ID: 927783925

View in Genome Browser
Species Human (GRCh38)
Location 2:25959367-25959389
Sequence CCTGGACTTAGCTCAGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 446}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927783918_927783925 18 Left 927783918 2:25959326-25959348 CCCTCATGGCAGCAGTCATATCT 0: 1
1: 0
2: 0
3: 14
4: 156
Right 927783925 2:25959367-25959389 CCTGGACTTAGCTCAGTGCTTGG 0: 1
1: 0
2: 4
3: 44
4: 446
927783919_927783925 17 Left 927783919 2:25959327-25959349 CCTCATGGCAGCAGTCATATCTT 0: 1
1: 0
2: 2
3: 9
4: 174
Right 927783925 2:25959367-25959389 CCTGGACTTAGCTCAGTGCTTGG 0: 1
1: 0
2: 4
3: 44
4: 446
927783915_927783925 30 Left 927783915 2:25959314-25959336 CCCCTGTGAGCTCCCTCATGGCA 0: 1
1: 0
2: 4
3: 24
4: 280
Right 927783925 2:25959367-25959389 CCTGGACTTAGCTCAGTGCTTGG 0: 1
1: 0
2: 4
3: 44
4: 446
927783917_927783925 28 Left 927783917 2:25959316-25959338 CCTGTGAGCTCCCTCATGGCAGC 0: 1
1: 0
2: 2
3: 23
4: 241
Right 927783925 2:25959367-25959389 CCTGGACTTAGCTCAGTGCTTGG 0: 1
1: 0
2: 4
3: 44
4: 446
927783916_927783925 29 Left 927783916 2:25959315-25959337 CCCTGTGAGCTCCCTCATGGCAG 0: 1
1: 0
2: 2
3: 13
4: 199
Right 927783925 2:25959367-25959389 CCTGGACTTAGCTCAGTGCTTGG 0: 1
1: 0
2: 4
3: 44
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927783925 Original CRISPR CCTGGACTTAGCTCAGTGCT TGG Intronic