ID: 927783919

View in Genome Browser
Species Human (GRCh38)
Location 2:25959327-25959349
Sequence AAGATATGACTGCTGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927783919_927783925 17 Left 927783919 2:25959327-25959349 CCTCATGGCAGCAGTCATATCTT 0: 1
1: 0
2: 2
3: 9
4: 174
Right 927783925 2:25959367-25959389 CCTGGACTTAGCTCAGTGCTTGG 0: 1
1: 0
2: 4
3: 44
4: 446
927783919_927783921 -8 Left 927783919 2:25959327-25959349 CCTCATGGCAGCAGTCATATCTT 0: 1
1: 0
2: 2
3: 9
4: 174
Right 927783921 2:25959342-25959364 CATATCTTACTCATATCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 180
927783919_927783920 -9 Left 927783919 2:25959327-25959349 CCTCATGGCAGCAGTCATATCTT 0: 1
1: 0
2: 2
3: 9
4: 174
Right 927783920 2:25959341-25959363 TCATATCTTACTCATATCTCTGG 0: 1
1: 1
2: 1
3: 13
4: 160
927783919_927783922 -1 Left 927783919 2:25959327-25959349 CCTCATGGCAGCAGTCATATCTT 0: 1
1: 0
2: 2
3: 9
4: 174
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927783919 Original CRISPR AAGATATGACTGCTGCCATG AGG (reversed) Intronic