTCTAGGGGCTGGGGGAAGG - Intergenic
946176582 2:217925799-217925821 GGTAACCAGGGGTTTGGGGGAGG - Intronic
946290755 2:218743219-218743241 GGTTGCCAGGGGGTTAAGGAGGG - Intronic
946393709 2:219432399-219432421 GGTTGCCAGAGGTTGGTGGAGGG + Intergenic
946622657 2:221575493-221575515 GGTTTCCACCTGTATGTGGAGGG + Intergenic
946671718 2:222111914-222111936 GGTTCCCAGGGGTTGGAGGAAGG + Intergenic
946741874 2:222810444-222810466 GGTTTCCAGGGGTTGGGGGAAGG + Intergenic
946901975 2:224381513-224381535 GGTTGCCAGGGGTTGGGGGGAGG + Intronic
947379531 2:229531979-229532001 GGTTGACAGGGGTTGGGGGAAGG + Intronic
948028483 2:234797712-234797734 TGGCCCCAGGGGTTTGTGGAAGG + Intergenic
948755911 2:240159491-240159513 GCTCTGCAGGGGTTTGGGGAAGG - Intergenic
1168976574 20:1970623-1970645 GGTTTCCAAGGGTTTTGAGAAGG + Intergenic
1169006805 20:2214155-2214177 GGTTGCCAGGGGTTGGGGGAAGG - Intergenic
1169408181 20:5343649-5343671 GGTTTCCAGGAGCTGGGGGAAGG + Intergenic
1169925220 20:10776663-10776685 GGTTGCCAGAGGTTAGGGGATGG + Intergenic
1169972527 20:11283758-11283780 GGTTGCCAGGGGCTGGAGGAGGG + Intergenic
1170292019 20:14781202-14781224 GGTTACCAGAGGTTTGAGGTGGG - Intronic
1170365130 20:15589686-15589708 GGTTGCCAGGGATTGCTGGAAGG - Intronic
1170421039 20:16193613-16193635 TGTTTTCAGGCCTTTGTGGACGG + Intergenic
1170433667 20:16300997-16301019 GGTTGCCAGGGATTTGAGGGAGG - Intronic
1170465546 20:16619385-16619407 GGTTTTCAGGGGTTTGGAGTGGG - Intergenic
1170782949 20:19441837-19441859 GGTTTCCAGGGGTCAGTGAGAGG - Intronic
1170888460 20:20359871-20359893 GGTTTCCAGGGCCTGGAGGATGG + Intronic
1170987193 20:21269237-21269259 GGTCCCCTGGGGTTGGTGGAGGG - Intergenic
1171087839 20:22254550-22254572 GGTTTCCAGGGGTTGTGGGGAGG + Intergenic
1171102702 20:22400429-22400451 GGTTGCCAGGGGCTTGGGGTGGG - Intergenic
1172044109 20:32067390-32067412 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1172895777 20:38299061-38299083 GCTCTCCAGGGGTGGGTGGAAGG - Intronic
1173321138 20:41987877-41987899 GGCTTGCCGGGGTTTGGGGATGG + Intergenic
1173431520 20:42991540-42991562 GGTTTCCAGGGACTGGTGGGGGG + Intronic
1173545207 20:43892410-43892432 GGTTGCCAGGGGCTTGGAGAAGG + Intergenic
1173708293 20:45131125-45131147 GGTTTCCAAGGGTTTCAGGAAGG - Intergenic
1173757227 20:45527392-45527414 GGTTGCCAGGGGCTGGTGGGAGG - Intergenic
1173838845 20:46143645-46143667 GGTTTCCAGGGGCTGGGGTAGGG + Intergenic
1174056092 20:47799512-47799534 GGGTTCCAGGGCTATGTGGAGGG + Intergenic
1174332976 20:49835524-49835546 GGTTTCCAGGGGATGGGAGAAGG - Intronic
1175406021 20:58729270-58729292 GGTTTCCAAGGGATAGGGGAAGG + Intergenic
1175713280 20:61238170-61238192 GGTTTCCAGGGGCTTGGGAAGGG + Intergenic
1175742764 20:61431803-61431825 GGTTGCCAGGGGATGGGGGAGGG - Intronic
1176133561 20:63508161-63508183 GGTTTCCAGGGGGAAGAGGATGG - Intergenic
1176195410 20:63834608-63834630 TTTTCCCAGGGGTTTGTGGGGGG - Intergenic
1176212572 20:63932183-63932205 GGTTTCCTGGGCCTTGTGGCAGG + Exonic
1176217183 20:63953764-63953786 GGTTTCCTTGGCATTGTGGATGG - Intronic
1176812033 21:13550843-13550865 GGTTTCCAGGTGTTTGAGGAGGG - Intergenic
1177476477 21:21630572-21630594 GGTTGCCAAGGGTTTGGGGGAGG + Intergenic
1177514994 21:22137927-22137949 GGTTGTCAAGGGTTTGTGGGAGG + Intergenic
1177754201 21:25324903-25324925 GGTTGCCAGGGGCTCGGGGAAGG + Intergenic
1178671474 21:34595190-34595212 GGTTTCCAGGTGTGTGTGTAAGG - Intronic
1179056509 21:37940649-37940671 GGTTACCAGGGGTTTGGGGGAGG - Intergenic
1179339957 21:40497450-40497472 GGTTTCCAGGGGTGGGGGCAGGG + Intronic
1179680098 21:43013705-43013727 GGGTTCCAGGGGCTAGGGGAGGG - Intronic
1180567237 22:16682270-16682292 GGTTTCCAGGGGCTGGAGGAAGG + Intergenic
1180899960 22:19363545-19363567 GGTTTCCAGGGGTTGGGGAAAGG + Intronic
1180930806 22:19589834-19589856 GGTTACCAGGGGCTAGGGGAGGG - Intergenic
1180945900 22:19693247-19693269 GGTTGCCAGGGGTTGGGGGCAGG - Intergenic
1181397023 22:22629879-22629901 GGGTTCCAGGGGTGTCTGGCAGG + Intergenic
1181499768 22:23309238-23309260 GGGTTCCAGGGGTGTCTGGCAGG + Intronic
1181545523 22:23600005-23600027 GGTGTCAGAGGGTTTGTGGAAGG + Intergenic
1181663365 22:24370904-24370926 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1182900732 22:33896096-33896118 GGTTTCCAGGGACTAGGGGAAGG - Intronic
1183118414 22:35710707-35710729 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1183158875 22:36097152-36097174 GGTTACCAGGGGTTGAGGGAGGG - Intergenic
1183694298 22:39412387-39412409 GGTTGCCAGGGATTAGGGGAGGG + Intronic
1184346873 22:43918929-43918951 GGTTTCCAGGGGCTGGGGGAAGG + Intergenic
1184775889 22:46622488-46622510 GGTTACCGGGGGCTTGGGGAGGG + Intronic
1184926567 22:47645335-47645357 GGTTGCCAGGGGTTGGGGGCAGG - Intergenic
949623804 3:5846044-5846066 GGTAGCCAGGGGTTAGGGGATGG - Intergenic
950203140 3:11058818-11058840 GGTTTCCAGGGGCTGAGGGAGGG - Intergenic
950203343 3:11060052-11060074 GGTTTCCAGGGGCTGGGTGAGGG + Intergenic
950208843 3:11102586-11102608 GGTTACCAGGGGTTGGGGGTTGG - Intergenic
950934373 3:16823811-16823833 GGTTTCCAGGGGTTGGGGACTGG - Intronic
951071556 3:18334768-18334790 GTTTTCCAGGGGCTGGAGGAAGG - Intronic
951617480 3:24564104-24564126 GGTTACCAGGGATGTGGGGAGGG - Intergenic
951758201 3:26116164-26116186 GGTTACCAGAGGTTGGGGGAAGG - Intergenic
952108014 3:30091703-30091725 GGTTTCCAGGGGCTGTGGGAGGG - Intergenic
952757266 3:36881758-36881780 GGTTGCCAGGGGTTTGGGAAGGG - Intronic
952768080 3:36972542-36972564 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
952797745 3:37257082-37257104 GGTTGCTAGGGGTTGGAGGAAGG - Intronic
953637839 3:44677726-44677748 GATTTACAGAGGTTTGGGGAGGG + Intergenic
953678270 3:45020250-45020272 GGTTTCCAGGGGCTTGGGGTGGG - Intronic
953854654 3:46491962-46491984 GGGTTCCAGGGGTGGGAGGAGGG - Intergenic
954825730 3:53371700-53371722 GGGATCCAGAGGGTTGTGGATGG - Intergenic
954897524 3:53989006-53989028 GGTTACCAGGGGTTGGGGGAGGG + Intergenic
955177739 3:56633552-56633574 GGTGTGCAGGAGTTTGTAGATGG - Exonic
955207993 3:56914825-56914847 GGTTGCCAGGGGATGGGGGAGGG + Intronic
955380296 3:58433179-58433201 GGTTACCAGGGGTTTGGGGAAGG + Intronic
955941664 3:64151878-64151900 GGTTTTTAGGGGTTAGGGGATGG + Intronic
956386648 3:68726230-68726252 GATTTGCATGGGTTTTTGGAGGG - Intergenic
956861727 3:73330933-73330955 GGTTGCCAGGGGTTAGAGGGAGG + Intergenic
956949848 3:74269843-74269865 GGTTGCCAGAGGCTGGTGGAAGG + Intronic
956978068 3:74605125-74605147 GGTTACCAGGGGGGTGAGGAGGG + Intergenic
957062445 3:75492983-75493005 GGTTTCCAGGGGCTGCGGGAGGG - Intergenic
957164855 3:76659268-76659290 TATTTCCAGGGGTTGGGGGAAGG + Intronic
958813275 3:98887991-98888013 GGTTACCAGGGTTTTGGGGGAGG - Intronic
959877073 3:111395652-111395674 GGTTGCCAGGGGTTGGGGGCAGG - Intronic
960049080 3:113223616-113223638 GGTTGCCAGGGGCTGGGGGAGGG - Intronic
960083137 3:113562683-113562705 GGTTTCCAGGGACTGGGGGAAGG + Intronic
960852557 3:122071292-122071314 GGTTTCCAGGGGTTGGGGAGGGG - Intronic
960996098 3:123341458-123341480 GGTTTCCAGGAGCTTGGGGGAGG + Intronic
961290946 3:125846431-125846453 GGTTTCCAGGGGCTGCAGGAGGG + Intergenic
961361240 3:126369020-126369042 GGTTGCCAGGGGCTAGTGGGAGG - Intergenic
961403150 3:126661244-126661266 GGCTTCCAGAGGGTTGTGGTCGG + Intergenic
961653521 3:128429158-128429180 AGTTCCCTGGGGTTTGTCGATGG - Intergenic
961896181 3:130169756-130169778 GGTTTCCAGGGGCTACAGGAGGG - Intergenic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962202611 3:133414077-133414099 GGAGTAGAGGGGTTTGTGGAGGG - Intronic
962353734 3:134676408-134676430 GGTTGCCAGGGGTTTGGGGTAGG + Intronic
963269965 3:143276870-143276892 GGTCTCTAGGGGTTTATGGATGG - Intronic
963276512 3:143336720-143336742 GGTTGCCAGGGGTTAGGGTAGGG + Intronic
965124230 3:164604291-164604313 GGTTACCAGGGGCTGGAGGAGGG + Intergenic
965599081 3:170437599-170437621 CGTTTCTAGAGGATTGTGGAAGG + Intronic
966242423 3:177769325-177769347 ATGTTCCAGGGTTTTGTGGAAGG - Intergenic
966415534 3:179686014-179686036 GGTTTCCAGCAGTCTGTGCATGG - Intronic
967173144 3:186839620-186839642 CATTTCTAGGGGTTTGGGGATGG + Intergenic
968159352 3:196412889-196412911 GGTTGCCAGGGGCTGGAGGAAGG + Intronic
968174983 3:196541684-196541706 GGTTTCCAGGGGTCAGAGGCAGG - Intergenic
968257142 3:197286194-197286216 GGTTTTCAGGAGTTTGTGTGGGG + Intronic
968464453 4:743602-743624 GGATTCCCGGGGCTTCTGGATGG - Intronic
969006346 4:4023105-4023127 GGTTTCCAGGGGCTGCAGGAGGG - Intergenic
969806605 4:9614186-9614208 GGTTTCCAGGGGCTGCAGGAGGG + Intergenic
970177203 4:13351437-13351459 GGTTTCCAGTGGTTTGGCCACGG - Intergenic
970267526 4:14305663-14305685 GGTTGCCAGGGGCTGGAGGAAGG + Intergenic
970458497 4:16249392-16249414 AGTTTGCAGAGGTTTGGGGAGGG + Intergenic
970922849 4:21415280-21415302 GGTTGCCAGGGGCTGGAGGAAGG + Intronic
971135158 4:23860304-23860326 GGTTACCAGGGGTGGGGGGAGGG + Intronic
971564919 4:28126022-28126044 GGTTTCTAGGGTTTTGGGGGAGG + Intergenic
972603251 4:40591168-40591190 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
973342014 4:49015042-49015064 GGTTGCCAGGGGTTTGGAGGAGG - Intronic
973766009 4:54163574-54163596 GGTTGCCAGGGGCTTGGAGAAGG - Intronic
973957310 4:56075617-56075639 GGTTGCTAGGGGTTTGGGGGAGG - Intergenic
974147668 4:57967174-57967196 TGTTTGCAGGGAGTTGTGGAGGG + Intergenic
974319289 4:60324115-60324137 AGTTTCTAGCGGTTGGTGGAGGG + Intergenic
975667920 4:76752277-76752299 GATTTCCAGGGGTTAGTAGGAGG + Intronic
975758215 4:77592409-77592431 GGTTGTCAGGGGTTGGGGGAAGG + Intronic
975789626 4:77935006-77935028 GGTTGCCAGGGGCTGGAGGAAGG + Intronic
975836041 4:78423002-78423024 GGTATGCTGGGCTTTGTGGAAGG - Intronic
976398924 4:84586020-84586042 GGTTTACAAGGGTTTGGGTAGGG + Intronic
976830166 4:89306778-89306800 GGTTTCAAGGGCTTTCTGGAGGG - Intronic
977213412 4:94247690-94247712 GGTTGCCAGGGGTTAGGGGGAGG - Intronic
977374740 4:96187720-96187742 GGTTGCCAGGGGTTGGAGGTAGG - Intergenic
978162375 4:105564473-105564495 GGTTTCCAGGGGCTGGGGGAAGG + Intronic
978328979 4:107590541-107590563 GGTTTCCAGGGTCTTGGGGAAGG - Intronic
980547855 4:134292786-134292808 TGTTACCAGGGGTTTGAGGTGGG - Intergenic
981356173 4:143791824-143791846 GGTTGCCAGGGGCTTGGGGAGGG - Intergenic
981367695 4:143922463-143922485 GGTTGTCAGGGGCTTGGGGAGGG - Intergenic
981377494 4:144032708-144032730 GGTTGCCAGGGGCTTGGGGAGGG - Intergenic
982239361 4:153283226-153283248 GGTTGCCAGGGATTAGTGGGAGG - Intronic
982700015 4:158650210-158650232 GTTTTCTAGGGGTTGGGGGAAGG + Intronic
983593626 4:169441712-169441734 GCTTTCCAGGGGCTTGGGAAAGG + Intronic
983822470 4:172212628-172212650 GGTTGCCAGGGGTTCATGAAGGG - Intronic
984548533 4:181134046-181134068 GCCTTCGAGGGCTTTGTGGAAGG + Intergenic
985019557 4:185673150-185673172 GGTTGCCAGGCGCTTGGGGAAGG + Intronic
985262973 4:188131979-188132001 GGTTTCCAGGGACTGGGGGAGGG - Intergenic
985417250 4:189749017-189749039 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
985469607 5:31513-31535 GGTTGCCAGAGGTTGGAGGAGGG - Intergenic
985849803 5:2380677-2380699 GGTTTCCAGGGGTTCTGGGGAGG + Intergenic
986021794 5:3811589-3811611 GGTTGTCAGGGGTTGGGGGAAGG + Intergenic
986217157 5:5730202-5730224 GGTTGCCAGGGGGTGGGGGAAGG - Intergenic
986223514 5:5791826-5791848 GGTTGCCAGGGGCTGGGGGAGGG + Intergenic
986415312 5:7522345-7522367 GGTTTCCAGGGGCTAGGGGTTGG - Intronic
986589133 5:9350630-9350652 GGTGTCCAGGGATTTATTGAGGG - Intronic
986593781 5:9399444-9399466 GATTGCCAGGGGTTGATGGAAGG + Intronic
987087594 5:14484768-14484790 GGTTGCCAGGGGCTTGGGGGTGG - Intronic
987315950 5:16723933-16723955 GGTTGCCAGGGGTCGGGGGAAGG + Intronic
987567798 5:19615700-19615722 GGTTGCCAGGGGTTGAGGGAGGG - Intronic
988587541 5:32521050-32521072 GGTTTCCAGAGGTTAGAAGAAGG + Intergenic
989329455 5:40239279-40239301 GGTTGCCAGGGTTTGGGGGATGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989751261 5:44896506-44896528 GGTTGCCAGGGGATGGGGGAAGG - Intergenic
989804850 5:45590645-45590667 GGTTTCCACAGGTTTGTGGGAGG - Intronic
989954450 5:50341058-50341080 AGTTTCCAGGGGCTGGGGGATGG + Intergenic
989980162 5:50633844-50633866 GGTTGCCAGGGGTTTGGGGATGG + Intergenic
990068819 5:51753023-51753045 GGTTACCAGAGGTTTGGGGAAGG + Intergenic
990425578 5:55685269-55685291 GGTTTCCAGGGGCTGGGGAAAGG - Intronic
990888858 5:60626120-60626142 GGTTTCCAGGGGTTGTGGGGAGG - Intronic
991476328 5:67024064-67024086 GGTGGCCAGGGGTTGGGGGAGGG - Intronic
991606841 5:68411039-68411061 GGTTGCCAGGGGTTGGGGGAAGG - Intergenic
992094095 5:73344413-73344435 GGTTTCCAGGGGCTGGGGGTGGG - Intergenic
992164590 5:74036945-74036967 GGTCACCAGGGGTTGGGGGAAGG + Intergenic
992247982 5:74847297-74847319 GGTTACCAGGGGGTGGTGGGGGG - Intronic
992298926 5:75357480-75357502 GGTTATCATGGGTTTGGGGAAGG + Intronic
992843190 5:80716875-80716897 GGTTACCAGAGCTTTGGGGAGGG - Intronic
993203999 5:84855803-84855825 GGTTGCCAGGGGTTGGGGCAAGG - Intergenic
993251540 5:85531086-85531108 GATTGCCAGAGGTTTGTGGGGGG - Intergenic
993447711 5:88034752-88034774 GGTTGCCAGGGGCTTGAGGGAGG - Intergenic
993705861 5:91169434-91169456 GGTTGCCAGGGGATGGGGGAGGG + Intergenic
993797696 5:92288467-92288489 GGTTTTCATGGGTTTGAGGTAGG - Intergenic
993941300 5:94062541-94062563 GGATTGCAGGGGTCTGTGGTGGG - Intronic
994043969 5:95286959-95286981 GGTTGCCAGGGGTTAGCGGTGGG + Intergenic
994724313 5:103416420-103416442 GGTTCACAGGTGTGTGTGGAGGG + Intergenic
995489165 5:112671971-112671993 AGTTGCCAGGGGTTGGGGGAAGG - Intergenic
995626549 5:114083852-114083874 GGTTTCCAGAGGTTTGGAGTGGG - Intergenic
996120090 5:119661905-119661927 GGTTTCCAGGGGTTAGGGGAAGG - Intergenic
996758982 5:126967980-126968002 GGTTGCCCGGGGCTGGTGGAAGG - Intronic
996895140 5:128472341-128472363 GGTTGGCAGGGGTTTGGGGTGGG + Intronic
997510038 5:134447838-134447860 GGTTTCCAAGTGATTCTGGATGG + Intergenic
997818602 5:137042281-137042303 GGTTCCCAGGGTTTTGAGGTAGG + Intronic
998273210 5:140725958-140725980 GCTCTCCAGGGGTTAGAGGAAGG + Intergenic
998436480 5:142113719-142113741 GGCTTCCAGGGGCTGGAGGAGGG - Intronic
998934605 5:147220893-147220915 GGTTTCCAGGGGTTGGGAGGAGG + Intergenic
999231116 5:150062429-150062451 GGTTGCCAGGGGCTGGAGGAGGG - Intronic
999379858 5:151112956-151112978 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
999511720 5:152259325-152259347 AGTTTCCTGGAGTTTGGGGATGG + Intergenic
999867948 5:155721634-155721656 GGTTGCCAGGGACTTGTGGGAGG - Intergenic
1000382490 5:160641605-160641627 GGGTCCCAGGGGTTGGTGAAAGG - Intronic
1000717509 5:164664449-164664471 GGTTTACAGGGGATGGGGGAAGG + Intergenic
1000939227 5:167340089-167340111 GTGTTCCAGTGTTTTGTGGAAGG - Intronic
1001370416 5:171194372-171194394 GGTTTCCAGGGTTTGGGGGAGGG - Intronic
1001447801 5:171799504-171799526 GGTTGCCAGGGGCTGCTGGAAGG + Intergenic
1001591492 5:172868531-172868553 GGTTGCCAGGGGTTGCGGGAGGG + Intronic
1001621911 5:173093923-173093945 GGTTGCCAGGGGCTGGTGGGTGG - Intronic
1001768137 5:174271082-174271104 GGTTGCCAGGGGCTTGGGGAGGG + Intergenic
1002005858 5:176234227-176234249 GGTTTTCAGGGGTTGGGGAAGGG - Intergenic
1002653256 5:180720201-180720223 GGTTTCCAGGGGCTGCTGGGTGG + Intergenic
1003133758 6:3417271-3417293 GCTTTCCAGAGGTCTGAGGAGGG + Intronic
1003405853 6:5826709-5826731 GGTTACCAGGGGTTGGGGGTTGG + Intergenic
1003414525 6:5896120-5896142 GGGTCCTAGGGGTTTGGGGATGG + Intergenic
1003684538 6:8288129-8288151 GATTTCCAGGGGTTGGGGAAGGG - Intergenic
1004200621 6:13544403-13544425 GGTCACCAGGGGCTTGGGGAGGG - Intergenic
1004320574 6:14628553-14628575 GGTTTCCAGGGGCTGGGGGAAGG - Intergenic
1004490841 6:16113807-16113829 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1004587557 6:17016603-17016625 GGTTACCAGGGGCTTGGGGGTGG - Intergenic
1004735125 6:18398150-18398172 GGTTACCAGGGGCTGGTGGGAGG - Intronic
1005218403 6:23558317-23558339 GGTTACCAGAGGTTGGCGGAGGG - Intergenic
1005424367 6:25685908-25685930 GGTTGCCAGGGCCTTGTGGGAGG - Intronic
1005626010 6:27663179-27663201 GGTTGCCAGGGAGTTGGGGAAGG + Intergenic
1005660402 6:27992801-27992823 GGTTTCCAGGGATTGGTGGGAGG - Intergenic
1005781643 6:29199391-29199413 GGTATCCAGGGCTTAGTGTAAGG + Intergenic
1006130455 6:31865914-31865936 GATGTCCTGGGGCTTGTGGAAGG + Exonic
1006172109 6:32099158-32099180 GGGATCCAGGTGTTTGGGGAAGG - Intronic
1006962434 6:37946858-37946880 GGTTTCCAGGGGCTAGAGGGTGG + Intronic
1007607453 6:43127135-43127157 AGTTTCCAGTGGTTTGGGAAGGG + Intronic
1008322869 6:50139411-50139433 GGTTTACAGGAGTTGGGGGAAGG - Intergenic
1008438811 6:51508428-51508450 AGTTTCCTCGTGTTTGTGGAAGG - Intergenic
1008550303 6:52622922-52622944 GGTTGCCAGGAGTTGGGGGAAGG + Intergenic
1008640317 6:53455712-53455734 GGTTTCTAGGGGCTGGAGGAAGG - Intergenic
1008658158 6:53637385-53637407 GGTTTCCAGGGGCCTGTTGTGGG - Intergenic
1008840087 6:55892429-55892451 GGTTTCCAGGGGCTCGGGGATGG + Intergenic
1009978799 6:70701722-70701744 GCTGTCCAGGGGGTTGAGGAGGG + Intronic
1010225613 6:73486386-73486408 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1010227584 6:73505481-73505503 GGTTACCAGGGGATGGGGGAGGG + Intronic
1010488281 6:76442839-76442861 GGTTACCAGAGGCTGGTGGATGG - Intergenic
1010595854 6:77763256-77763278 TGCTGCCTGGGGTTTGTGGAGGG + Intronic
1010923427 6:81713154-81713176 AGTTTCCAGTTGTTTATGGAAGG + Intronic
1011441843 6:87395696-87395718 GGTTGCCAGGGGTTGGGGGAAGG + Intronic
1011684676 6:89814875-89814897 GGTTTCTAGGGGTTTCTAGGAGG - Intronic
1011755375 6:90493706-90493728 GGTTTCCAGGGGTTGGGGGCAGG + Intergenic
1012126343 6:95433178-95433200 GGTTTCCAGGGGCTGGGGGCAGG + Intergenic
1012963972 6:105652890-105652912 GGTTTCCAGGGGCTTAGGGGTGG - Intergenic
1014201658 6:118615753-118615775 GGTGTCCAGGGTTTTTTGGTAGG - Intronic
1014957733 6:127641873-127641895 TGTTTCCAACGGTTTGAGGAGGG - Intergenic
1015655484 6:135513647-135513669 GGTTTCCAGGGACTAGGGGAAGG + Intergenic
1015771527 6:136773145-136773167 GGTTTCCATGGGAATGTGGAAGG - Intronic
1015887655 6:137935165-137935187 GGTTGCCAGGGGATGGTGGAAGG - Intergenic
1016141453 6:140617008-140617030 GGTTGCCAAGGCCTTGTGGAAGG - Intergenic
1016363410 6:143291440-143291462 GGTTTGCAGGGGTCTCTGAAGGG - Intronic
1016583466 6:145656390-145656412 GGTTTGCAGGAGTTGGTGGTGGG - Intronic
1017122703 6:151039308-151039330 GGTTGCCAGGAGTTGGGGGAGGG + Intronic
1017141589 6:151195786-151195808 GGTTGTCAGGGGTTGGAGGATGG + Intergenic
1017287358 6:152691348-152691370 GGTTGCCAGGGGTTGAAGGAAGG - Intergenic
1017518644 6:155181634-155181656 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1017650375 6:156576114-156576136 TGCTTCCTGGGGTTGGTGGAGGG - Intergenic
1017778370 6:157697190-157697212 GGTGTTCAAGGGTGTGTGGATGG - Intergenic
1018072806 6:160180580-160180602 GGTTGCCAGGGGTTGGGGAAGGG + Intronic
1018198786 6:161377081-161377103 GGATTCCAGGTGTCTGTGGAGGG + Intronic
1018897739 6:168032544-168032566 GGTTTCCAGGCTCTTGTGGCTGG + Intronic
1019025261 6:168956756-168956778 GGCTTCTAAGGGTTTGGGGATGG + Intergenic
1019089922 6:169520005-169520027 GCTTCCCAGGGGTTTAGGGAGGG - Intronic
1019351261 7:555099-555121 TGTTTCCAGGAGTTTCTGGAAGG - Intronic
1019860114 7:3650363-3650385 GGTTTCCAGGGACTAGGGGAAGG - Intronic
1021267227 7:18539738-18539760 GGTTGCCAGGGGTTAGGGTACGG + Intronic
1021465866 7:20943064-20943086 GGTTTCCAGGGGCTTGGGGGAGG + Intergenic
1021648449 7:22809357-22809379 GGTTGCCAGGGGTTAGCGGTAGG + Intergenic
1022079999 7:27010686-27010708 GGTTACCAGGGGCTGGAGGAAGG - Intergenic
1022281376 7:28913729-28913751 GGTTGCCAGGGGCTGGTGGGAGG + Intergenic
1022296218 7:29056353-29056375 GGTTGCCAGGAGTTGGGGGAGGG - Intronic
1022751104 7:33226871-33226893 GGTTTCCAGGGGCTTGGGAAAGG + Intronic
1022759551 7:33332995-33333017 GGTTTCCAGGGGCTGGGGGAGGG - Intronic
1023036398 7:36135179-36135201 GGCTGCCAGGGGTTGGGGGAGGG + Intergenic
1023404979 7:39823956-39823978 GGTTGCCAGGGATTAGTGGGGGG - Intergenic
1023619144 7:42052000-42052022 GGTTTCCTGGGGTTGGGGGCTGG - Intronic
1024357785 7:48433689-48433711 GGTTTCCAGGAGCTGGGGGAGGG - Intronic
1024480517 7:49857189-49857211 GGTTGCCAGGGGTTGGGGGTAGG - Intronic
1024600564 7:50976846-50976868 GGTTTCCAGAGGCTCGGGGATGG - Intergenic
1024704922 7:51946755-51946777 GGTTCTGAGAGGTTTGTGGAAGG + Intergenic
1024772412 7:52738731-52738753 GGTTTCCAGGGGTTGGAGGAAGG - Intergenic
1024861949 7:53854147-53854169 GCTTTCCCGTGGGTTGTGGATGG + Intergenic
1025711581 7:63915276-63915298 GGTTTCCAGGAGCTGGTGGGTGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027492334 7:78844624-78844646 GGTTTCCAGGAGAGGGTGGAGGG + Intronic
1027585850 7:80057639-80057661 GGTTGCCAGGGGCTTGGGGCTGG + Intergenic
1027619031 7:80460300-80460322 GGTTGCCAGGAGTGTGAGGAGGG + Intronic
1028224313 7:88232269-88232291 GGTTACCAGGGGCTGGGGGAGGG + Intergenic
1028635283 7:92981868-92981890 GGTTTCCAGGGATTTGGGGGTGG - Intergenic
1029056387 7:97748430-97748452 GGTTGCCAGGGGCTGGCGGAAGG + Intergenic
1029470980 7:100753982-100754004 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1030004841 7:105107558-105107580 CGTTTCCAGGGTTTTATGTAGGG - Exonic
1030155026 7:106445970-106445992 GGTTACCATGGGTTGGTGGGTGG - Intergenic
1030378009 7:108776099-108776121 GGTTTCCAGGGGTTGGGAGGAGG - Intergenic
1030537993 7:110792853-110792875 GGTTGCCAGGGGCTGGGGGAGGG - Intronic
1030994512 7:116342308-116342330 TGTTTCCAGGAGTTTGGGGGAGG - Intronic
1031100068 7:117469086-117469108 GGTTGCCAGGAGTTTGGGAAAGG - Intronic
1031249264 7:119358370-119358392 GGTTGCCAGGGGTTTGGGAGAGG + Intergenic
1031256993 7:119465569-119465591 GGTTACCAGAGGCTGGTGGAAGG - Intergenic
1031426638 7:121613512-121613534 GGTTTCCAGGGGTTAGGGATGGG + Intergenic
1031805377 7:126301149-126301171 GGTTTCCAGGGGCTGGGAGAAGG - Intergenic
1031906499 7:127465806-127465828 GGTTTTCAGGGGATGGTGGCTGG - Intergenic
1031944928 7:127829857-127829879 GGTTTCCAGGGGCTAGAGGTAGG + Intronic
1032019434 7:128398827-128398849 GGTTCCTGGGGGTCTGTGGATGG + Intronic
1032694853 7:134326229-134326251 GGTTTCGAGGGGCTGGTGGGAGG - Intergenic
1032919023 7:136525377-136525399 GGTTTCCAGGGGCTGGGGGAAGG + Intergenic
1033248638 7:139739720-139739742 GGTTTCCAGGGGCTGTGGGAAGG - Intronic
1033432526 7:141301976-141301998 GGTTGCCAGGGGTTGGGGGAAGG + Intronic
1033543174 7:142375979-142376001 GGGTTGCAGGGGTTGGTGTAGGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1033979221 7:147142956-147142978 TGTTTCCTGGGGTTTGGGGAAGG - Intronic
1034056646 7:148042350-148042372 GGTTGCCAGGGCATGGTGGAGGG + Intronic
1034116032 7:148584619-148584641 GGTTACCACGGGCTGGTGGAAGG - Intergenic
1034125708 7:148669577-148669599 GGTTGCCAGGGGTTGGGGAAAGG - Intergenic
1034261178 7:149756862-149756884 GGTTGCCAGGGATTTGGAGAGGG + Intergenic
1034457008 7:151176053-151176075 GGGGTCCAGGGATGTGTGGAAGG - Intronic
1034679409 7:152917177-152917199 GGTTGCCAGGGGTTGGCGGAGGG - Intergenic
1034953756 7:155319630-155319652 GGTTACCAGGGAATAGTGGAAGG - Intergenic
1035430086 7:158812906-158812928 GGTTGCCATGGGTTGGGGGAGGG + Intronic
1035545057 8:474118-474140 GGCTGCCAGGGGCTGGTGGATGG - Intergenic
1035683790 8:1508334-1508356 GGTTTGCGGGGGTTTGCGGGGGG - Intronic
1035730571 8:1851018-1851040 GGTTGCTAGGGGTTTGCGGGGGG + Intronic
1035995613 8:4543305-4543327 GGTTGCCAGGGGGTGGAGGAAGG - Intronic
1036596386 8:10216581-10216603 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1036776358 8:11615582-11615604 GGTTTCCAAAGGTCTGTGGATGG - Intergenic
1036951089 8:13140060-13140082 GGTTACCAGGGGCTGGGGGAAGG - Intronic
1037161242 8:15775284-15775306 GGTTGCCAGGGGTTGGATGAGGG + Intergenic
1037426406 8:18760405-18760427 GGTTACCAGGGGTCTGGGGATGG - Intronic
1037758121 8:21724550-21724572 GGTTTACAGGGCTTTGTCTAAGG - Intronic
1037899651 8:22680265-22680287 AGTTTTCTGGGGTTTGGGGAGGG - Intergenic
1038012010 8:23482903-23482925 GGTTTCCTGGGCCTTGTGGCAGG - Intergenic
1039234573 8:35487903-35487925 GTTTTCTAGTGGTTTGTGGAAGG + Intronic
1039385535 8:37132334-37132356 GGTTGCCAGGGTTCTGTGGATGG - Intergenic
1040047982 8:42982306-42982328 GGTTACCAGGGGATAGGGGAGGG + Intronic
1040072645 8:43200986-43201008 GGTTTCCCTGGCTTTGTGAATGG + Exonic
1040856183 8:51950406-51950428 GGTTGCCAGGGGATGGGGGAAGG + Intergenic
1041085011 8:54248650-54248672 GGTTACCAGGGGCTGGGGGAAGG + Intergenic
1041503632 8:58568848-58568870 GGTTGCCAGGAGTTTCTAGAAGG - Intronic
1042124253 8:65521394-65521416 GGTTGCCAGGGGCTAGGGGAAGG + Intergenic
1042756390 8:72217829-72217851 GGTTTCCAAGGGCTGGGGGAAGG + Intergenic
1042864722 8:73347166-73347188 GATTTCCAGGGGCTGGGGGAAGG + Intergenic
1043224240 8:77702468-77702490 GGTTACCAGGGGTTGGGGGAAGG - Intergenic
1043494377 8:80783890-80783912 GGTTGCCAGGGGTTGGAGGAAGG - Intronic
1043598123 8:81907584-81907606 GTTTTCTAGTTGTTTGTGGAAGG - Intergenic
1043639017 8:82425667-82425689 GGTTGTCAGGGGTTGGGGGAAGG - Intergenic
1043739688 8:83795149-83795171 GGTTGTCAGGGGTTGGGGGAGGG + Intergenic
1044172587 8:89073916-89073938 GGTTGCCAGTTGTTGGTGGAGGG + Intergenic
1044279279 8:90337566-90337588 GGTTTCCAGTGTATTGTAGAGGG - Intergenic
1044608388 8:94067933-94067955 GGTTGCCAGGGGTTGAGGGAGGG - Intergenic
1044718849 8:95126308-95126330 GGTTGCCAGGTGTTGGGGGAAGG - Intergenic
1044718863 8:95126512-95126534 GGTTGCCAGGTGTTGGGGGAAGG + Intergenic
1044856353 8:96480010-96480032 GGCTGCCAGGGGTTGGGGGAAGG + Intergenic
1044928818 8:97232619-97232641 GGTTTCCATGGCTATGTGAAAGG + Intergenic
1045485092 8:102624893-102624915 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1045976492 8:108135277-108135299 GGTTTCCAGGGGCTGGGGGTAGG + Intergenic
1046062820 8:109159174-109159196 GGTTTCTAGAGGTATGTTGAGGG - Intergenic
1046637149 8:116682460-116682482 GGTTTTGAGAGGTTTTTGGAGGG - Intronic
1047410131 8:124617645-124617667 GGTGCCCAGGGGCTTGTGGTGGG - Intronic
1047465792 8:125112721-125112743 GGTTACCAAGGGATTGGGGAAGG + Intronic
1047475284 8:125222528-125222550 GGTTACCAGAGGTTGGGGGAAGG - Intronic
1047491243 8:125376514-125376536 GGTTACCAGGGGTCTGGGGTAGG - Intergenic
1047503456 8:125460324-125460346 GGTTTCCAGGGGTTGGGGGGTGG + Intergenic
1047793299 8:128227975-128227997 GGTTTCCAGGGGTGGGAGAAGGG - Intergenic
1048027460 8:130599912-130599934 GGTTGCCAGGGGTTGGGGGAGGG - Intergenic
1048265933 8:132985938-132985960 ATTTTGCAGGGGGTTGTGGAGGG + Intronic
1048305552 8:133281601-133281623 GTTTTCTGGGGGTTTGTGGTGGG - Intronic
1048943694 8:139425406-139425428 GGTTGCCAGGGGTTAGAGGCAGG + Intergenic
1049113692 8:140667096-140667118 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1049207176 8:141369029-141369051 GGTTTCACCGGGCTTGTGGAAGG + Intergenic
1049571708 8:143372881-143372903 GGGTTCCAGGGGATGGTGCAGGG + Intronic
1049571814 8:143373149-143373171 GGGTTCCAGGGGATGGTGCAGGG + Intronic
1050974390 9:11918411-11918433 GTTTGCCAGGAGTTTGTGGGAGG + Intergenic
1051812974 9:21071434-21071456 GGTTACCAGGGGCTTGGAGAAGG + Intergenic
1052098787 9:24417520-24417542 GCATTCCAAGGGTTTGTTGAGGG - Intergenic
1052132965 9:24872496-24872518 GGTTTCCAGGAGTTAGAGGTAGG - Intergenic
1052509161 9:29392112-29392134 AGTTTCCAGGGGTTTAGGGTGGG + Intergenic
1052809797 9:33047451-33047473 GGCTTCCAGAGGTGGGTGGAAGG + Intronic
1055162560 9:73148179-73148201 GGTTGCCAGGAGTTGGTGGCAGG - Intergenic
1055178303 9:73349204-73349226 GTTTTCTAGTGGTTTGTGGTAGG - Intergenic
1055582659 9:77723764-77723786 GGTTTCCAAGGGTTAGGGGGAGG + Intronic
1055826161 9:80327467-80327489 GGTTGCCAGAGGTTTAGGGAGGG + Intergenic
1056267155 9:84909089-84909111 GGGTTCCAGGGGTTTATGAATGG - Intronic
1056286751 9:85094828-85094850 GGTTTCCAGGGGCTGGGGGAAGG + Intergenic
1056287994 9:85110778-85110800 GGTTCCCAGGGGCTGGGGGAGGG - Intergenic
1056292175 9:85154742-85154764 GGTTTTCAGAGGTTGGTGGAAGG + Intergenic
1056375562 9:86006621-86006643 GCTTGCCAGGGGTTTGGGGCGGG + Intronic
1056594099 9:87991290-87991312 GGTTGCCAGGGGTTTGTGTGAGG - Intergenic
1056971314 9:91206969-91206991 GGTTGCCAGGGGCTTGGGGGTGG + Intergenic
1057049615 9:91913793-91913815 GGTTTCCAGGGCCTGGGGGAAGG + Intronic
1057058187 9:91980116-91980138 GGTTTCCAGAGGCTGGAGGAAGG + Intergenic
1057309943 9:93936038-93936060 GGTTGCCAGGGTTTGGGGGAAGG + Intergenic
1057524825 9:95789464-95789486 GGTTGCCAGGGGCTGGAGGAGGG - Intergenic
1057728528 9:97587759-97587781 GGTTGCCAGGGGCTGGGGGAGGG - Intronic
1058421807 9:104839998-104840020 GGTTTTCTGGGGGATGTGGAAGG - Intronic
1058484546 9:105430438-105430460 GGTTTCCAGGGGCTGGGTGAGGG - Intronic
1058675328 9:107395321-107395343 GTTTTACAGGGGTTTTTGGATGG - Intergenic
1058681179 9:107441574-107441596 GGCTGCCAGGGGCTGGTGGAAGG + Intergenic
1058683947 9:107464757-107464779 GGATCCCAGGCATTTGTGGAAGG + Intergenic
1058893784 9:109382967-109382989 GGTTGCCAAGGGCTTGGGGAAGG - Intronic
1059205343 9:112459117-112459139 GGTTTCCAGGGACTGGGGGATGG - Intronic
1059344373 9:113618187-113618209 GGTTGCCAGGGGCTGGGGGAGGG - Intergenic
1059442004 9:114313217-114313239 ATTTTCCAGGGGTTGGGGGAGGG - Intergenic
1059708544 9:116846184-116846206 GGTTGCCAGGGGCTGGGGGAAGG + Intronic
1060100449 9:120836012-120836034 GGTTGCCAGGTGCTTGGGGAGGG - Intronic
1060184808 9:121557889-121557911 GATTTCCAGGGCTGAGTGGACGG - Intergenic
1060351312 9:122863092-122863114 GGTTTCTAGGGGTTTAGGGCTGG - Intronic
1060365002 9:123002561-123002583 GGTTTACAAGGTTTTGTGGTTGG + Intronic
1060953678 9:127622144-127622166 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1061503349 9:131016232-131016254 GGTTGCCAGGGGCTGGGGGAGGG + Intronic
1061544364 9:131295665-131295687 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1061674645 9:132208872-132208894 GGCTTCCAGGGGTCTCGGGACGG - Intronic
1061869752 9:133514470-133514492 GGTTCCCGGGGGTCTGTGAAGGG - Intergenic
1062137198 9:134935510-134935532 GTTTTTCCCGGGTTTGTGGAAGG - Intergenic
1062627500 9:137449882-137449904 GGTTTCCAGAGGTCTGGGGTGGG + Intronic
1203635888 Un_KI270750v1:110631-110653 GGTTGCCAGGGGCTGGGGGAAGG + Intergenic
1186208719 X:7227877-7227899 GGTTTCCAGGGGATAGGGGAAGG - Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186251736 X:7675009-7675031 GGTTGCCAGGGGCTGGTGGGAGG + Intergenic
1186479659 X:9886606-9886628 GGTTGCCAGGGGGTGGGGGAGGG - Intronic
1186486304 X:9936848-9936870 GTCCTCCAGGGGTTCGTGGAGGG - Intronic
1186494062 X:9997743-9997765 GGTTTCCAGGGACTGGGGGAGGG + Intergenic
1186625475 X:11288666-11288688 GGTTGCCAGGGGTTGAGGGAAGG - Intronic
1187305695 X:18093454-18093476 GGATTGCAGGTGTATGTGGAGGG + Intergenic
1187430120 X:19215280-19215302 GGTTCCCAGGGGCTTGGAGAGGG - Intergenic
1187647374 X:21363299-21363321 GGTTACCAGGGGCTGGGGGAAGG - Intergenic
1187674954 X:21707104-21707126 GGTTGCCAGGGGCTTGGGGTGGG - Intronic
1187800567 X:23058041-23058063 GGTTTCCAGGTGTTAGGGGAAGG + Intergenic
1187947540 X:24441130-24441152 GGTTGCCAGGAGTTGGAGGAGGG - Intergenic
1188299603 X:28491592-28491614 GGTTTCCAGGGGCTGGAGGTGGG - Intergenic
1188388014 X:29585202-29585224 GGTTTCCAGGGGATAGAGGTGGG - Intronic
1188521337 X:31041659-31041681 GGTTGCCAGGGGTTAGGGAAGGG + Intergenic
1188559640 X:31453107-31453129 GGTTTCCAGGGGCTGGGGGCAGG + Intronic
1188995286 X:36877490-36877512 GGTTACCAGGGGCTTTGGGAGGG + Intergenic
1189120247 X:38386464-38386486 GGTTGCCAGGGGTTGGAGGTGGG - Intronic
1189272705 X:39762356-39762378 GGTTGCCAGGGGCTGGGGGAAGG - Intergenic
1189405660 X:40720691-40720713 CGCTGCCTGGGGTTTGTGGAAGG - Intronic
1189791512 X:44609709-44609731 GGTTGCCAGGGGCTGGGGGATGG + Intergenic
1189891874 X:45611026-45611048 GGATTCCAGAGGTTTGTGTCAGG + Intergenic
1190294808 X:49019770-49019792 GGTTACCAGGGCCTTGGGGATGG - Intergenic
1190399400 X:50016743-50016765 GGTTGCCAGGGGTTTAGGGTGGG - Intronic
1190498732 X:51054089-51054111 TGCTTCTAGGGGTTTGGGGAGGG + Intergenic
1191970353 X:66807683-66807705 GGTTTTCAGGGGTTGGAGCATGG - Intergenic
1192664458 X:73073613-73073635 GGTTACCAGGGGTTGGTGGCAGG - Intergenic
1193137278 X:77985828-77985850 GGTTTCCAGGGGTTAGAGGTAGG - Intronic
1193666845 X:84329799-84329821 GGTTACCAAGGGCTTGTGGGAGG - Intronic
1193878036 X:86886222-86886244 GGTTTCCAAGGGTTGGGGAAGGG + Intergenic
1194002359 X:88446265-88446287 GGTTACCAGGGGCTTGGGGTGGG + Intergenic
1194209603 X:91055396-91055418 GGTTTCCAGGGGCTTGGAGGAGG + Intergenic
1194362366 X:92968730-92968752 GGTTACCAGGGGTTGAGGGAAGG - Intergenic
1194715078 X:97278491-97278513 GGTTGCCAGGGGTTAGGGGGAGG - Intronic
1194891690 X:99386378-99386400 GGTTTTCAGGGGCTGGGGGAAGG - Intergenic
1195201130 X:102551251-102551273 GGTTTGCAGAAGTTTGGGGAGGG - Intergenic
1195529160 X:105932010-105932032 GGTTATCAGGGGTTAGAGGAGGG - Intronic
1195676846 X:107513121-107513143 GGTTTCCAGGTATTTGTGAAAGG + Intergenic
1195710491 X:107769461-107769483 GGTTACCAGGGGGTAGTGGGAGG + Intronic
1195860186 X:109375092-109375114 GATTTCCAAGGATATGTGGAGGG + Intronic
1195982070 X:110590165-110590187 GGTTGCCAGAGGTTTGCGGAAGG + Intergenic
1196051909 X:111314528-111314550 GGTTTCCAAGGGTTGGAGGAAGG + Intronic
1196476900 X:116097810-116097832 GCTTTACAGAGATTTGTGGATGG - Intergenic
1196716329 X:118814713-118814735 GGTTGCCAGGGGTTGGGGGTAGG - Intergenic
1196839745 X:119848450-119848472 GGTTGCCAGGGGCTGGAGGAAGG + Intronic
1197249852 X:124204215-124204237 GGTTGCCAGGGGCTGGGGGAAGG - Intronic
1197802039 X:130360942-130360964 GGTTGCCAGGGGCTAGGGGAAGG - Intronic
1198000688 X:132432501-132432523 GGTTGCCAGGGTCTTGTGAAGGG - Intronic
1198007701 X:132515492-132515514 GGTTGCCAGGGGTAGGAGGAGGG + Intergenic
1198096323 X:133383403-133383425 GGTTGCCAGGAGTTGATGGAAGG + Intronic
1198269778 X:135045682-135045704 GGTTGCCTGGGGCTTGGGGAAGG - Intergenic
1198368069 X:135963109-135963131 GGTTGCCAGGGGCTCGGGGATGG + Exonic
1198788501 X:140316881-140316903 GGTTTCCAGGGGCTAGGAGAAGG + Intergenic
1198862980 X:141090420-141090442 GGTTTCCAGGGTCTGCTGGAAGG + Intergenic
1198899712 X:141496967-141496989 GGTTTCCAGGGTCTGCTGGAAGG - Intergenic
1199697303 X:150351881-150351903 GGTTTCCAGGGGCTGAGGGATGG - Intergenic
1199861483 X:151804255-151804277 GGTTACCAGAGGCTGGTGGAGGG - Intergenic
1199931264 X:152525440-152525462 GGTTGCCAGGGGCTAGTGAAGGG + Intergenic
1200120206 X:153786564-153786586 GGGTGCCAGGGGTTGGGGGAAGG + Intronic
1200130743 X:153843290-153843312 GGTTGCCAGGGGCTAGAGGAGGG - Intergenic
1200158699 X:153993076-153993098 GGTTTCCAGGGGCTGCAGGAGGG - Intergenic
1200670613 Y:6084955-6084977 GGTTACCAGGGGTTGAGGGAAGG - Intergenic
1200941754 Y:8789791-8789813 GGTTTCCAGGGAGTAGGGGAAGG + Intergenic
1201239184 Y:11941854-11941876 GGGTTCCAGGGGATTGAGGAAGG + Intergenic
1201579703 Y:15498204-15498226 GGTTTCCAGGGGTGGGGGGAAGG - Intergenic