ID: 927751427

View in Genome Browser
Species Human (GRCh38)
Location 2:25673632-25673654
Sequence CCCGGCCGCGCGCTCGCGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 135}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927751427_927751438 3 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751438 2:25673658-25673680 GTGGCTTCCGCGCGCGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 77
927751427_927751436 -1 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751436 2:25673654-25673676 GGGCGTGGCTTCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 14
4: 86
927751427_927751444 14 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751444 2:25673669-25673691 GCGCGGGGAGGGGGCGGGAGCGG 0: 1
1: 4
2: 33
3: 460
4: 4988
927751427_927751441 8 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751441 2:25673663-25673685 TTCCGCGCGCGGGGAGGGGGCGG 0: 1
1: 0
2: 6
3: 37
4: 291
927751427_927751437 2 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751437 2:25673657-25673679 CGTGGCTTCCGCGCGCGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 73
927751427_927751440 5 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751440 2:25673660-25673682 GGCTTCCGCGCGCGGGGAGGGGG 0: 1
1: 0
2: 0
3: 21
4: 189
927751427_927751442 9 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751442 2:25673664-25673686 TCCGCGCGCGGGGAGGGGGCGGG 0: 1
1: 1
2: 14
3: 71
4: 489
927751427_927751439 4 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751439 2:25673659-25673681 TGGCTTCCGCGCGCGGGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 92
927751427_927751434 -3 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751434 2:25673652-25673674 GGGGGCGTGGCTTCCGCGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 157
927751427_927751435 -2 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751435 2:25673653-25673675 GGGGCGTGGCTTCCGCGCGCGGG 0: 1
1: 0
2: 4
3: 25
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927751427 Original CRISPR CCCGGCCGCGCGCTCGCGCT GGG (reversed) Exonic