ID: 927750444

View in Genome Browser
Species Human (GRCh38)
Location 2:25664854-25664876
Sequence TGACACAATAGAAAGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 1, 1: 7, 2: 5, 3: 74, 4: 701}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927750444_927750454 12 Left 927750444 2:25664854-25664876 CCCATTTTCTTTCTATTGTGTCA 0: 1
1: 7
2: 5
3: 74
4: 701
Right 927750454 2:25664889-25664911 CAGGGCAACATGAGGCCTCAAGG 0: 1
1: 0
2: 1
3: 25
4: 215
927750444_927750455 19 Left 927750444 2:25664854-25664876 CCCATTTTCTTTCTATTGTGTCA 0: 1
1: 7
2: 5
3: 74
4: 701
Right 927750455 2:25664896-25664918 ACATGAGGCCTCAAGGAATAAGG 0: 1
1: 0
2: 1
3: 15
4: 140
927750444_927750446 -7 Left 927750444 2:25664854-25664876 CCCATTTTCTTTCTATTGTGTCA 0: 1
1: 7
2: 5
3: 74
4: 701
Right 927750446 2:25664870-25664892 TGTGTCACATCGCCCCCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 142
927750444_927750448 4 Left 927750444 2:25664854-25664876 CCCATTTTCTTTCTATTGTGTCA 0: 1
1: 7
2: 5
3: 74
4: 701
Right 927750448 2:25664881-25664903 GCCCCCTCCAGGGCAACATGAGG 0: 1
1: 0
2: 1
3: 19
4: 168
927750444_927750447 -6 Left 927750444 2:25664854-25664876 CCCATTTTCTTTCTATTGTGTCA 0: 1
1: 7
2: 5
3: 74
4: 701
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927750444 Original CRISPR TGACACAATAGAAAGAAAAT GGG (reversed) Intronic