ID: 927753825

View in Genome Browser
Species Human (GRCh38)
Location 2:25692932-25692954
Sequence CAGTGAGTGTGTTTAGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927753823_927753825 18 Left 927753823 2:25692891-25692913 CCTGGGGCCATGATTGGATGAGA No data
Right 927753825 2:25692932-25692954 CAGTGAGTGTGTTTAGCATGTGG No data
927753824_927753825 11 Left 927753824 2:25692898-25692920 CCATGATTGGATGAGATCACAAG No data
Right 927753825 2:25692932-25692954 CAGTGAGTGTGTTTAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927753825 Original CRISPR CAGTGAGTGTGTTTAGCATG TGG Intergenic
No off target data available for this crispr