ID: 927785792

View in Genome Browser
Species Human (GRCh38)
Location 2:25973818-25973840
Sequence GGGGTAGAACAGCTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927785785_927785792 -2 Left 927785785 2:25973797-25973819 CCCATGTTGATTTCAAAGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 178
Right 927785792 2:25973818-25973840 GGGGTAGAACAGCTGGTGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 173
927785787_927785792 -3 Left 927785787 2:25973798-25973820 CCATGTTGATTTCAAAGGAAGGG 0: 1
1: 0
2: 1
3: 20
4: 200
Right 927785792 2:25973818-25973840 GGGGTAGAACAGCTGGTGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927785792 Original CRISPR GGGGTAGAACAGCTGGTGCA GGG Intronic
900191199 1:1353035-1353057 TGGGGAGAACAGATGGTGCCTGG + Exonic
900919433 1:5661387-5661409 GGGGTTGAACACCTGCTGCTCGG - Intergenic
901214718 1:7548988-7549010 GGGGTAGAGGTGCTGGTGGAGGG + Intronic
901323989 1:8356212-8356234 GGGGTCGACCAGCGGGTGAACGG + Exonic
902336307 1:15756871-15756893 GGGGTGCAACAGGTGGTTCAGGG + Intronic
903302768 1:22390867-22390889 GAGGTAGAAAAGGTGGTGCTTGG + Intergenic
904407162 1:30299898-30299920 GGGTGAGAACAGCTCTTGCAGGG + Intergenic
904574889 1:31499002-31499024 AAGGAAGAACAGCTGGTCCAAGG + Intergenic
906611441 1:47206536-47206558 GGAGGGGAACAGCTAGTGCAAGG - Intergenic
908693452 1:66809109-66809131 AGGGTAGAACAGTGGTTGCAAGG + Intergenic
912432854 1:109638544-109638566 GGAGTAGAAGAGCAGGAGCAGGG - Intergenic
913686759 1:121239489-121239511 TGGGTAGAACGGCAAGTGCAGGG + Intronic
914038613 1:144027075-144027097 TGGGTAGAACGGCAAGTGCAGGG + Intergenic
915061502 1:153189751-153189773 GGGGTAGTACAGAAGGTCCAGGG + Intergenic
915713817 1:157925621-157925643 GGGTTAGACCAGCAGGTGCGAGG + Intergenic
916361901 1:163979532-163979554 TGGGGAGAACAGCTTGTGAAGGG + Intergenic
916378087 1:164178123-164178145 GGAGTGGAACAGCAGGTGCTTGG - Intergenic
917633668 1:176915245-176915267 CGGGTAGAACACCTGGCCCATGG - Intronic
918451649 1:184664661-184664683 GGGCGAGAACAGCAGGTGCTCGG - Intergenic
920474084 1:206257956-206257978 TGGGTAGAACGGCAAGTGCAGGG + Intronic
1070001639 10:72382536-72382558 GAGTTAGAACAGAAGGTGCAGGG + Intronic
1070654879 10:78264555-78264577 GGGGTGGGAAGGCTGGTGCATGG - Intergenic
1070825516 10:79388264-79388286 GGGGGACACCAGCTGGTGGAGGG + Intronic
1072621094 10:97079882-97079904 GGGGTAGAACTACAGGAGCAAGG + Intronic
1075155584 10:119973892-119973914 GGAGAATAACAGCTGGTGCTGGG + Intergenic
1076831172 10:132995040-132995062 GGGGTAGCTCAGCAGGGGCAGGG + Intergenic
1077354475 11:2108850-2108872 GAGGCAGAACAGCTGGTGGAGGG + Intergenic
1077505836 11:2929641-2929663 GGGGCCGGACAGCTGGGGCACGG - Intergenic
1083779427 11:64910271-64910293 GTGGGAGAAGAGCTGGGGCAGGG + Intronic
1087256299 11:95958117-95958139 GGGTTAGAACTTCAGGTGCAAGG + Intergenic
1090396367 11:126421871-126421893 GGTGCAGAAAAGCTGGTGAAGGG - Intronic
1092063499 12:5569850-5569872 GGGATAGAACAGCTGGGGTGGGG + Intronic
1094480949 12:30881059-30881081 GGGCTAGAACTGCTAGTGAAGGG - Intergenic
1098178908 12:67824398-67824420 GGGGAAGAAAAGCAGATGCATGG + Intergenic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1100449120 12:94688465-94688487 AGGGCAGAATTGCTGGTGCAGGG - Intergenic
1105782216 13:23715353-23715375 GTGGTAGAAAAGTTGCTGCAGGG + Intergenic
1112104158 13:96222447-96222469 GAGGCAAAATAGCTGGTGCAAGG + Intronic
1113381735 13:109811374-109811396 GGGGACACACAGCTGGTGCAAGG - Intergenic
1121789344 14:96687247-96687269 GGGGTAGCAAAGCTGGTGTCAGG - Intergenic
1123464498 15:20505602-20505624 GGGAGAGAAGAGCTGGTGGAGGG + Intergenic
1123653615 15:22495439-22495461 GGGAGAGAAGAGCTGGTGGAGGG - Intergenic
1123744038 15:23304297-23304319 GGGAGAGAAGAGCTGGTGGAGGG - Intergenic
1124275226 15:28321566-28321588 GGGAGAGAAGAGCTGGTGGAGGG + Intronic
1124307475 15:28590027-28590049 GGGAGAGAAGAGCTGGTGGAGGG - Intergenic
1129157630 15:73728663-73728685 GAGGTGAAATAGCTGGTGCAAGG + Intergenic
1129248422 15:74294250-74294272 GGATTCCAACAGCTGGTGCAGGG + Intronic
1132743171 16:1426086-1426108 GGGGTAGAACAGGTGGGGCAGGG - Intergenic
1132878082 16:2149043-2149065 GGGGTCGGACAGGGGGTGCAGGG + Intronic
1132981518 16:2740655-2740677 GGGACAGCACAGGTGGTGCATGG - Intergenic
1133939959 16:10300933-10300955 CGAAAAGAACAGCTGGTGCATGG - Intergenic
1134084914 16:11349672-11349694 GGGGTTGAACAGCAGGATCAGGG + Intronic
1134659374 16:15972218-15972240 GGGGCAAAACAGCTGGGGAAAGG - Intronic
1136485028 16:30566152-30566174 GGAGAATAACAGCTAGTGCATGG + Intergenic
1140406118 16:74712823-74712845 TGGGTAGAATTGCTGGGGCATGG - Intergenic
1144789500 17:17849617-17849639 GGGGAAGAGCAGCATGTGCAGGG + Intronic
1145995697 17:29103610-29103632 GGAGAAGAGCAGCTGCTGCATGG - Exonic
1146165465 17:30584949-30584971 GGGGAGGGACTGCTGGTGCAAGG + Intergenic
1147740434 17:42668224-42668246 GGAGGAGAAGAGCTGCTGCAGGG + Exonic
1149647675 17:58252127-58252149 GGGGTGGAACAGCTGGGTCCTGG - Intronic
1151680015 17:75618115-75618137 TGGGTAGAACACCTGGAGGAGGG - Intergenic
1151815709 17:76470439-76470461 GGGGCAGGGAAGCTGGTGCAGGG + Intergenic
1153299113 18:3577181-3577203 GGTGCAGAGCAGCTGGTGCATGG - Intronic
1154191254 18:12232404-12232426 GGGTGAGTCCAGCTGGTGCAGGG - Intergenic
1156377827 18:36530729-36530751 GGGGTAGAATTGCTGGTCAAGGG + Intronic
1158098675 18:53804687-53804709 GGGGCAGAGCAGCTGGCGGATGG + Intergenic
1160570691 18:79815784-79815806 GGGTTAGAACAGCTGCTTCAGGG - Intergenic
1161103263 19:2431824-2431846 GGGCCAGAGCAGCTGGGGCACGG - Exonic
1161262469 19:3345474-3345496 GGGACAGAACAGGTTGTGCAGGG - Intergenic
1161479732 19:4504526-4504548 GGGTTAGAGCAGCTGCTGGAGGG - Exonic
1162079630 19:8210176-8210198 GGCTTGGAACAGCAGGTGCATGG + Intronic
1162930760 19:13956397-13956419 GGGGTAGACCACCTGGTACTTGG - Exonic
1165133118 19:33645600-33645622 TGGGTGGAACAGCTGTTGGAGGG + Intronic
1165604948 19:37093817-37093839 GAGGTAGAACAGATGGAGAATGG + Intronic
1165998847 19:39865409-39865431 GGGGTAGAATAGATGCTGGAAGG + Intronic
1167846445 19:52168925-52168947 AGGGTAGAACAGTTGTTGCCAGG + Intronic
925383525 2:3445798-3445820 GGAGCAGAAATGCTGGTGCAGGG - Intronic
927555272 2:24026640-24026662 GGGGTAGACCTCCTGGTACATGG - Intronic
927785792 2:25973818-25973840 GGGGTAGAACAGCTGGTGCAGGG + Intronic
928067622 2:28182228-28182250 GGGGGAGAATAGCGTGTGCAGGG + Intronic
928100015 2:28431426-28431448 TGCATAGAACAGCTGGCGCATGG - Intergenic
928864361 2:35900113-35900135 GGGGTAGAACAACAGGTAAAGGG + Intergenic
929589830 2:43137638-43137660 GGCAGAGAACAGCTAGTGCAAGG - Intergenic
930087562 2:47508665-47508687 GGGGAAGAACTGCAGGTGCCTGG + Intronic
930635153 2:53796551-53796573 GTGGGAGAACAGCTTGAGCATGG - Intronic
930671715 2:54158526-54158548 TGGTTAGAATTGCTGGTGCATGG - Intronic
931739341 2:65228001-65228023 GGGGACGAGCAGCTGGCGCACGG + Intronic
932067629 2:68583265-68583287 AGGGTAGTAAAGCTGTTGCAGGG - Intronic
932701845 2:73997528-73997550 GTGGGAGAAGAGCTGGTGCCAGG + Intronic
935222512 2:101027552-101027574 GTGGGAGAGAAGCTGGTGCATGG - Intronic
935377670 2:102416692-102416714 GGGTTAGAACAGCTGGGGCCTGG + Intergenic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
937028685 2:118720345-118720367 GGAGCAGAATAGCTGGAGCAGGG - Intergenic
938072765 2:128317296-128317318 GGGGTAGTTGAGCTGGTCCAGGG - Intronic
940054488 2:149499820-149499842 GGGACAGAACAGCTGGGGGAAGG - Intergenic
940518509 2:154712948-154712970 GCTGTGGAACAGCTGGTGCAAGG + Intronic
943792188 2:191945651-191945673 GAGGAACAACAGGTGGTGCAGGG + Intergenic
945634501 2:212330701-212330723 GAGGCAGAGCAGCTGGTGAATGG - Intronic
946525050 2:220509252-220509274 AGGGTGGGGCAGCTGGTGCAAGG - Intergenic
947713673 2:232329603-232329625 GGTGTAGACCAACTGGTGCAGGG + Intronic
947733115 2:232441841-232441863 GGTGTAGACCAACTGGTGCAGGG + Intergenic
1169021402 20:2333893-2333915 GGGTTGGACCAGCTGATGCAAGG + Intronic
1170124644 20:12949877-12949899 TGGGTAGAGAAGCTGGTGCCAGG + Intergenic
1171202915 20:23256181-23256203 GGGCCAGAGCAGCTGTTGCAGGG + Intergenic
1173225982 20:41162754-41162776 GGGGTGGAAGAGCAGGGGCAGGG - Intronic
1175419030 20:58819882-58819904 GAGGTAGAACAGCTGGGACCCGG + Intergenic
1175863869 20:62164220-62164242 GGGGTAGTACTGCTGGCCCATGG - Exonic
1176048536 20:63104798-63104820 GGGGGAGAGCGGCTGGGGCAGGG + Intergenic
1176117413 20:63439150-63439172 AGGGCAGGGCAGCTGGTGCACGG - Intronic
1179941010 21:44638844-44638866 GGGGTAGACCACCTGGGGCCTGG + Intronic
1180017408 21:45096393-45096415 GGGCCGGCACAGCTGGTGCAGGG - Intronic
1180515598 22:16139897-16139919 TGGGTAGATCAGCTGATGCCAGG + Intergenic
1181960091 22:26616569-26616591 AGGGTGGAACAGCTAGTGGAGGG - Intronic
1182357936 22:29730629-29730651 GGGATGGCACAGCTGGGGCATGG - Exonic
1183010556 22:34943244-34943266 GGTGTAGAACAGCTTGTTCTAGG - Intergenic
1183441119 22:37823696-37823718 GAGGTAGATGAGCAGGTGCACGG - Exonic
949371461 3:3338988-3339010 GGAGTAGAACTGCTGGGTCATGG + Intergenic
949423484 3:3891229-3891251 GGGACAGAACACCTGGGGCAAGG - Intronic
952314547 3:32221234-32221256 GAGGTTGCACAGCTGGTGGATGG - Intergenic
953791654 3:45952154-45952176 GTGTAAGAGCAGCTGGTGCAAGG + Intronic
956114476 3:65904514-65904536 GGGGTAGAACAGTGGGAGCTGGG - Intronic
956262682 3:67362257-67362279 GAGGGAGAACAGCATGTGCAAGG - Intronic
958734491 3:97992975-97992997 GAGGTAGGACACCTGGGGCATGG + Exonic
959878868 3:111419475-111419497 GTGGTGGTACAGGTGGTGCAAGG + Intronic
961362002 3:126373935-126373957 GAGGAAGCAGAGCTGGTGCAGGG - Intergenic
964012583 3:151908783-151908805 GGGGGAGAACACCTGGTTGAGGG - Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
968126000 3:196160700-196160722 GGAGTAAATCAGCTGGGGCAGGG + Intergenic
973271536 4:48267852-48267874 GAGCTGGAACAGCTGGGGCAGGG + Intronic
973974071 4:56244647-56244669 GGGTTAGAACAGCTGGTGTGTGG - Intronic
978302030 4:107281061-107281083 GGGGAAGAATAGCAGATGCAAGG - Intronic
981223090 4:142259413-142259435 GGGGTAGAAGAGATGGAGAAGGG + Intronic
989094509 5:37769237-37769259 GGGGTAGACCAGCAGGAGAAAGG - Intergenic
990598338 5:57333020-57333042 GGGGTTGAAGAGAAGGTGCAGGG + Intergenic
992767627 5:80015668-80015690 GGGGAAGGTCAGCTGTTGCAGGG + Intronic
999082388 5:148856601-148856623 GGGGCAGATCAGCTGCAGCAAGG + Intergenic
999178811 5:149654289-149654311 GGGGCAGGAGTGCTGGTGCAGGG + Intergenic
1002074188 5:176698344-176698366 GGGACAGAACAGGTGGTGGAGGG + Intergenic
1003566933 6:7230009-7230031 GGGGTAGAGCACCTTGCGCATGG - Exonic
1005819799 6:29588426-29588448 GGGGCAGAAGGGCAGGTGCAGGG - Exonic
1012544689 6:100404608-100404630 TGGGAAGAACAGATGGTGAAAGG + Intronic
1013705302 6:112826229-112826251 AGGGTAGAACAGGTGGTGGGAGG + Intergenic
1014715285 6:124857351-124857373 GGAGGAGAACAGGGGGTGCAAGG + Intergenic
1015757068 6:136618356-136618378 TAGCTTGAACAGCTGGTGCAGGG - Intronic
1016289987 6:142518455-142518477 GGGGAGGAACAGCTGGTGTGGGG + Intergenic
1019797504 7:3062727-3062749 TGTGTAGAATTGCTGGTGCATGG + Intergenic
1020874224 7:13673626-13673648 GGGATAGAGCACCTGGGGCAGGG - Intergenic
1022594264 7:31697115-31697137 CAGGTAAAAAAGCTGGTGCAGGG + Exonic
1024989994 7:55225871-55225893 CAGGAAGAACAGCTAGTGCATGG - Intronic
1026858670 7:73770722-73770744 GGGGCAGAGCAGCAGGTGCGCGG - Intergenic
1029737686 7:102473712-102473734 GAGCTGGAACAGCTGGGGCAAGG + Intronic
1031094872 7:117405492-117405514 GGTCTGGAAGAGCTGGTGCAGGG - Intronic
1031162770 7:118188356-118188378 GGGGTAGAACAAGTGGTACTAGG + Exonic
1031693437 7:124818676-124818698 GGGAGAGATCAGCTGGTGGATGG + Intergenic
1031995448 7:128227457-128227479 GGGGTGGCAGAGTTGGTGCAGGG - Intergenic
1032072796 7:128819217-128819239 GAGGAAGAACTGCTGGTGAAGGG + Intronic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1034489339 7:151385052-151385074 GGGGTGGCACAGGTCGTGCAGGG + Intronic
1035216691 7:157372848-157372870 GGAGAAGAACAGCTGGGGAAGGG - Intronic
1039495132 8:37974760-37974782 GGGAAAGAGCAGCTGGTGCTGGG + Intergenic
1039757812 8:40542009-40542031 GAGGCAGAGCAGCAGGTGCAAGG + Intronic
1041687833 8:60660644-60660666 GGGGTGGAACTGCAGGTGCCTGG - Intergenic
1045310890 8:101001532-101001554 GGGCTAGTACAGCTATTGCAGGG - Intergenic
1045672038 8:104565934-104565956 GGGGGAGAAAGGCTGGGGCAGGG + Intronic
1047643637 8:126846949-126846971 GGCCTAGAACAGCTGGGCCAAGG + Intergenic
1048925166 8:139264954-139264976 GGGGCACAGAAGCTGGTGCAGGG + Intergenic
1049487808 8:142875573-142875595 GGGGAGGAAGAGCAGGTGCAGGG + Intronic
1049492583 8:142913146-142913168 GGGGAGGAAGAGCAGGTGCAGGG + Intronic
1051814363 9:21087742-21087764 GGGATAGAGCACCTGGGGCAAGG + Intergenic
1056741167 9:89256655-89256677 GGTGTTCAACACCTGGTGCATGG - Intergenic
1056994757 9:91445516-91445538 GGGGTAGAACAGCTCAGCCAAGG + Intergenic
1057046963 9:91893472-91893494 GGGGAAGAAGGGTTGGTGCAAGG - Intronic
1058813967 9:108666988-108667010 CGGGTAGAACACCATGTGCAGGG + Intergenic
1059814665 9:117899331-117899353 GGGGGAGAAGAGATGGAGCAAGG - Intergenic
1059842985 9:118239241-118239263 AGGGTAAAACAGCTTGTACAAGG + Intergenic
1061586119 9:131569922-131569944 AGGGTACAACAGCTGGTGAAAGG - Intergenic
1061621308 9:131812968-131812990 GGGGAAAAGCAGCTGGTACAGGG - Intergenic
1062017380 9:134297626-134297648 GGGATTGAACAGCCGGTGAAAGG + Intergenic
1062025293 9:134337470-134337492 GGGTTAAAACATCTGGTCCAAGG - Intronic
1189378625 X:40485415-40485437 GGAGTAGAACTGCTGGGTCATGG - Intergenic
1192238848 X:69314004-69314026 GGGGAAGATCAGCTGGGGCGGGG + Intergenic
1192443597 X:71193560-71193582 GGGCAGGAACAGCTGGGGCAGGG - Intergenic
1198264955 X:135000340-135000362 GGCGAAGGAGAGCTGGTGCATGG - Intergenic
1199820307 X:151439036-151439058 GGGGTTAAACAGCTTGTCCATGG + Intergenic