ID: 927783915

View in Genome Browser
Species Human (GRCh38)
Location 2:25959314-25959336
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927783915_927783920 4 Left 927783915 2:25959314-25959336 CCCCTGTGAGCTCCCTCATGGCA 0: 1
1: 0
2: 4
3: 24
4: 280
Right 927783920 2:25959341-25959363 TCATATCTTACTCATATCTCTGG 0: 1
1: 1
2: 1
3: 13
4: 160
927783915_927783922 12 Left 927783915 2:25959314-25959336 CCCCTGTGAGCTCCCTCATGGCA 0: 1
1: 0
2: 4
3: 24
4: 280
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165
927783915_927783925 30 Left 927783915 2:25959314-25959336 CCCCTGTGAGCTCCCTCATGGCA 0: 1
1: 0
2: 4
3: 24
4: 280
Right 927783925 2:25959367-25959389 CCTGGACTTAGCTCAGTGCTTGG 0: 1
1: 0
2: 4
3: 44
4: 446
927783915_927783921 5 Left 927783915 2:25959314-25959336 CCCCTGTGAGCTCCCTCATGGCA 0: 1
1: 0
2: 4
3: 24
4: 280
Right 927783921 2:25959342-25959364 CATATCTTACTCATATCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927783915 Original CRISPR TGCCATGAGGGAGCTCACAG GGG (reversed) Intronic