ID: 927751442

View in Genome Browser
Species Human (GRCh38)
Location 2:25673664-25673686
Sequence TCCGCGCGCGGGGAGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 1, 2: 14, 3: 71, 4: 489}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927751427_927751442 9 Left 927751427 2:25673632-25673654 CCCAGCGCGAGCGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 927751442 2:25673664-25673686 TCCGCGCGCGGGGAGGGGGCGGG 0: 1
1: 1
2: 14
3: 71
4: 489
927751429_927751442 8 Left 927751429 2:25673633-25673655 CCAGCGCGAGCGCGCGGCCGGGG 0: 1
1: 1
2: 2
3: 27
4: 226
Right 927751442 2:25673664-25673686 TCCGCGCGCGGGGAGGGGGCGGG 0: 1
1: 1
2: 14
3: 71
4: 489
927751433_927751442 -9 Left 927751433 2:25673650-25673672 CCGGGGGCGTGGCTTCCGCGCGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 927751442 2:25673664-25673686 TCCGCGCGCGGGGAGGGGGCGGG 0: 1
1: 1
2: 14
3: 71
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927751442 Original CRISPR TCCGCGCGCGGGGAGGGGGC GGG Intergenic