ID: 927762450

View in Genome Browser
Species Human (GRCh38)
Location 2:25771490-25771512
Sequence CTGCTGGAATGGTGGGTGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927762441_927762450 28 Left 927762441 2:25771439-25771461 CCTGCTTTAGTGCCTTCTTGCTG 0: 1
1: 0
2: 1
3: 26
4: 249
Right 927762450 2:25771490-25771512 CTGCTGGAATGGTGGGTGATGGG 0: 1
1: 0
2: 3
3: 24
4: 190
927762442_927762450 16 Left 927762442 2:25771451-25771473 CCTTCTTGCTGTGCTTCTGTGAT 0: 1
1: 0
2: 1
3: 36
4: 339
Right 927762450 2:25771490-25771512 CTGCTGGAATGGTGGGTGATGGG 0: 1
1: 0
2: 3
3: 24
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927762450 Original CRISPR CTGCTGGAATGGTGGGTGAT GGG Exonic
901248123 1:7749810-7749832 CTGGTGGAATGGTTTGTGAGAGG - Intronic
902757856 1:18560928-18560950 CTGCTGGGCTGGTGTGTGGTTGG - Intergenic
903359481 1:22767771-22767793 CTTCTGGAATGGGGGCTGGTGGG - Intronic
906534627 1:46544621-46544643 GTGCAGGATTGGTGGTTGATTGG - Intergenic
906812446 1:48842209-48842231 TTGCTGGAATGATGGGAAATGGG - Intronic
908290926 1:62666249-62666271 CTGATGGTATGGTGGTTAATTGG - Intronic
910178534 1:84456974-84456996 GTGCTTGAATGTTGGGGGATGGG - Intergenic
910340809 1:86184802-86184824 TTGCAGGAATGGTGGGGGATGGG - Intergenic
915606034 1:156951522-156951544 CTGCTCGAAGAGTGGGTCATGGG - Intronic
916064946 1:161128789-161128811 CTTCTGGAATGTTGTTTGATGGG - Intronic
921348246 1:214209110-214209132 CTACGGAAATGGTGGGTGGTGGG - Intergenic
923343462 1:233027266-233027288 GTGGTGGAATGGTGGGGGAGGGG + Intronic
924740780 1:246793324-246793346 CTGCTGGACTGGAGGGGGAGGGG + Intergenic
1064703752 10:18048915-18048937 CAGCTTGAATGATGGATGATAGG + Intergenic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1067524105 10:47028068-47028090 CTGCTGGGATGCTGGGTGGGGGG - Intergenic
1068427819 10:56890432-56890454 CTGATGGAATGTTGGCTAATAGG - Intergenic
1069098283 10:64286938-64286960 AGGCTGGAGTGGTGTGTGATGGG + Intergenic
1069708779 10:70476085-70476107 CTGGTGGAGTGCTGGGTGAGTGG + Intergenic
1070704612 10:78628709-78628731 CTGTTGGAACACTGGGTGATGGG + Intergenic
1072648079 10:97275044-97275066 GTGCTGGAGTGGTGACTGATGGG - Intronic
1076445421 10:130510619-130510641 TTCCTGGAATGGTGGATGCTGGG + Intergenic
1076615116 10:131749916-131749938 CTGCTGGAAAGGCTGGTGAGCGG - Intergenic
1076733711 10:132449955-132449977 CTGCTGGGGTGGGGGGTGCTCGG + Intergenic
1077423116 11:2462189-2462211 GTTCTGGATTGGTGGGTGCTGGG + Intronic
1077483643 11:2828252-2828274 CTGCTGGAAGGTTTGGTGACCGG + Intronic
1077523575 11:3050608-3050630 CTGCTGGCGAGGTGGGTGTTGGG - Intronic
1079417208 11:20250102-20250124 CTACTGAAATGCTGGGTGATCGG + Intergenic
1080344631 11:31310763-31310785 GTGCTGGAATGAAGGGTGTTAGG + Intronic
1080691623 11:34563599-34563621 CTGCTGGCACCGTGGGTGAGGGG + Intergenic
1083151459 11:60794258-60794280 GTGGTGGAAAGGTGGGTGCTGGG + Intronic
1083245139 11:61421042-61421064 CTGTGATAATGGTGGGTGATGGG - Intronic
1083312086 11:61789088-61789110 CTGCAGGGGTGGTGGGTGCTGGG - Exonic
1085877612 11:80427619-80427641 GTGCTTGGATGGTGGATGATAGG - Intergenic
1087161158 11:94949465-94949487 CTTAGGGAATTGTGGGTGATAGG - Intergenic
1087659622 11:100971488-100971510 CTGCTGAAATGGTGAGTGGTGGG + Intronic
1088627067 11:111737171-111737193 CTGTTGGACTGGGAGGTGATAGG + Intronic
1089189252 11:116642137-116642159 GAGGTGGAATTGTGGGTGATGGG + Intergenic
1089440593 11:118513350-118513372 CTCCTGGAAAGGTGGGTGAATGG + Intronic
1089660161 11:119980562-119980584 ATGCTGGAAAGGTGGGTGGGAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091765434 12:3117236-3117258 CTGCTGGAAGGGCTTGTGATGGG + Intronic
1092476415 12:8822684-8822706 CTTCTGCAATGGCTGGTGATAGG - Exonic
1092864458 12:12747832-12747854 CTTCTGGAGTGGTGAGGGATTGG + Intronic
1092998823 12:13976887-13976909 CTGGTGGAATGAGGGGTGTTTGG - Intronic
1093685512 12:22049350-22049372 CTGCTGTAATGGTTGGTTGTTGG - Intronic
1094307318 12:29035345-29035367 CTGCTACAATGGTGGGTGTAAGG + Intergenic
1095372135 12:41481207-41481229 CTCCTGTTATGATGGGTGATAGG - Intronic
1096153183 12:49327344-49327366 CTCCTGGGATGGTGGGTGGGAGG + Intronic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1098347756 12:69524215-69524237 GTGGTGGTATGGTGGGGGATAGG + Intronic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1101222787 12:102658175-102658197 CTGCTGCAGTGGTGGCTGAAAGG - Intergenic
1102346325 12:112163464-112163486 CTGCTGGAGTTGAGGGTGACAGG + Intronic
1103992818 12:124810533-124810555 AGGCTGGAAATGTGGGTGATAGG - Intronic
1105674988 13:22661502-22661524 CTGCTGCCATGATGGTTGATTGG - Intergenic
1106428664 13:29658390-29658412 CTGTTGGAAAGGTGGGTGGGGGG - Intergenic
1107002206 13:35560864-35560886 CTGCTGGTATGGTGGATGCTGGG - Intronic
1107031106 13:35854516-35854538 TTCCTGGGCTGGTGGGTGATGGG + Exonic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1108212567 13:48153034-48153056 CTGTTGGAAGGATGGGAGATGGG - Intergenic
1109231579 13:59764231-59764253 CTCCTGGAAGGGTGGGAGAAAGG + Intronic
1110832306 13:80045434-80045456 CTGGAGGAATGGAGGATGATGGG - Intergenic
1112320047 13:98397546-98397568 ATGCAGGAATGCTGGGTGAAAGG - Intronic
1112463111 13:99620385-99620407 CTGCTGGACTGCTGGCTGATGGG - Intronic
1115801903 14:37004044-37004066 CTGCTGGAATGATGCCTGGTGGG - Intronic
1116938050 14:50762396-50762418 CTTCTGTAATGCTGAGTGATGGG - Intronic
1121099780 14:91242507-91242529 CTGATGGAAGGGTGGGTGGGTGG + Intronic
1121261379 14:92568805-92568827 ATGCTGAAAGGGTGGGTGATGGG + Intronic
1124172575 15:27388617-27388639 GTGCTGGGATGGTAGATGATTGG + Intronic
1124438318 15:29669293-29669315 CTGATGGACTGGTGGGTTAATGG + Intergenic
1125460339 15:39900681-39900703 CTTCTGGAATGGTGGGTCAAAGG - Intronic
1126845977 15:52760951-52760973 CTGCTGGAAGGGTTGGTGACAGG + Intronic
1127329852 15:57928087-57928109 CTGTTGGAAGGTTGGGGGATAGG - Intergenic
1128332402 15:66764058-66764080 CTGAGTGAGTGGTGGGTGATTGG + Intronic
1129799751 15:78405363-78405385 CTGCTGCCCTGGTGGGTGATGGG + Intergenic
1131770835 15:95735729-95735751 CTAATGGAATGGTAGGTTATTGG + Intergenic
1132799187 16:1743312-1743334 CTGCTGAAATGGGGGGCGAGAGG - Intronic
1134508308 16:14825178-14825200 CTGCTGGAATGGAGGGTGGTGGG + Intronic
1134696004 16:16223943-16223965 CTGCTGGAATGGAGGGTGGTGGG + Intergenic
1134849898 16:17470944-17470966 CCGCTGGAGGGGAGGGTGATGGG + Intergenic
1134975821 16:18570745-18570767 CTGCTGGAATGGAGGGTGGTGGG - Intergenic
1136060272 16:27721589-27721611 CAGCTGGAGTGGTGGGTGGAAGG - Exonic
1136698944 16:32115523-32115545 TTGCTGGAATGGGATGTGATAGG - Intergenic
1136799451 16:33058823-33058845 TTGCTGGAATGGGATGTGATAGG - Intergenic
1137043598 16:35637067-35637089 CTGCTGGGAAGGTGGGTGCTGGG + Intergenic
1137393794 16:48102856-48102878 CTGGTGGAATTTTGGGTGTTGGG - Intronic
1137498705 16:48993895-48993917 CTGCTGGGATGGGGAGTGAAGGG - Intergenic
1138679538 16:58675017-58675039 TGGCTGGAGTGGTGTGTGATGGG - Intronic
1142065691 16:88061031-88061053 CTGCTGGAAGGGGGGGTGGGCGG + Intronic
1142851768 17:2707880-2707902 CTGGTGGAAGGGAGGGGGATGGG + Intronic
1143462035 17:7110033-7110055 CTGCTGGGTCGGGGGGTGATAGG - Intronic
1146470012 17:33116626-33116648 CTCCAGGAATGGTGGGGGGTGGG + Intronic
1146650054 17:34601149-34601171 ATGCTGGCATGGAGGGTGTTGGG - Intronic
1148150683 17:45395118-45395140 TTTCTGGAATGGTAGGTGCTGGG - Exonic
1148833991 17:50455742-50455764 CTGCTGGCTGGGTGGGTGATGGG - Intronic
1151650833 17:75468443-75468465 CTGCTGGGATGGGGTGTCATGGG + Intronic
1152080455 17:78184198-78184220 CTGGTGGAGTGGAGGGTGCTTGG - Intronic
1154213139 18:12396876-12396898 CTGTTGGAGTGGTGGGCGATTGG + Intergenic
1157330207 18:46698520-46698542 CTGTTGGCGTGGTGGGTGGTTGG - Intronic
1158348066 18:56535818-56535840 CTCCTGGAATTGTGGATCATGGG - Intergenic
1161389672 19:4014600-4014622 CTGCTGGGTGGGTGCGTGATGGG + Intronic
1163649963 19:18511613-18511635 CCGGTGGTATGGTGGGTGGTGGG - Intronic
1163675463 19:18653529-18653551 CTGATGGAAGGGTGGGTGGATGG - Intronic
1163675500 19:18653640-18653662 CTGATGGAAGGGTGGGTGGACGG - Intronic
1163675578 19:18653872-18653894 CTGATGGAAGGGTGGGTGGATGG - Intronic
1163927925 19:20363051-20363073 CTGTGTGAATGGTGAGTGATTGG + Intergenic
1164769731 19:30799348-30799370 AGGATGGAATGGTGGGTTATTGG + Intergenic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165817103 19:38648894-38648916 GAGCTGGAATGGTGGATAATGGG + Intronic
927044517 2:19263353-19263375 CAGCTGCAACTGTGGGTGATGGG - Intergenic
927241738 2:20925386-20925408 TTCCTGGAGTGGTGGGGGATGGG - Intergenic
927762450 2:25771490-25771512 CTGCTGGAATGGTGGGTGATGGG + Exonic
928388614 2:30890882-30890904 TTGGGGGAATGGTGGGTGAGGGG + Intergenic
928399834 2:30969770-30969792 AAGCTGGAGAGGTGGGTGATTGG - Intronic
928459971 2:31462938-31462960 CTGCTGAAATGGAGGCTGAGAGG + Intergenic
929310213 2:40415537-40415559 CTGCTGGAATGGAGACAGATAGG - Intronic
929557400 2:42934229-42934251 CAGATGGAAAGGTGGGTGTTGGG + Intergenic
929609927 2:43263380-43263402 ATGCTGGGTGGGTGGGTGATTGG + Intronic
929948317 2:46387354-46387376 CTGCTGGAATGGCTGGTTCTAGG - Intergenic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
932575452 2:72960108-72960130 GTGCTGGAATCGAGGGTGGTGGG - Intronic
934884713 2:98014459-98014481 CTGGTGGGCTGGTGGGTGGTGGG - Intergenic
935408244 2:102732314-102732336 TTGCTGGAATAGTAGGTGAGTGG - Exonic
936005412 2:108882851-108882873 CTGCTGGAAGGGTGTGAGGTAGG + Intronic
939965080 2:148602438-148602460 CTTCTGGGAGGGTGGGTGACTGG - Intergenic
940161560 2:150719493-150719515 ATGGTGGCATGGTGGGTGATGGG - Intergenic
946292379 2:218754968-218754990 CTGCTGGCAGGGTGGGTATTTGG - Exonic
947395655 2:229684346-229684368 GGGGTGGAATGGTGGGTGCTCGG - Intronic
948106692 2:235420154-235420176 TTGCTGGAGAGGTGGGTGTTGGG - Intergenic
1169228751 20:3872913-3872935 CTACTGTACTGGTGGGTGGTGGG - Exonic
1171964695 20:31520661-31520683 CTCATGGCAGGGTGGGTGATAGG + Intronic
1172860424 20:38045660-38045682 CTCCAGGAATGGTGGGTGGTGGG + Intronic
1173273481 20:41557776-41557798 CTGATAGAGTGGTGGGGGATAGG - Intronic
1174550548 20:51358333-51358355 CAGGTGGACTGGTGGGTGAGTGG + Intergenic
1177957217 21:27613760-27613782 CTGCTGGAATGAGAGGTGACAGG - Intergenic
1178690913 21:34748893-34748915 CTGTCTGAATGGTGGATGATGGG - Intergenic
1180086034 21:45508304-45508326 TTGCTGGACAGGTGGGTGAGTGG + Intronic
1180593621 22:16960187-16960209 CTTCTGGGATGGTGGGTGGAGGG + Intergenic
1181495177 22:23283620-23283642 CTGCTGTGAAGATGGGTGATGGG - Intronic
1181882856 22:25994983-25995005 ATGCTTGAAGGGTGGGTGACAGG + Intronic
1183381452 22:37492423-37492445 CTGTTGGGAAGGTGGGTGCTGGG - Exonic
1184783178 22:46659180-46659202 CTGCTGGAGTGGAGGCTGAGAGG - Intronic
1184993841 22:48188267-48188289 CTGCTGGGATGCTGAGGGATGGG - Intergenic
1185109086 22:48890768-48890790 CTGATGGGATGGTGGGTCACTGG + Intergenic
949941623 3:9159185-9159207 CTGGTGGGATGGTGGGTGGTGGG - Intronic
951429424 3:22588903-22588925 CTGCTGAAATGATGGGGCATGGG - Intergenic
953050039 3:39332614-39332636 CTGCTGGACCAGTGGGTGTTTGG + Exonic
953733309 3:45468675-45468697 CTGCTGAAAAGGTGGGTCAGAGG + Intronic
955274508 3:57534228-57534250 CTGCTGGGATTGGGGGTGATTGG + Intronic
959344191 3:105172403-105172425 TTTCTAGAATGATGGGTGATAGG - Intergenic
959952352 3:112193842-112193864 TGGCTGGAATTGTGGGTGGTGGG + Intronic
961154482 3:124667173-124667195 CTTTTTGAATGGTGGGTGCTGGG + Intronic
961462273 3:127058511-127058533 CAACTGGGATGGTGGGGGATAGG + Intergenic
961582706 3:127895572-127895594 CTGCAGGAGGGGTGGGCGATGGG + Intergenic
961636745 3:128337876-128337898 CTGCTGGATTGCAGGGTGAATGG - Intronic
962167387 3:133063546-133063568 CATTGGGAATGGTGGGTGATAGG + Intronic
962294742 3:134172882-134172904 CATCGGGCATGGTGGGTGATGGG - Intronic
962315793 3:134358717-134358739 CTGCTGGAAAGGTAGGTGGATGG + Intronic
962428638 3:135298567-135298589 CAGCTGGCATGGCTGGTGATGGG + Intergenic
962845729 3:139272245-139272267 CAGCTGGCATGTTGGGTGAAGGG + Intronic
962924447 3:139978622-139978644 CTGCTGGGAGGATGGGGGATGGG + Intronic
963141836 3:141952613-141952635 CTGCTGGACTGGTGACTGTTTGG + Exonic
963234323 3:142941543-142941565 CTGCTGGAATCTTGGCTGTTTGG - Intergenic
963434510 3:145250770-145250792 TTGTTGGAAGTGTGGGTGATTGG + Intergenic
965976549 3:174630971-174630993 CTTCTGGAGTGGTGTGTGAAAGG - Intronic
966501639 3:180648739-180648761 GTGCTTGAAAGGTGGGAGATTGG - Intronic
968682136 4:1928710-1928732 CTGGAGTCATGGTGGGTGATGGG + Intronic
969545673 4:7826087-7826109 CTGGTAGAATGGTGGGTGAAGGG + Intronic
969995567 4:11308787-11308809 CTTCTAGAATGGTGGGTAGTTGG + Intergenic
973608554 4:52611519-52611541 CTTCTGGAATTTTGGGTCATAGG - Intronic
975491747 4:74996580-74996602 CAGCTGGAATGATGGGAGCTGGG + Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
978073469 4:104499296-104499318 CTGCTAGAATAGTGGGTTCTTGG - Intergenic
978455583 4:108886820-108886842 CTCCTGTAATGGAGGGTGAAAGG - Intronic
980063495 4:128156255-128156277 CAGCTGGACTGGTGGGGGAAGGG - Intronic
980069399 4:128227822-128227844 CTTCTGGACTTGTGGGTGTTGGG + Intergenic
982330789 4:154179734-154179756 ATGCTGGAATGGTGGGGGGTGGG - Intergenic
982557771 4:156890354-156890376 CAGCTGGAATGATGGGTGCAGGG - Intronic
985612247 5:896789-896811 CTGCAGGTATGGGGTGTGATGGG + Exonic
990484556 5:56245168-56245190 GTGCTTGAATGTTGGGTGATTGG - Intergenic
990889026 5:60628903-60628925 CTGCTGAAATGGTGGGAGAAAGG + Intronic
991976001 5:72184116-72184138 CTGCTGGGATGGAGTCTGATAGG + Intronic
991983794 5:72261784-72261806 ATGCTGGAATGTGGGGTAATGGG - Intronic
992773387 5:80069502-80069524 CCCCTGGGATGATGGGTGATGGG + Intronic
999098295 5:149001077-149001099 ATGCAGGAATGGAGGGTGTTAGG - Intronic
999832767 5:155336641-155336663 CAGCTGGAAAGGTGGGAGACTGG - Intergenic
1001099983 5:168806361-168806383 CTGATGGCCTAGTGGGTGATGGG + Intronic
1002365488 5:178706425-178706447 CTGCTGGGATGGTGGCAGAGGGG + Intergenic
1003487952 6:6595817-6595839 GTGGTGGAATGGTTGGGGATGGG - Intronic
1003665156 6:8104139-8104161 TTGCTGGAAAGTTGGGTGTTTGG + Intergenic
1009972562 6:70640555-70640577 CTGCTCGAATGGTGGGGAAATGG - Intergenic
1012308397 6:97689080-97689102 CTACTAGAATGCTGAGTGATTGG + Intergenic
1013088048 6:106873604-106873626 CTGCTGGACTCCTGGGTGCTAGG + Intergenic
1014350875 6:120343891-120343913 CTGCTGGAATGGTTGTTCCTGGG + Intergenic
1019712556 7:2524266-2524288 CTGCTGGAAAGGCGGGGGACAGG - Intronic
1020442721 7:8235267-8235289 CTGCTTGCTTGGTGGGTCATGGG + Intronic
1023610733 7:41967850-41967872 CTGTTGGAATAGTTGCTGATGGG + Exonic
1023789055 7:43737544-43737566 CTGCAGGAATGTTGGGGGTTGGG - Intergenic
1026374046 7:69732280-69732302 CTGTTGTAAAGGTGGGGGATGGG + Intronic
1026508047 7:71003373-71003395 GTGATGAAGTGGTGGGTGATTGG + Intergenic
1027624452 7:80529059-80529081 CTGCTGGAATCTTAGTTGATTGG - Intronic
1029791605 7:102848726-102848748 CTGCTGGAATTATGGGTGTGAGG - Intronic
1032322732 7:130899236-130899258 CTGCTGGAATTATGGGGGGTGGG + Intergenic
1033770705 7:144548558-144548580 ACACTGGAATGGAGGGTGATTGG - Exonic
1035222412 7:157414073-157414095 CTGCCGGGATGGTGGGGGAGGGG - Intronic
1035319310 7:158018204-158018226 CTGCTGAAGTGGTGGGTAACTGG + Intronic
1036268361 8:7286611-7286633 CTGCTGAATTGGTGGGTAAACGG + Intergenic
1040856176 8:51950393-51950415 CTGCTGGAATGGCGGTTGCCAGG + Intergenic
1047310239 8:123685824-123685846 CTGCTGGATTGGTGGTTCAGGGG + Intronic
1050855158 9:10345101-10345123 CAGATGCAATGGTGGGTGATTGG - Intronic
1059828042 9:118055566-118055588 ATTCTGGAATGGTGGTTGCTGGG - Intergenic
1061720100 9:132546211-132546233 CTGCCGGGATGGTGGGTGCTTGG - Intronic
1062050945 9:134446756-134446778 CTGCTGGGCAGGTGGGTGTTGGG - Intergenic
1185566257 X:1097632-1097654 CTGGAGGAAAGGTGGGTGAGAGG + Intergenic
1189217377 X:39337710-39337732 CTCCTGGAAGGGTGGCTGCTTGG + Intergenic
1191955242 X:66636856-66636878 CTACTGGCATGGTGGGTGGGAGG + Intronic
1198539949 X:137627480-137627502 GTGCTGGAATGGCATGTGATAGG + Intergenic