ID: 927775837

View in Genome Browser
Species Human (GRCh38)
Location 2:25902399-25902421
Sequence AGTAGCTATTAGACCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927775831_927775837 -5 Left 927775831 2:25902381-25902403 CCTAAGTTCAAGCCCCAGAGTAG No data
Right 927775837 2:25902399-25902421 AGTAGCTATTAGACCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927775837 Original CRISPR AGTAGCTATTAGACCTTGGT GGG Intergenic
No off target data available for this crispr