ID: 927783922

View in Genome Browser
Species Human (GRCh38)
Location 2:25959349-25959371
Sequence TACTCATATCTCTGGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927783912_927783922 14 Left 927783912 2:25959312-25959334 CCCCCCTGTGAGCTCCCTCATGG 0: 1
1: 0
2: 1
3: 27
4: 264
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165
927783918_927783922 0 Left 927783918 2:25959326-25959348 CCCTCATGGCAGCAGTCATATCT 0: 1
1: 0
2: 0
3: 14
4: 156
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165
927783914_927783922 13 Left 927783914 2:25959313-25959335 CCCCCTGTGAGCTCCCTCATGGC 0: 1
1: 0
2: 5
3: 35
4: 251
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165
927783916_927783922 11 Left 927783916 2:25959315-25959337 CCCTGTGAGCTCCCTCATGGCAG 0: 1
1: 0
2: 2
3: 13
4: 199
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165
927783919_927783922 -1 Left 927783919 2:25959327-25959349 CCTCATGGCAGCAGTCATATCTT 0: 1
1: 0
2: 2
3: 9
4: 174
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165
927783915_927783922 12 Left 927783915 2:25959314-25959336 CCCCTGTGAGCTCCCTCATGGCA 0: 1
1: 0
2: 4
3: 24
4: 280
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165
927783917_927783922 10 Left 927783917 2:25959316-25959338 CCTGTGAGCTCCCTCATGGCAGC 0: 1
1: 0
2: 2
3: 23
4: 241
Right 927783922 2:25959349-25959371 TACTCATATCTCTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927783922 Original CRISPR TACTCATATCTCTGGGTCCC TGG Intronic