ID: 927750447

View in Genome Browser
Species Human (GRCh38)
Location 2:25664871-25664893
Sequence GTGTCACATCGCCCCCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927750444_927750447 -6 Left 927750444 2:25664854-25664876 CCCATTTTCTTTCTATTGTGTCA 0: 1
1: 7
2: 5
3: 74
4: 701
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101
927750445_927750447 -7 Left 927750445 2:25664855-25664877 CCATTTTCTTTCTATTGTGTCAC 0: 1
1: 0
2: 2
3: 56
4: 675
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101
927750443_927750447 19 Left 927750443 2:25664829-25664851 CCATGACGATGCTAAAGCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927750447 Original CRISPR GTGTCACATCGCCCCCTCCA GGG Intronic
907290452 1:53409305-53409327 GAGTCCCATAGCCCCCTGCATGG - Intergenic
918083374 1:181224389-181224411 TTTTCACATCGCCTCATCCATGG - Intergenic
919502268 1:198351987-198352009 GTGTCCCCTCTCCCCATCCACGG + Intergenic
920687079 1:208117491-208117513 GGGTCACAGCACCACCTCCAGGG - Intronic
922831466 1:228556570-228556592 CTCTCACAACGCCCCCACCACGG + Intergenic
922831944 1:228608524-228608546 CTCTCACAACGCCCCCACCACGG + Intergenic
922832505 1:228610765-228610787 CTCTCACAACGCCCCCACCACGG + Intergenic
922833065 1:228613006-228613028 CTCTCACAACGCCCCCACCACGG + Intergenic
922833626 1:228615247-228615269 CTCTCACAACGCCCCCACCACGG + Intergenic
922834185 1:228617488-228617510 CTCTCACAACGCCCCCACCACGG + Intergenic
922834743 1:228619729-228619751 CTCTCACAACGCCCCCACCACGG + Intergenic
922835294 1:228621944-228621966 CTCTCACAACGCCCCCACCACGG + Intergenic
922835853 1:228624164-228624186 CTCTCACAACGCCCCCACCACGG + Intergenic
922836412 1:228626406-228626428 CTCTCACAACGCCCCCACCACGG + Intergenic
922836970 1:228628645-228628667 CTCTCACAACGCCCCCACCACGG + Intergenic
922837529 1:228630887-228630909 CTCTCACAACGCCCCCACCACGG + Intergenic
922838088 1:228633128-228633150 CTCTCACAACGCCCCCACCACGG + Intergenic
922838648 1:228635368-228635390 CTCTCACAACGCCCCCACCACGG + Intergenic
922839206 1:228637593-228637615 CTCTCACAACGCCCCCACCACGG + Intergenic
922839764 1:228639834-228639856 CTCTCACAACGCCCCCACCACGG + Intergenic
922840327 1:228642065-228642087 CTCTCACAACGCCCCCACCACGG + Intergenic
922840887 1:228644306-228644328 CTCTCACAACGCCCCCACCACGG + Intergenic
922841450 1:228646537-228646559 CTCTCACAACGCCCCCACCACGG + Intergenic
1064320633 10:14301165-14301187 GAGTCCCATTGCCCTCTCCATGG - Intronic
1072709937 10:97709631-97709653 GAGTCACATCACCCCTTACAAGG - Intergenic
1072734789 10:97871975-97871997 GTGTAACATTGCCCCCTTCTTGG - Intronic
1074243034 10:111658064-111658086 GTGACACATGGCCCAGTCCAAGG + Intergenic
1075649379 10:124117575-124117597 GTGTCTCTTCGCCCCTGCCAGGG - Intergenic
1076417945 10:130305223-130305245 GTGTCACAATGCCCACTGCAAGG - Intergenic
1083294267 11:61706814-61706836 GTGGCACCTCGTCTCCTCCAGGG - Intronic
1092104872 12:5914273-5914295 GTGTGACATCGTGCCCTCCCAGG - Intronic
1099675342 12:85754511-85754533 GTGTAACACCTCCCCCTTCATGG + Intergenic
1102012641 12:109628044-109628066 ATGTCCCATCGACCCCTTCAAGG - Intergenic
1102053452 12:109879715-109879737 GACTCCCATCTCCCCCTCCAAGG - Intronic
1102200639 12:111055585-111055607 TTCTCTCCTCGCCCCCTCCAGGG - Intronic
1104105926 12:125659286-125659308 GTTTCTCATGGCCCCGTCCAGGG + Exonic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108569374 13:51734089-51734111 GTGTCACACCACACCCTCAAGGG - Intronic
1110273106 13:73613632-73613654 GTGTCACCTGGCCCTCTTCATGG - Intergenic
1113377989 13:109782453-109782475 GCGGCTCGTCGCCCCCTCCAGGG + Exonic
1121778382 14:96606054-96606076 GGGACACAGAGCCCCCTCCATGG - Intergenic
1128742843 15:70095804-70095826 GTTTCACATCCCCCTCCCCACGG - Intronic
1133922655 16:10167592-10167614 GGGTAACATAGCCACCTCCATGG + Intronic
1134860400 16:17555491-17555513 GTGTCTTATCGCCACCACCAGGG + Intergenic
1137540410 16:49357879-49357901 TTGTCACGTCCCCCCCTCCATGG + Intergenic
1139396084 16:66640345-66640367 GTCTCAAATAGCACCCTCCAGGG - Intronic
1140888832 16:79268022-79268044 GAGTCACATCCTCCCCTCTAGGG + Intergenic
1142005321 16:87687025-87687047 CGGTCCCAACGCCCCCTCCAGGG - Intronic
1143723456 17:8829819-8829841 GGGTCCCATGGCCTCCTCCATGG - Intronic
1143765873 17:9137467-9137489 GAGACACATGCCCCCCTCCACGG - Intronic
1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG + Exonic
1146931699 17:36782528-36782550 GTGGCACAGCGGCACCTCCATGG - Intergenic
1158467993 18:57708570-57708592 GTGACACATCCCCACCACCAGGG + Intronic
925900586 2:8506514-8506536 GCCTCACATGGCCCCCTCCTTGG - Intergenic
927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG + Intronic
935217369 2:100984984-100985006 AAGGCCCATCGCCCCCTCCAAGG + Intronic
935729713 2:106055382-106055404 GAGTGACATCGGCCCCCCCAGGG + Intergenic
937217742 2:120323466-120323488 GTGTCACATTGCCCTTTCCTGGG + Intergenic
945777489 2:214125440-214125462 TTGTAACTTCGCCCTCTCCAGGG + Intronic
948897126 2:240932793-240932815 GTGCCACATCCCCCCATCAAGGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170606887 20:17881608-17881630 CTGTCACTTAGCCCCCGCCATGG + Intergenic
1171394597 20:24823910-24823932 GGGTCACATCTTGCCCTCCAGGG + Intergenic
1171414093 20:24965738-24965760 CTGTCACATGGCCCCATCCAGGG - Intronic
1172365765 20:34347827-34347849 ACGTCACATGGACCCCTCCATGG + Intergenic
1175172752 20:57091741-57091763 ATGTCACATCACCCCCTCTCGGG - Intergenic
1175237943 20:57526215-57526237 GTATCCCAGCGCCCCCTGCAGGG - Intergenic
1175238005 20:57526384-57526406 GTCTCCCAGCGCCCCCTACAGGG - Intergenic
1175238169 20:57526834-57526856 GTCTCCCAGCGCCCCCTGCAAGG - Intergenic
1184273433 22:43397537-43397559 GCCTCACATCGCTCACTCCAGGG - Intergenic
1184850035 22:47114842-47114864 GTGACCCATCGCCCCCTCCCTGG - Intronic
1185207549 22:49548801-49548823 GAGGCACAGCGCCCCCTTCAAGG + Intronic
950568482 3:13785887-13785909 GGGGCACATAGCCCCCTCCCTGG - Intergenic
954432655 3:50479527-50479549 GTGTCCCAGTGCCACCTCCAAGG + Intronic
954622140 3:52002379-52002401 CTGTCACAAGGCCCCCTCCATGG - Intergenic
961347575 3:126274109-126274131 GGCTCACATCTCTCCCTCCAGGG + Intergenic
966915981 3:184584215-184584237 GTGTGACATCGCCCTCTACTGGG + Intronic
967776407 3:193390896-193390918 GAGTCCCATTACCCCCTCCATGG + Intergenic
969608281 4:8212963-8212985 GTATCACAGCCGCCCCTCCAAGG - Intronic
977996843 4:103504921-103504943 TTGTCACATAGACCACTCCACGG - Intergenic
978574076 4:110171035-110171057 GTGTCACATTCCTTCCTCCAGGG - Intronic
980442418 4:132866677-132866699 GTGCCACATGGCCCCTGCCAGGG - Intergenic
986341472 5:6793040-6793062 GTGTCACCTGCCCGCCTCCAAGG + Intergenic
986477660 5:8152273-8152295 GTCCCACATCGCCACCTCCCAGG + Intergenic
996962716 5:129270231-129270253 GGCTCACATCGTCCCCTCCTGGG - Intergenic
1006790733 6:36699384-36699406 GTGTCACATCGCAGCCTGCCGGG - Intronic
1007849758 6:44791800-44791822 TTGTCACAACGCCCCCTCCTTGG - Intergenic
1012741116 6:103018053-103018075 GTGGCACAACGCCTCCACCAAGG - Intergenic
1019168931 6:170117729-170117751 GTGACACACCAGCCCCTCCAAGG + Intergenic
1019414754 7:922134-922156 GTGTCAGTGCGGCCCCTCCAGGG - Intronic
1019468229 7:1202197-1202219 ATGCCACATGGCCACCTCCAGGG - Intergenic
1019531518 7:1505934-1505956 GTGTCCCATCTCCTCATCCAGGG + Intergenic
1026538718 7:71261858-71261880 TTTTCACATTGCCACCTCCATGG + Intronic
1033161054 7:138996997-138997019 GTGTCACATCTCTCCTTGCAAGG + Intergenic
1034470914 7:151253902-151253924 GTGACCCATCCCTCCCTCCAGGG - Intronic
1035581210 8:739880-739902 GTGTCACCTCGGTCCCTCCACGG - Intergenic
1036231625 8:7004020-7004042 TTGGGACATAGCCCCCTCCATGG - Intronic
1037027796 8:14060651-14060673 ATGTCACACCGCCCCTTCCAAGG - Intergenic
1039221098 8:35331615-35331637 GAGTCAGAGCACCCCCTCCAAGG - Intronic
1042746462 8:72113037-72113059 GTACCACATCAGCCCCTCCAGGG + Intronic
1043003781 8:74792730-74792752 TTGTCACCTTGCCCCTTCCATGG - Intronic
1047546738 8:125825355-125825377 ATGTCACATCTCATCCTCCAAGG + Intergenic
1049713340 8:144077496-144077518 TTGTCACAGCATCCCCTCCAAGG - Intergenic
1053593157 9:39533791-39533813 GGGGCCCATGGCCCCCTCCAGGG + Intergenic
1054573150 9:66831486-66831508 GGGGCCCATGGCCCCCTCCAGGG - Intergenic
1057018954 9:91681095-91681117 ATATCACGTGGCCCCCTCCAAGG + Intronic
1059161583 9:112040012-112040034 GTATCACCTCCCCTCCTCCATGG + Intergenic
1061808408 9:133148992-133149014 GTGGCACATCGCCGGCCCCAGGG + Intronic
1200017903 X:153179918-153179940 GTTTCACATCGGGCCATCCAGGG - Intronic
1200585729 Y:5003053-5003075 GTGTCCCTTCGGCCCCTCCTGGG + Intronic