ID: 927750447

View in Genome Browser
Species Human (GRCh38)
Location 2:25664871-25664893
Sequence GTGTCACATCGCCCCCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927750444_927750447 -6 Left 927750444 2:25664854-25664876 CCCATTTTCTTTCTATTGTGTCA 0: 1
1: 7
2: 5
3: 74
4: 701
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101
927750445_927750447 -7 Left 927750445 2:25664855-25664877 CCATTTTCTTTCTATTGTGTCAC 0: 1
1: 0
2: 2
3: 56
4: 675
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101
927750443_927750447 19 Left 927750443 2:25664829-25664851 CCATGACGATGCTAAAGCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927750447 Original CRISPR GTGTCACATCGCCCCCTCCA GGG Intronic