ID: 927751797

View in Genome Browser
Species Human (GRCh38)
Location 2:25676127-25676149
Sequence TGACCAATTCAGAAACTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927751786_927751797 25 Left 927751786 2:25676079-25676101 CCTAGAGGTACCCCACGTTCTAC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 189
927751787_927751797 15 Left 927751787 2:25676089-25676111 CCCCACGTTCTACATGTCTAAAC 0: 1
1: 0
2: 2
3: 6
4: 125
Right 927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 189
927751788_927751797 14 Left 927751788 2:25676090-25676112 CCCACGTTCTACATGTCTAAACT 0: 1
1: 0
2: 0
3: 1
4: 99
Right 927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 189
927751789_927751797 13 Left 927751789 2:25676091-25676113 CCACGTTCTACATGTCTAAACTA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927751797 Original CRISPR TGACCAATTCAGAAACTGGG GGG Intergenic
901903156 1:12384309-12384331 TGCCCAAATCAGAACCTTGGAGG - Intronic
903546661 1:24128269-24128291 TGTCCAATTCAGCACCTTGGAGG - Exonic
903695225 1:25201373-25201395 TGGCCAATTGAGAAATAGGGAGG + Intergenic
904230340 1:29065177-29065199 TGACCAATTGTGAAAATGGAGGG + Intronic
906236672 1:44215410-44215432 TGCCCAAACCAGAAACTTGGGGG + Intronic
906574224 1:46873456-46873478 TTACCAACTCAGAAACATGGGGG - Intergenic
908950265 1:69552725-69552747 TCACCCATTCAGAAGCTGGTAGG + Intergenic
910890901 1:92018992-92019014 TGTCCACTTCAGATACTGAGAGG + Intergenic
911584477 1:99674789-99674811 TGAACAATCCAGAAAGTGGGAGG + Intronic
911917829 1:103721808-103721830 TTACCCATGCAGAAAATGGGGGG + Intronic
912427244 1:109605340-109605362 TCCCAAATTCAGAAACTGGCTGG + Exonic
912705017 1:111905116-111905138 TGACTGATTTAGAAACTGCGTGG + Intronic
914891427 1:151627270-151627292 TGAACAATTAAGTAAATGGGTGG - Intronic
916190770 1:162175882-162175904 TGAACAATTAAGCAAATGGGTGG - Intronic
918075195 1:181165704-181165726 TTCCCAGTCCAGAAACTGGGTGG - Intergenic
923839586 1:237653960-237653982 TGACCCATTCTCAATCTGGGTGG - Intronic
1063687328 10:8249527-8249549 TCACCCAGTCAGAAGCTGGGTGG - Intergenic
1063845520 10:10123310-10123332 TAACCTCTTCAAAAACTGGGTGG - Intergenic
1065751184 10:28889265-28889287 TGAACTATTCACAAACTGGATGG - Intergenic
1066001991 10:31113229-31113251 TGGACCATTCAGAAGCTGGGTGG - Intergenic
1067134276 10:43594473-43594495 TGAAAGCTTCAGAAACTGGGAGG - Intergenic
1067548764 10:47218487-47218509 TGACAAATTAAGAAGCTGGAAGG + Intergenic
1070541542 10:77418740-77418762 TCACCAATTTAGAAAGTTGGGGG - Intronic
1071413664 10:85421296-85421318 TGACAATTTCAAAAACTGGAGGG - Intergenic
1074174379 10:110981616-110981638 TCACCAATTTAGAAACAGTGGGG - Intronic
1074274730 10:111990429-111990451 CTACTAATTCAGAAACTGTGAGG - Intergenic
1075361898 10:121845681-121845703 TGACCAATTCAGTAAATGGATGG + Intronic
1075616801 10:123895817-123895839 TGAAGAACTCAGAAACTGGGGGG - Intronic
1077969182 11:7169831-7169853 TCACCAATTTAGAAGCTGAGAGG + Intergenic
1078493692 11:11794877-11794899 TGACAATTTCAAGAACTGGGTGG - Intergenic
1078931349 11:15914081-15914103 AGGACAATTCAGAAACTGGAAGG - Intergenic
1079909114 11:26287095-26287117 CTACCAAGTCAGAAACTGTGGGG + Intergenic
1080425878 11:32153894-32153916 TTACAGATTCAGAAACTTGGAGG - Intergenic
1081265253 11:41013586-41013608 TAACCATATCATAAACTGGGTGG + Intronic
1084620135 11:70264151-70264173 TTACCAAATCATAAACTGTGGGG + Intergenic
1084723093 11:70921546-70921568 TGCCGAATTCTGAAATTGGGAGG + Intronic
1088542999 11:110932759-110932781 TGACTGATTCAGAGACTGAGAGG - Intergenic
1090848378 11:130548876-130548898 TGGCCAAGTCACACACTGGGTGG + Intergenic
1093317393 12:17667857-17667879 TGACCAAGCGAGAAAGTGGGAGG + Intergenic
1093396845 12:18693322-18693344 AGACCTATGCAGATACTGGGGGG + Intronic
1097111659 12:56663292-56663314 TGACAAATACAGAAGCTGTGAGG + Intergenic
1097477093 12:60071788-60071810 TAACCAATTCAGAAAGAAGGTGG - Intergenic
1101288714 12:103344086-103344108 TGACCAAATTAGAAAAAGGGTGG + Intronic
1103486003 12:121283075-121283097 TGACCAAGTCTCACACTGGGCGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104233305 12:126906677-126906699 TGCCTAATACAGAAACTTGGTGG + Intergenic
1104619711 12:130301927-130301949 TGGCCTGTTCAGAAACTGCGAGG - Intergenic
1104737443 12:131145207-131145229 TGGCCAATTCAGATACTGACTGG - Intergenic
1106053492 13:26214923-26214945 TCACCAATTCAGAGACAGAGTGG - Exonic
1106284115 13:28304211-28304233 GGAACACTTCAGAAAATGGGTGG - Intronic
1108599574 13:51980567-51980589 TGAAGAAATCAGAAACTGGGTGG + Intronic
1108966789 13:56317144-56317166 TGAACAATGCAGAAACTAGAAGG - Intergenic
1110187933 13:72696922-72696944 AGACCAAATCAGAAATAGGGAGG - Intergenic
1112966944 13:105208955-105208977 TGACCAATTCTGAAAATGTCAGG + Intergenic
1115701334 14:35955948-35955970 TGAATAATTCAGAAACTCAGGGG + Intergenic
1115985410 14:39100231-39100253 GGACCAATTGAGAAACAGGTGGG - Intronic
1116067807 14:40006979-40007001 AGACCCATTCTCAAACTGGGTGG + Intergenic
1116530356 14:45965292-45965314 TGACAAATTAGGAAACTGAGGGG - Intergenic
1117746218 14:58872186-58872208 TGGCTAATTCGGAAACTTGGTGG - Intergenic
1120110487 14:80548924-80548946 TGACCAATTTAAAAAATGTGAGG - Intronic
1120470356 14:84916061-84916083 TGAACAATTCTTAAACTGGATGG - Intergenic
1120893229 14:89507630-89507652 TGACTAATTCAGAAACAGCAAGG + Intronic
1126333935 15:47565585-47565607 TGTACAATTCTGAATCTGGGAGG + Intronic
1127762500 15:62152488-62152510 TGAAGAATTCAGAATCTGAGTGG - Intergenic
1129634663 15:77302466-77302488 TGAACAATTAAGAAAATGGGTGG - Intronic
1130967309 15:88706750-88706772 TTACCAAGTCAGAAACTATGGGG + Intergenic
1133762365 16:8809401-8809423 TGAACTTTTAAGAAACTGGGTGG + Intronic
1135727099 16:24863535-24863557 TGGCCCATACAGAAACTGTGCGG - Intronic
1137849086 16:51720781-51720803 TGTCAAATTCAGAAACTAGGAGG + Intergenic
1139098394 16:63733933-63733955 TGACCATTTCATGAACTGGAAGG - Intergenic
1140889556 16:79273240-79273262 TGACCACTGCAGAAGCTGGTGGG - Intergenic
1144736750 17:17559787-17559809 TTCCCCACTCAGAAACTGGGAGG - Intronic
1146821372 17:35985785-35985807 TCTCCTTTTCAGAAACTGGGGGG - Exonic
1149260934 17:54878710-54878732 TTACCAAATCAGAAACTCTGGGG + Intergenic
1149619003 17:58027859-58027881 TGAACAATTAAGAAAATGGATGG + Intergenic
1150101537 17:62428383-62428405 TGACCAATTCAAAAACAGCTGGG + Intronic
1152269260 17:79314122-79314144 TGACCCATTCAGAAACTTTTGGG - Intronic
1153129481 18:1838199-1838221 TGACAAACTCTGAAGCTGGGAGG + Intergenic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1154374884 18:13800985-13801007 TGTCCAGTTCAGATACCGGGAGG + Intergenic
1155878445 18:31114876-31114898 TGACAAAATCAGAGACTGGAGGG - Intergenic
1156834636 18:41537825-41537847 TGAGGAATTCAGAAGCTGGTGGG - Intergenic
1157932595 18:51839808-51839830 TTATCAAATCAGAAACTGTGGGG + Intergenic
1160159519 18:76460578-76460600 TGACCAGTAAAAAAACTGGGAGG + Intronic
1160393728 18:78557300-78557322 TGACCAAGGCAGGAACTAGGTGG - Intergenic
925169571 2:1742918-1742940 TGAACAATTCAGGAAGTGGGCGG - Intronic
925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG + Intronic
925355983 2:3241645-3241667 TGAACAAGTCAGGAACTAGGTGG + Intronic
925439617 2:3873248-3873270 TGACCTTGTCAGAAACTGGTTGG - Intergenic
925520772 2:4742411-4742433 TGAACAATTCAGTAAATGGATGG + Intergenic
925794589 2:7528319-7528341 GGACCAATCCTGAATCTGGGTGG - Intergenic
926285938 2:11488185-11488207 AGACCAACTCGGAAACTCGGGGG + Intergenic
927009297 2:18885865-18885887 TAAGGTATTCAGAAACTGGGTGG + Intergenic
927525512 2:23736612-23736634 TGAGCAATGCAGAAGATGGGTGG + Intergenic
927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG + Intergenic
930772344 2:55140886-55140908 TAACAAATTAACAAACTGGGTGG + Intergenic
930772352 2:55140963-55140985 TAACAAATTAACAAACTGGGTGG + Intergenic
934689088 2:96344259-96344281 TGACTAATTCAGAACCTTAGGGG + Intronic
938807439 2:134819493-134819515 TGACTAATTCAGAAATGAGGTGG - Intergenic
941239487 2:163018002-163018024 AGACCAATGCAGAAGGTGGGTGG - Intergenic
941667114 2:168253228-168253250 TAACCAATACACATACTGGGGGG - Intergenic
944655320 2:201871696-201871718 TAACAAAGTCACAAACTGGGTGG + Intronic
944879510 2:203997691-203997713 TGACTAAATCAGAAACCGTGTGG - Intergenic
945158337 2:206862461-206862483 TCCCCAATTCATGAACTGGGAGG - Intergenic
946177580 2:217930858-217930880 TGACCTATTCTGAAGCAGGGAGG + Intronic
946357490 2:219197300-219197322 TGCCCAAAACAGAAACTGGATGG - Intronic
947756894 2:232572717-232572739 AGACTAATGAAGAAACTGGGAGG + Intronic
1169631689 20:7639490-7639512 TGTTCAATTCAAAAACAGGGCGG - Intergenic
1170746963 20:19108147-19108169 TTTCCAATTCTGAATCTGGGTGG - Intergenic
1174428975 20:50453953-50453975 TGACCATTTCAGAACCTAAGAGG - Intergenic
1176965021 21:15202807-15202829 TGACAAGCTCAGAAACTGGCAGG - Intergenic
1179358277 21:40682292-40682314 TGACCAATACAGAAAGTGGATGG + Intronic
1181906410 22:26200693-26200715 TGACAAATCCAGCAACTGGCTGG - Intronic
1183134592 22:35874409-35874431 TGTCCAATTCAGGAAAGGGGTGG + Intronic
1183819512 22:40334024-40334046 TGCCCAAATCAGAAGGTGGGTGG - Exonic
949462901 3:4313116-4313138 TGACCACTGCAGAAACAGAGTGG + Exonic
953149802 3:40314555-40314577 TAACCATTCCAGAAACGGGGTGG + Intergenic
956244610 3:67168395-67168417 TGACAAATTCAGAAACTTGGAGG - Intergenic
960072117 3:113442191-113442213 TGCCCATTTAAGAAATTGGGTGG - Intergenic
960098687 3:113714575-113714597 TGATCAAAACAAAAACTGGGGGG - Intergenic
960624605 3:119669294-119669316 TTACCAATTCAGAATCAGTGTGG - Exonic
964086716 3:152827670-152827692 TGACCAATGCAGGGACTGGTGGG - Intergenic
965735827 3:171819624-171819646 TGATCAATACAGTGACTGGGAGG - Intergenic
966396380 3:179507983-179508005 TGACCAATTTTGATACTGAGAGG + Intergenic
966815092 3:183883982-183884004 TAACCAAGTCAGAAATTGGAAGG + Intronic
968433662 4:574677-574699 TGACCATTTCTGTATCTGGGAGG - Intergenic
969189474 4:5505413-5505435 TGACAAGTGTAGAAACTGGGAGG + Intergenic
971946723 4:33287856-33287878 TAAATTATTCAGAAACTGGGGGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972713230 4:41619526-41619548 TGACCAATTCAGAACTTTGATGG + Intronic
973327634 4:48879590-48879612 TGACCAGTTCAGAAAAGGGCAGG - Intergenic
975481870 4:74889953-74889975 TCACCAACTCAGAAACTGCATGG + Intergenic
976604039 4:86965900-86965922 TTCCCAATTCAGAAAATTGGAGG + Intronic
979010354 4:115359258-115359280 TGACAAATTCAGTAAATGTGCGG + Intergenic
979093410 4:116516441-116516463 TGACCTAAACATAAACTGGGAGG - Intergenic
979417357 4:120460391-120460413 AGACCAATGCAGAAGGTGGGTGG + Intergenic
980905956 4:138949104-138949126 TGACCCATTGAGAAACTATGCGG - Intergenic
981109112 4:140915456-140915478 TGACAAAGTCAGGATCTGGGAGG - Intronic
982989963 4:162261080-162261102 TGTCCATTTCTGAAACTCGGAGG - Intergenic
984838007 4:184040232-184040254 AGACTAATTAAGAACCTGGGCGG + Intergenic
986296585 5:6444437-6444459 GGACCAACTGAAAAACTGGGAGG + Intergenic
990160370 5:52932272-52932294 CTACCAAATCAGAAACTCGGAGG + Intronic
990334095 5:54755497-54755519 AGAGAAAATCAGAAACTGGGAGG - Intergenic
990675129 5:58175756-58175778 TGACAAAATCACAAACTGAGTGG + Intergenic
991737352 5:69640256-69640278 ACACCAATTCTCAAACTGGGCGG + Intergenic
991760841 5:69916169-69916191 ACACCAATTCTCAAACTGGGCGG - Intergenic
991786490 5:70201932-70201954 ACACCAATTCTCAAACTGGGCGG + Intergenic
991788927 5:70219982-70220004 ACACCAATTCTCAAACTGGGCGG + Intergenic
991813677 5:70495088-70495110 ACACCAATTCTCAAACTGGGCGG + Intergenic
991816807 5:70516372-70516394 ACACCAATTCTCAAACTGGGCGG + Intergenic
991840070 5:70791220-70791242 ACACCAATTCTCAAACTGGGCGG - Intergenic
991878933 5:71202317-71202339 ACACCAATTCTCAAACTGGGCGG + Intergenic
991881373 5:71220346-71220368 ACACCAATTCTCAAACTGGGCGG + Intergenic
992103917 5:73434941-73434963 TAACTAGTTTAGAAACTGGGAGG - Intergenic
992398477 5:76389391-76389413 TTAATAATTCAGAAACTGGCTGG + Intergenic
992958562 5:81936027-81936049 TTACTAATTCAGAAACACGGGGG + Intergenic
993410580 5:87567910-87567932 AGACCAACGCAGAAAGTGGGTGG - Intergenic
998911596 5:146966234-146966256 TGACCAATTCATCCACTAGGTGG - Intronic
1003059817 6:2853952-2853974 TGAACAATTAAGAAAATGGATGG - Intergenic
1003287706 6:4749116-4749138 TGACCTTCTCAAAAACTGGGGGG + Intronic
1003538917 6:7001096-7001118 TTACAAATTCATAGACTGGGGGG + Intergenic
1003886398 6:10524981-10525003 TGCCCAAATTAGAAACCGGGGGG - Intronic
1005547179 6:26883407-26883429 ACACCAATTCTCAAACTGGGCGG + Intergenic
1006223549 6:32516944-32516966 TGACAAATTTAGAAAATGGAGGG - Intergenic
1008091525 6:47298499-47298521 TGAGCAATACAGAAACAGGCAGG - Intronic
1009017940 6:57924481-57924503 ACACCAATTCTCAAACTGGGTGG + Intergenic
1013219952 6:108069576-108069598 CTACCAATTCAGAATCTGAGGGG + Intronic
1015929141 6:138339346-138339368 TGACACTTTCAGAGACTGGGAGG - Exonic
1016172441 6:141036033-141036055 TGAGCAATTCTGAAACTCGTTGG - Intergenic
1016631895 6:146242515-146242537 TAACCATTTGAGAATCTGGGTGG - Intronic
1017524479 6:155230468-155230490 TGACCAGTGCCGAAAGTGGGGGG - Intronic
1018337477 6:162809716-162809738 AGACCAACTCAGTAAGTGGGAGG + Intronic
1019328592 7:451917-451939 TGGGAAAATCAGAAACTGGGCGG - Intergenic
1022896725 7:34757641-34757663 TGATCAAGGCAGAAACTGGGGGG - Intronic
1023923824 7:44650586-44650608 AGATAAATTCAGAAACTGAGAGG + Intronic
1024725542 7:52189678-52189700 TCTCCCATTCAGGAACTGGGAGG - Intergenic
1030923669 7:115424004-115424026 TTACCAATTAAGAAACAGGAGGG - Intergenic
1031843776 7:126779897-126779919 TGAAGAATTCAGAGACTTGGAGG - Intronic
1036105166 8:5830363-5830385 TCAGCAATGCAGAAACTGGCCGG - Intergenic
1036502860 8:9329319-9329341 TGACCTATTCAGGAAATGGGAGG + Intergenic
1039193211 8:35000790-35000812 TCACAAATTCAGAAACTTGCAGG - Intergenic
1040705629 8:50123005-50123027 TGACAGATTCAGAAACTAAGCGG + Intronic
1040993725 8:53379492-53379514 TGACCAATTGAGAAAGCAGGGGG + Intergenic
1041251399 8:55938170-55938192 TGACCCATCCAGAAAATGTGAGG - Intronic
1041401659 8:57451601-57451623 TGAGCATTTCACAAACTGAGTGG + Intergenic
1041469979 8:58197661-58197683 TGACCAATTTAAAAACTGCTGGG - Intronic
1042186031 8:66137027-66137049 TGACCAATTCACAGTCGGGGTGG + Intronic
1044294804 8:90515737-90515759 TTACCAAATCAGACACTGTGAGG - Intergenic
1044309614 8:90678810-90678832 TAACAAAATCAGAAACTGGAGGG - Intronic
1046889681 8:119409056-119409078 CTACAAATCCAGAAACTGGGTGG + Intergenic
1047229023 8:122980193-122980215 GCACCAAGTCAGATACTGGGAGG + Intergenic
1053516982 9:38738901-38738923 GGATCACTTGAGAAACTGGGAGG + Intergenic
1054757080 9:68969640-68969662 TGACCTATTAAGAAAATGGGTGG - Intronic
1056195475 9:84224517-84224539 TGAACGATTCACAAATTGGGTGG - Intergenic
1058382552 9:104393712-104393734 TTATCAATGCAGAAACTGAGAGG + Intergenic
1061166853 9:128927931-128927953 TGACCTATTCGGTCACTGGGGGG - Intronic
1061804765 9:133131744-133131766 TGACCAATTCACAGCCTGGTTGG - Intronic
1185889853 X:3814455-3814477 TGACCGATTTAGAAATTGGGTGG + Intergenic
1187025574 X:15432547-15432569 TGAAGTATTCAGAAACTGAGAGG + Intronic
1187478517 X:19633448-19633470 TGACCAATTCAGATTTGGGGAGG - Intronic
1188775077 X:34206868-34206890 GCACAAACTCAGAAACTGGGGGG - Intergenic
1189391838 X:40582915-40582937 TGAGCAATTCAGAAGCTGACAGG - Intronic
1190953800 X:55171860-55171882 TGACCCATTCAGAAGCTTGCTGG - Intronic
1195594002 X:106667181-106667203 GGAACATTTCAGAAACTTGGGGG + Intronic
1196729426 X:118926172-118926194 TTACCCATTTAAAAACTGGGTGG + Intergenic