ID: 927750445

View in Genome Browser
Species Human (GRCh38)
Location 2:25664855-25664877
Sequence GTGACACAATAGAAAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 675}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927750445_927750446 -8 Left 927750445 2:25664855-25664877 CCATTTTCTTTCTATTGTGTCAC 0: 1
1: 0
2: 2
3: 56
4: 675
Right 927750446 2:25664870-25664892 TGTGTCACATCGCCCCCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 142
927750445_927750448 3 Left 927750445 2:25664855-25664877 CCATTTTCTTTCTATTGTGTCAC 0: 1
1: 0
2: 2
3: 56
4: 675
Right 927750448 2:25664881-25664903 GCCCCCTCCAGGGCAACATGAGG 0: 1
1: 0
2: 1
3: 19
4: 168
927750445_927750457 30 Left 927750445 2:25664855-25664877 CCATTTTCTTTCTATTGTGTCAC 0: 1
1: 0
2: 2
3: 56
4: 675
Right 927750457 2:25664908-25664930 AAGGAATAAGGAAAGAACACAGG 0: 1
1: 0
2: 5
3: 93
4: 1033
927750445_927750454 11 Left 927750445 2:25664855-25664877 CCATTTTCTTTCTATTGTGTCAC 0: 1
1: 0
2: 2
3: 56
4: 675
Right 927750454 2:25664889-25664911 CAGGGCAACATGAGGCCTCAAGG 0: 1
1: 0
2: 1
3: 25
4: 215
927750445_927750455 18 Left 927750445 2:25664855-25664877 CCATTTTCTTTCTATTGTGTCAC 0: 1
1: 0
2: 2
3: 56
4: 675
Right 927750455 2:25664896-25664918 ACATGAGGCCTCAAGGAATAAGG 0: 1
1: 0
2: 1
3: 15
4: 140
927750445_927750447 -7 Left 927750445 2:25664855-25664877 CCATTTTCTTTCTATTGTGTCAC 0: 1
1: 0
2: 2
3: 56
4: 675
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927750445 Original CRISPR GTGACACAATAGAAAGAAAA TGG (reversed) Intronic