ID: 927750443

View in Genome Browser
Species Human (GRCh38)
Location 2:25664829-25664851
Sequence CTAGCGCTTTAGCATCGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927750443_927750448 29 Left 927750443 2:25664829-25664851 CCATGACGATGCTAAAGCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 927750448 2:25664881-25664903 GCCCCCTCCAGGGCAACATGAGG 0: 1
1: 0
2: 1
3: 19
4: 168
927750443_927750447 19 Left 927750443 2:25664829-25664851 CCATGACGATGCTAAAGCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101
927750443_927750446 18 Left 927750443 2:25664829-25664851 CCATGACGATGCTAAAGCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 927750446 2:25664870-25664892 TGTGTCACATCGCCCCCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927750443 Original CRISPR CTAGCGCTTTAGCATCGTCA TGG (reversed) Intronic