ID: 927783914

View in Genome Browser
Species Human (GRCh38)
Location 2:25959313-25959335
Sequence GCCATGAGGGAGCTCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927783914_927783920 5 Left 927783914 2:25959313-25959335 CCCCCTGTGAGCTCCCTCATGGC 0: 1
1: 0
2: 5
3: 35
4: 251
Right 927783920 2:25959341-25959363 TCATATCTTACTCATATCTCTGG 0: 1
1: 1
2: 1
3: 13
4: 160
927783914_927783921 6 Left 927783914 2:25959313-25959335 CCCCCTGTGAGCTCCCTCATGGC 0: 1
1: 0
2: 5
3: 35
4: 251
Right 927783921 2:25959342-25959364 CATATCTTACTCATATCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 180
927783914_927783922 13 Left 927783914 2:25959313-25959335 CCCCCTGTGAGCTCCCTCATGGC 0: 1
1: 0
2: 5
3: 35
4: 251
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927783914 Original CRISPR GCCATGAGGGAGCTCACAGG GGG (reversed) Intronic