ID: 927751429

View in Genome Browser
Species Human (GRCh38)
Location 2:25673633-25673655
Sequence CCCCGGCCGCGCGCTCGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 226}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927751429_927751435 -3 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751435 2:25673653-25673675 GGGGCGTGGCTTCCGCGCGCGGG 0: 1
1: 0
2: 4
3: 25
4: 127
927751429_927751434 -4 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751434 2:25673652-25673674 GGGGGCGTGGCTTCCGCGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 157
927751429_927751444 13 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751444 2:25673669-25673691 GCGCGGGGAGGGGGCGGGAGCGG 0: 1
1: 4
2: 33
3: 460
4: 4988
927751429_927751440 4 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751440 2:25673660-25673682 GGCTTCCGCGCGCGGGGAGGGGG 0: 1
1: 0
2: 0
3: 21
4: 189
927751429_927751441 7 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751441 2:25673663-25673685 TTCCGCGCGCGGGGAGGGGGCGG 0: 1
1: 0
2: 6
3: 37
4: 291
927751429_927751439 3 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751439 2:25673659-25673681 TGGCTTCCGCGCGCGGGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 92
927751429_927751436 -2 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751436 2:25673654-25673676 GGGCGTGGCTTCCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 14
4: 86
927751429_927751438 2 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751438 2:25673658-25673680 GTGGCTTCCGCGCGCGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 77
927751429_927751437 1 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751437 2:25673657-25673679 CGTGGCTTCCGCGCGCGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 73
927751429_927751442 8 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751442 2:25673664-25673686 TCCGCGCGCGGGGAGGGGGCGGG 0: 1
1: 1
2: 14
3: 71
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927751429 Original CRISPR CCCCGGCCGCGCGCTCGCGC TGG (reversed) Exonic