ID: 927751433

View in Genome Browser
Species Human (GRCh38)
Location 2:25673650-25673672
Sequence GCGCGCGGAAGCCACGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927751433_927751448 28 Left 927751433 2:25673650-25673672 CCGGGGGCGTGGCTTCCGCGCGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 927751448 2:25673701-25673723 CCCCCTCCACCCCGCCCCCGCGG 0: 1
1: 1
2: 14
3: 155
4: 897
927751433_927751444 -4 Left 927751433 2:25673650-25673672 CCGGGGGCGTGGCTTCCGCGCGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 927751444 2:25673669-25673691 GCGCGGGGAGGGGGCGGGAGCGG 0: 1
1: 4
2: 33
3: 460
4: 4988
927751433_927751442 -9 Left 927751433 2:25673650-25673672 CCGGGGGCGTGGCTTCCGCGCGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 927751442 2:25673664-25673686 TCCGCGCGCGGGGAGGGGGCGGG 0: 1
1: 1
2: 14
3: 71
4: 489
927751433_927751441 -10 Left 927751433 2:25673650-25673672 CCGGGGGCGTGGCTTCCGCGCGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 927751441 2:25673663-25673685 TTCCGCGCGCGGGGAGGGGGCGG 0: 1
1: 0
2: 6
3: 37
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927751433 Original CRISPR GCGCGCGGAAGCCACGCCCC CGG (reversed) Intergenic